Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Diese Arbeit wurde von NIH AI099854 und AI126742 auf Schlüssel unterstützt.

(1) Glühen des vDNA
<ol><li>Mähdrescher 1 X 10-Puffer (10 X 10 Lager: 100 mM Tris-HCl, pH 8.0, 1 M NaCl 10 mM EDTA), 10 µM Oligo-1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM-Lager) und 10 µM Oligo-2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM-Lager) in einem Endvolumen von 1,5 mL . Aliquoten 25 µL in sechzig 0,2 mL Polymerase-Kettenreaktion (PCR) Röhren. Hinweis: Abhängig von der Anwendung können Oligomere mit Fluorophore oder Tags am 5'-Ende von Oligo 2 oder als eine interne amino-T...

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Retroviren INs bilden einen Komplex mit viralen genomischen DNA führen Integration und weiter den viralen Lebenszyklus Multimeric. Die Anzahl der im Monomeren pro Intasome möglicherweise Tetramers, Octamers oder eventuell höhere Ordnung Multimere11,12,13,14. PFV Intasomes sind, dass ein Tetramer des rekombinanten mit doppelsträngigen DNA-Oligomere, die viralen genomischen DNA zu imitieren e...

Integration des viralen Genoms in das Wirtsgenom ist ein obligatorischer Schritt im Lebenszyklus von allen Retroviren1. Das virale Enzym Integrase (IN) katalysiert die kovalente Verbindung der beiden Enden der viralen DNA-Genom an den Host DNA. Während einer zellulären Infektion gehört eine Vorintegration Komplex, die die Integration vermittelt. Rekombinante IN komplexiert mit doppelten gestrandeten DNA-Oligomere imitiert die virale DNA-enden können auch die Integration in ein Ziel DNA in Vitro2durchführen. Eine gemeinsame Integration Assay in Vitro nutzt ein supercoiled Plasmid als Ziel DNA. Integration der beiden virale DNA-Oligomere (vDNA) auf dem Plasmid führt zu einem linearen Produkt und ist abgestimmte Integration (Abbildung 2A) bezeichnet. Die Integration Tests in Vitro können auch Produkte mit nur ein vDNA kovalent an das Ziel-Plasmid, was zu einem entspannten Kreis trat führen. Dieser halb-Website Integration Produkt scheint ein Artefakt der Assay in Vitro.
IN rekombinanten und vDNA Integration in Vitroverrichten, aber sie sind nicht ideal Reagenzien für das Studium der Dynamik oder die Struktur der komplexe Integration, wenn Monomere IN relevanten Visualisierung verdecken würde. Gereinigte Integration komplexe oder "Intasomes" sind für dynamische Einzelmolekül-Analyse oder strukturelle Studien erforderlich. PFV IN und vDNAs können durch Dialyse aus einem relativ hohen Salzkonzentration Puffer zu einem niedrigeren Salzkonzentration3,4montiert werden. Während der Dialyse, einen Niederschlag Formen. Dieser Niederschlag aus Dialyse entfernt und die Salzkonzentration steigt. Die höheren Salzkonzentration solubilisiert überstürzten enthaltenden PFV-Intasomes. Die Intasomes werden dann durch Größe Ausgrenzung Chromatography (SEC) gereinigt. Rekombinante Prototyp schaumig Virus (PFV) IN nachweislich als ein Monomer in Lösung in Konzentrationen bis zu 225 µM5existieren. SEC Fraktionierung trennt effektiv PFV Intasomes (225.5 kDa), die ein Tetramer des PFV IN und zwei vDNAs umfasst, von Monomeren PFV IN (44,4 kDa) und freie vDNA (24,0 kDa). Der PFV Intasomes können eingefroren werden und Integration Aktivität für mindestens sechs Monate Lagerung bei-80 ° c aufbewahren.
Rekombinante PFV Intasomes kann auch geändert werden, um IN Aminosäure Substitutionen oder abschneiden Mutationen oder vDNAs beschriftet mit Fluorophore oder Biotin4,6erweitert. Die gereinigten PFV Intasomes durchführen ohne weiteres Integration in ein Ziel supercoiled Plasmid DNA in Vitro. Bulk-biochemische Integration-Assays mit Intasomes können die Auswirkungen der IN Mutationen im Hemmer oder sonstigen chemischen Zusätzen testen. Biotinylierte Intasomes kann verwendet werden, Affinität mit Nukleinsäuren oder Proteine zu untersuchen. PFV Intasomes funktionieren bei Umgebungstemperatur zulassend Einzelmolekül-Mikroskopie-Analyse von magnetischen Pinzette Messung die Zeit zwischen den Beitritt der beiden vDNA enden oder Totalreflexion Fluoreszenz, die Intasome Suche auf Ziel zu visualisieren DNA-6. Darüber hinaus wurden PFV Intasomes die erste strukturell sein deutlich beeinflussen das Feld von Retroviren Integration3gekennzeichnet.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A Definition von Funktion und notwendiger Schritt des Lebenszyklus Retrovirus ist die Integration des viralen Genoms in das Wirtsgenom. Alle Retroviren kodiert eine Integrase (IN)-Enzym, das katalysiert die kovalente Verbindung von viralen Host DNA, bekannt als Strang übertragen. Integration kann modelliert in Vitro mit rekombinante Retroviren und DNA-Oligomere imitiert die Enden des Virusgenoms. Um genauer rekapitulieren die Integration-Reaktion, die auftritt, in Vivo, Integration sind komplexe von rekombinanten IN und synthetischen Oligomere durch Dialyse in einem reduzierten Salzgehalt Puffer montiert. Die Integration komplexer, genannt eine Intasome kann durch Größe Ausgrenzung Chromatographie gereinigt werden. Bei Prototyp schaumig Virus (PFV) der Intasome ist ein Tetramer von innen und zwei DNA-Oligomere und ist leicht von Monomeren IN und kostenlose Oligomer DNA getrennt. Die Effizienz der Integration des PFV Intasomes kann unter einer Vielzahl von experimentellen Bedingungen für die Dynamik besser zu verstehen und Mechanik der retroviralen Integration untersucht.

PFV Intasomes werden von rekombinanten IN und vDNA montiert. Nach der Montage sind Intasomes durch SEC (Abbildung 1) gereinigt. Integration-Aktivität der einzelnen Fraktionen ist mit einem supercoiled DNA Ziel- und Agarose Gelelektrophorese (Abbildung 2) untersucht. Dieses Gel wird mit einem fluoreszierenden Scanner eingestellt, erkennt EtBr (und Fluorophor, wenn Fluorophore beschriftet vDNA verwendet wird) abgebildet. Bildanaly...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Rekombinante Retroviren Integrase und DNA-Oligomere imitiert virale DNA enden können einen enzymatisch aktiven Komplex bekannt als ein Intasome bilden. Intasomes können für biochemische, strukturellen und kinetischen Studien verwendet werden. Dieses Protokoll beschreibt, wie zu montieren und zu reinigen Prototyp schaumig Virus Intasomes.

Montage und Reinigung der Prototyp schaumig Virus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Research

JoVE Journal

Immunology and Infection

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Einfach und robust In-vivo- Und In-vitro- Ansatz für das Studium Virusassemblierung

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Forschung

Immunologie und Infektion

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Affinitätsreinigung des Influenza-Virus Ribonukleoproteinkomplexe aus dem Chromatin der infizierten Zellen

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Die Reinigung von Pathogen Vakuolen aus<em&gt; Legionellen</em&gt;-Infizierten Phagozyten

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Rettung von rekombinanten Newcastle Disease Virus aus cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophilen-Isolierung und Analyse zur Bestimmung ihrer Rolle in der Lymphom-Zellempfindlichkeit therapeutische Mittel

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Bewertung der Wirksamkeit und Toxizität von RNAs Targeting HIV-1-Produktion für den Einsatz in Gene oder Arzneimitteltherapie

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Rettung und Charakterisierung des rekombinanten Virus aus einer neuen Welt Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Generation von Escape Varianten des Influenza-Virus Monoclonal Antikörper neutralisieren

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

Erkennung und Entfernung von Nuklease Kontamination während der Reinigung von rekombinanten Prototyp schaumig Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

Schnelle, sichere und einfache manuelle am Krankenbett Nukleinsäure-Extraktion für den Nachweis des Virus in Vollblut-Proben

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...