Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

עבודה זו נתמכה על ידי NIH AI099854 ו- AI126742 למפתח.

1. חישול של vDNA
<ol><li>שלב 1 X 10 מאגר (10 X 10 מניות: 100 מ"מ טריס-HCl, pH 8.0, 1 M NaCl, EDTA 10 מ מ), 10 מיקרומטר Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 מניות מיקרומטר) ו- 10 מיקרומטר Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 מניות מיקרומטר באמצעי אחסון הסופי של 1.5 מ ל) . µL 25 aliquot לתוך צינורות תגובת שרשרת (PCR) 0.2-mL פולימראז שישים. הערה: ...

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

תוספות retroviral טופס של multimeric מורכבים עם ה-DNA גנומי הנגיפי לבצע אינטגרציה ולהמשיך את מחזור החיים ויראלי. המספר של מונומרים לכל intasome ייתכן tetramers, octamers או אולי גבוה יותר סדר multimers11,12,13,14. PFV intasomes הם tetramer של רקומביננטי עם כפול גד...

שילוב של הגנום הנגיפי לתוך הגנום המארח הוא צעד הכרחי במחזור החיים של רטרווירוסים כל1. Integrase אנזים ויראלי (ב) מזרז בהצטרפות קוולנטיות בסוף כל הגנום DNA נגיפי למחשב המארח הדנ א. במהלך זיהום הסלולר, הוא חלק ממתחם אינטגרציה קדם המעביר אינטגרציה. ב רקומביננטי ומורכבת עם כפול oligomers DNA נטושים מחקה את הקצוות DNA נגיפי ניתן גם לבצע אינטגרציה לתוך ה-DNA היעד במבחנה2. יישום נפוץ השילוב assay במבחנה מנצל של פלסמיד supercoiled כיעד הדנ א. שילוב של שני oligomers DNA נגיפי (vDNA) כדי פלסמיד התוצאה היא מוצר ליניארי, הנקרא מתואמת אינטגרציה (איור 2 א). שילוב assay במבחנה גם תניב מוצרים עם אחד בלבד vDNA covalently לצרף את פלסמיד המטרה וכתוצאה מכך עיגול רגוע. מוצר זה שילוב חצי-אתר שנראה חפץ של assay בתוך חוץ גופית.
ב רקומביננטי, vDNA ניתן לבצע אינטגרציה במבחנה, אבל הם לא ריאגנטים אידיאלי עבור חקר הדינמיקות או מבנה של אינטגרציה מתחמי כאשר ב monomeric יטשטש ויזואליזציה הרלוונטיים. מתחמי אינטגרציה מטוהרים, או "intasomes", נדרשים ללימודי ניתוח או מבנה דינמי מולקולה בודדת. ב PFV ו- vDNAs עשוי להיות התאספו על-ידי דיאליזה מתוך מאגר ריכוז המלח גבוה יחסית ל-3,ריכוז מלח נמוך4. במהלך דיאליזה, התמיסה טפסים. המשקע הזה יוסר דיאליזה, ריכוזי המלח הוא גדל. ריכוז המלח גבוה יותר solubilizes את intasomes PFV המכיל precipitate. Intasomes כבר אז טהור לפי גודל אי-הכללה של כרומטוגרפיה (שניות). אב טיפוס רקומביננטי קצפית וירוס (PFV) ב הוכח קיימים מונומר בפתרון בריכוזים עד מיקרומטר 2255. Fractionation שניה מפריד ביעילות את intasomes PFV (225.5 kDa), הכוללת של tetramer PFV IN, שני vDNAs, PFV monomeric ב (44.4 kDa), חינם vDNA (24.0 kDa). Intasomes PFV יתכן מוקפאות ולשמר את פעילות האינטגרציה במשך לפחות שישה חודשים של אחסון ב-80 הלעפה תרוטרפמט.
Intasomes PFV רקומביננטי ניתן לשינוי כדי לכלול החלפות חומצת אמינו או לחיתוך מוטציות או vDNAs עם4,fluorophores או ביוטין6תוויות. Intasomes PFV מטוהרים בקלות לבצע אינטגרציה לתוך פלסמיד supercoiled יעד ה-DNA במבחנה. תפזורת מבחני הביוכימי אינטגרציה עם intasomes עשוי לבחון את ההשפעות של מוטציות, מעכבי, או תוספים כימיים אחרים. Biotinylated intasomes יכול לשמש כדי לחקור זיקה עם חומצות גרעין או חלבונים. PFV intasomes פונקציונליים בטמפרטורת הסביבה ומאפשר לבדיקה מיקרוסקופית מולקולה בודדת על-ידי פינצטה מגנטי כדי למדוד את הזמן בין הצטרפות של שני הקצוות vDNA או קרינה פלואורסצנטית גמורה להמחיש את החיפוש intasome על המטרה דנ א6. בנוסף, PFV intasomes היו הראשונים להיות מבנית מאופיין להשפיע באופן משמעותי בתחום של שילוב retroviral3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

א הגדרת תכונה, צעד הכרחי של מחזור חיי הרטרווירוס הוא השילוב של הגנום הנגיפי לתוך הגנום המארח. כל רטרווירוסים לקודד אנזים integrase (ב) אשר מזרז קוולנטיות בהצטרפות של נגיפי למארח ה-DNA, הידוע בשם strand העברה. שילוב יכול להיות מעוצבת במבחנה עם IN retroviral רקומביננטי ו- DNA oligomers מחקה את הקצוות של הגנום הנגיפי. על מנת לסכם באופן הדוק יותר התגובה אינטגרציה המתרחשת ויוו, אינטגרציה מתחמי are התכנסו from IN רקומביננטי, oligomers סינתטי על-ידי דיאליזה במאגר מלח בריכוז. מורכבות, השילוב של intasome, שנקרא יכולים להיטהר על-ידי גודל אי-הכללה של כרומטוגרפיה. במקרה של אב-טיפוס קצפית וירוס (PFV), intasome של tetramer של oligomers דנ א שני והוא מופרד ברצון monomeric IN, אוליגומר חינם הדנ א. יעילות שילוב PFV intasomes ייתכן לבדיקה תחת מגוון תנאים ניסיוני כדי להבין טוב יותר את הדינמיקה, מכניקה של retroviral אינטגרציה.

PFV intasomes are התכנסו from רקומביננטי IN ו- vDNA. לאחר ההרכבה, intasomes כבר טהור על ידי שניה (איור 1). שילוב פעילות של כל שבר לבדיקה עם supercoiled DNA היעד ואת agarose בג'ל (איור 2). הג'ל הזה הוא עם תמונה עם סורק פלורסנט מוגדר לזהות EtBr (וגם fluorophore, אם התווית על-ידי fluorophore v...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Integrase retroviral רקומביננטי oligomers DNA מחקה מסתיים DNA נגיפי יכול יוצרים קומפלקס פעיל enzymatically המכונה של intasome. Intasomes עשוי לשמש ללימודי הביוכימי, מבניים קינטי. פרוטוקול זה מפרט כיצד להרכיב ולטהר intasomes וירוס קצפית אב-טיפוס.

הרכבה ולטיהור Intasomes וירוס קצפית אב-טיפוס

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Research

JoVE Journal

Immunology and Infection

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

פשוט וחזק In vivo ו במבחנה גישה ללימוד הרכבה וירוס

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

זיקה טיהור של נגיף השפעת תסביכים Ribonucleoprotein של הכרומטין של תאים נגועים

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

טיהור vacuoles הפתוגן מ<em&gt; הלגיונלה</em&gt; נגועים phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

הצלה של וירוס רקומביננטי ניוקאסל מחלות מcDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

בידוד נויטרופילים וניתוח כדי לקבוע את תפקידם רגישות תאים לימפומה לסוכנים טיפוליים

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

הערכת היעילות והרעילות של RNAs מיקוד ייצור HIV-1 לשימוש ב ג&#39;ין או טיפול תרופתי

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

הצלה אפיון של וירוס רקומביננטי מעולם חדש Zika וירוס זיהום מזוהם

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

דור של בריחה וריאציות של נטרול נוגדנים חד-שבטיים של וירוס שפעת

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

האיתור וההסרה של נוקלאז זיהום במהלך טיהור של אב טיפוס רקומביננטי קצפית וירוס Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

חילוץ מהיר, בטוח, ופשוט ידנית המיטה חומצת גרעין איתור וירוס בדגימות דם מלא

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...