Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

이 작품은 NIH AI099854 및 AI126742 키에 의해 지원 되었다.

1. 어 닐 링 vDNA의
<ol><li>결합 1 X 10 버퍼 (10 X 10 재고: 100 mM Tris HCl, pH 8.0, 1 M NaCl, 10 mM EDTA), 10 µ M (5' 3' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG, 100 µ M 재고), 올리고 1과 10 µ M 1.5 mL의 최종 볼륨에 올리고 2 (5' 3' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA, 100 µ M 재고) . Aliquot 25 µ L 60 0.2 mL 중 합 효소 연쇄 반응 (PCR) 튜브로. 참고: 응용 프로그램에 따라 올리고 fluorophores 또는 5'-끝에 올리고 2의 또는 태그 기본 13 5'-끝 올?...

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Retroviral 기능 통합을 수행 하 고 바이러스 성 수명 주기를 계속 하는 바이러스 성 게놈 DNA와 복잡 한 multimeric를 형성 한다. Intasome 당 단위체에의 수는 tetramers, octamers, 또는 가능 하 게 더 높은 순서 multimers11,12,,1314수 있습니다. PFV intasomes는 모방 하는 바이러스 성 게놈 DNA 이중 가닥 DNA 올리고도 재조합 ...

호스트 게놈으로 바이러스 성 게놈의 통합 모든 레트로 바이러스1의 라이프 사이클에는 필수 단계입니다. 바이러스 성 효소 integrase (IN) catalyzes 호스트 DNA에 바이러스 성 DNA 게놈의 각 끝의 공유 결합. 세포 감염 동안에 통합을 중재 하는 사전 통합 복잡 한의 일부가입니다. 재조합에 더블 좌초 DNA 올리고 흉내 낸 바이러스 성 DNA 끝에 complexed는 대상 DNA 생체 외에서2에 통합을 수행할 수 있습니다. 일반적인 통합 분석 결과 생체 외에서 supercoiled 플라스 미드 DNA 대상으로 사용합니다. 플라스 미드를 모두 바이러스 성 DNA 올리고 (vDNA)의 통합 선형 제품 귀착되 고 공동된 통합 (그림 2A) 이라고 불린다. 통합 분석 결과 생체 외에서 covalently 편안한 원에서 결과 대상 플라스 미드에 참가 한 vDNA와 제품을 얻을 또한 수 있습니다. 이 반 사이트 통합 제품 분석 결과 체 외의 인 것 처럼 보인다.
재조합에 및 vDNA 통합에서 생체 외에서수행할 수 있습니다 하지만 그들은 역학의 연구 또는 통합 복합물의 구조에 대 한 이상적인 약 단위체에 관련 시각화 모호한 것 때. 순화 통합 복합물, 또는 "intasomes," 동적 단일 분자 분석 또는 구조 연구에 필요한 있습니다. PFV에 및 vDNAs 수 있습니다 조립 될 투 석 하 여 상대적으로 높은 소금 농도 버퍼에서 낮은 염 농도3,4. 투 석, 한 침전 동안 양식. 이 침전 물은 투 석에서 제거 되 고 소금 농도 증가. 더 높은 소금 농도 촉진 포함 PFV intasomes solubilizes. intasomes 다음 크기 배제 크로마토그래피 (SEC)에 의해 정화 된다. 재조합 프로토 타입 거품 바이러스 (PFV)에 225 µ M5농도에서 솔루션에 단위체로 존재 하기 위하여 보였다. 초 분류 (44.4 kDa) 단위체 PFV와 무료 vDNA (24.0 kDa)에서 효과적으로 tetramer PFV에 및 2 개의 vDNAs를 포함 하는 PFV intasomes (225.5 kDa)를 구분 합니다. PFV intasomes 냉동 수 있습니다 그리고-80 ˚C에 저장의 적어도 6 개월에 대 한 통합 활동을 유지 합니다.
재조합 PFV intasomes 아미노산 대체 또는 잘림 돌연변이 또는 fluorophores 또는 biotin4,6으로 표시 하는 vDNAs에 포함 하도록 수정할 수 있습니다. 순화 PFV intasomes는 쉽게 DNA에서 생체 외에서supercoiled 플라스 미드 대상으로 통합을 수행합니다. Intasomes과 대량 생 화 확 적인 통합 분석 돌연변이, 억제제, 또는 다른 화학 첨가제에의 효과 테스트할 수 있습니다. Biotinylated intasomes는 핵 산 또는 단백질 선호도 조사를 사용할 수 있습니다. PFV intasomes는 두 vDNA 끝 또는 목표에 intasome 검색을 시각화 하기 위해 총 내부 반사 형광의 가입 사이 시간을 측정 하려면 자기 핀셋에 의해 단일 분자 현미경 분석에 대 한 허용 주위 온도에 기능적 DNA6. 또한, PFV intasomes 구조적으로 먼저 retroviral 통합3분야에 크게 영향을 미치는 특징 이었다.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A 기능 및 레트로 바이러스 라이프 사이클의 필요한 단계를 정의 하는 것은 주인 게놈으로 바이러스 성 게놈의 통합. 모든 레트로 바이러스는 호스트 DNA 가닥 전송으로 알려진 바이러스의 공유 결합 catalyzes integrase (IN) 효소를 인코딩합니다. 통합은 모델링 된 시험관에 재조합 retroviral in 되며 DNA 올리고 바이러스 성 게놈의 끝을 흉내 낸 수 있습니다. 더 밀접 하 게 통합 반응에서 발생 하 비보에, 통합을 정리 하기 위해 단지 감소 된 소금 농도 버퍼에서 투 석 하 여 재조합 및 합성 올리고에서 조립 된다. intasome 라는 통합 복잡 한, 크기 배제 크로마토그래피에 의해 순화 될 수 있습니다. 프로토 타입 거품 바이러스 (PFV)의 경우는 intasome에 tetramer 및 2 개의 DNA 올리고 이며 단위체에 무료 올리고 DNA 머에서 쉽게 분리 된다. PFV intasomes의 통합 효율성 다양 한 역학을 보다 잘 이해 하려면 실험 조건 및 retroviral 통합의 역학 분석 될 수 있습니다.

PFV intasomes 재조합 및 vDNA에서 조립 된다. 조립 후 intasomes 초 (그림 1)에 의해 정화 된다. 각 분수의 통합 활동을 supercoiled DNA 대상과 agarose 젤 전기 이동 법 (그림 2)와 분석 이다. 이 젤은 감지 EtBr (fluorophore, fluorophore 표시 vDNA 사용 하는 경우)로 설정 하는 형광 스캐너와 몇 군데. 이미지 분석 소프트웨어를 사용 하 여, 밴드 픽셀 볼?...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

재조합 retroviral integrase와 바이러스 성 DNA 끝을 흉내 낸 DNA 올리고는 intasome로 알려진 복잡 한 효소 활성을 형성할 수 있다. Intasomes 생화학, 구조, 및 키네틱 연구에 대 한 사용할 수 있습니다. 이 프로토콜에는 조립 및 프로토 타입 거품 바이러스 intasomes를 정화 하는 방법을 자세히 설명 합니다.

조립 및 프로토 타입 거품 바이러스 Intasomes의 정화

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Research

JoVE Journal

Immunology and Infection

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

간편하고 강력한 생체내에서과 체외에서</em바이러스 조립 유학을위한> 접근법

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

연구

면역학 및 감염병학

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

감염된 세포의 염색질에서 인플루엔자 바이러스 Ribonucleoprotein 컴플렉스의 동질 정제

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

병원체 Vacuoles의 정제에서<em&gt; Legionella</em&gt; - 감염된 Phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

의 cDNA에서 재조합 뉴캐슬 질병 바이러스의 구조

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

호중구의 분리 및 분석 치료제에 림프종 세포 감도에서 자신의 역할을 확인하는 방법

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

유전자 또는 약물 치료에 사용하기 위해 HIV-1 생산을 표적 RNA를의 효능 및 독성 평가

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

새로운 세계 Zika 바이러스 전염성 클론으로부터 재조합 바이러스의 구조 및 특성 규명

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

인플루엔자 바이러스 단일 클론 항 체를 중화의 탈출 변종의 생성

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

검색 및 재조합 프로토 타입 거품 바이러스 Integrase의 정화 동안 Nuclease 오염의 제거

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

전체 혈액 샘플에서 바이러스의 검출, 안전, 신속 하 고 간단한 수동 침대 핵 산 추출

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...