Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Dette arbeidet ble støttet av NIH AI099854 og AI126742 til nøkkelen.

1. annealing av vDNA
<ol><li>Kombiner 1 X ti Buffer (10 X 10 lager: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA), 10 µM Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3, 100 µM lager) og 10 µM Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3, 100 µM lager) i et siste volum på 1,5 mL . Aliquot 25 µL i seksti 0,2-mL polymerase kjedereaksjon (PCR) rør. Merk: Avhengig av programmet, oligomers kan bli endret med fluorophores eller koder på 5'-slutten av Oligo 2 eller som en intern amino-T base 13 fra ...

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Retroviral moduler danner en multimeric kompleks med viral genomisk DNA å utføre integrering og fortsette viral livssyklusen. Antall i monomerer per intasome kan være tetramers, octamers eller muligens høyere orden multimers11,12,13,14. PFV intasomes er en tetramer av rekombinant med double-strandet DNA oligomers som etterligner viral genomisk DNA ender3. Di...

Integrering av viral genomet til verten genomet er et obligatorisk trinn i livssyklusen til alle retroviruses1. Viral enzymet integrase (IN) gir kovalente sammenføyning av hver ende av viral DNA genomet til verten DNA. Under en mobilnettet infeksjon, er en del av en pre integrering kompleks som formidler integrering. Rekombinant i kompleksbundet med dobbel strandet DNA oligomers etterligne viral DNA endene kan også utføre integrering i målet DNA i vitro2. En felles integrering analysen i vitro benytter en supercoiled plasmider målet DNA. Integrasjon av både viral DNA oligomers (vDNA) til plasmider en lineær produktet og kalles felles integrering (figur 2A). Den integrering analysen i vitro kan også gi produkter med bare én vDNA covalently koblet til målet plasmider resulterer i en avslappet sirkel. Halv-site integrering produktet synes å være en gjenstand på analysen i vitro.
Rekombinant i og vDNA kan utføre integrering i vitro, men de er ikke ideelt reagensene studiet av dynamikken eller struktur av integrasjon komplekser når monomerisk IN ville skjule relevante visualisering. Renset integrering komplekser, eller "intasomes," kreves for dynamisk ett molekyl analyse eller strukturelle studier. PFV i og vDNAs kan settes sammen av dialyse fra en relativt høy saltkonsentrasjon buffer til en lavere saltkonsentrasjon3,4. Under dialyse, en utløse skjemaer. Dette utløse fjernes fra dialyse og salt konsentrasjonen er økt. Den høyere saltkonsentrasjon solubilizes bunnfall inneholder PFV intasomes. Intasomes er så renset ved størrelse utelukkelse kromatografi (SEC). Rekombinant prototype skummende virus (PFV) IN har vist å eksistere som en monomer i løsning på konsentrasjoner opptil 225 µM5. SEC fraksjoneres skiller effektivt PFV intasomes (225.5 kDa), som inkluderer en tetramer av PFV i og to vDNAs, monomerisk PFV i (44.4 kDa) og gratis vDNA (24.0 kDa). PFV intasomes kan fryses og beholde integrering aktivitet i minst seks måneder av bagasje på-80 grader.
Rekombinant PFV intasomes kan også endres for å inkludere i aminosyre erstatninger eller trunkering mutasjoner eller vDNAs merket med fluorophores eller biotin4,6. De renset PFV intasomes utføre lett integrering i et supercoiled plasmider mål DNA i vitro. Bulk biokjemiske integrering analyser med intasomes kan teste effekten av i mutasjoner, hemmere eller andre kjemiske tilsetningsstoffer. Biotinylated intasomes kan brukes å undersøke slektskap med nukleinsyrer eller proteiner. PFV intasomes er funksjonelle ved omgivelsestemperatur muliggjør enkel molekyl mikroskopi analyse av magnetiske pinsetter å måle tiden mellom sammenføyning av to vDNA endene eller totale interne refleksjon fluorescens å visualisere intasome søk på målet DNA6. I tillegg var PFV intasomes først til å være strukturelt preget betydelig påvirker feltet retroviral integrering3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A definere funksjonen og nødvendig trinn i livssyklusen til retrovirus er integrering av viral genomet til verten genomet. Alle retroviruses kode et integrase (IN) enzym som gir kovalente sammenføyning av viral vert DNA, som er kjent som strand overføring. Integrering kan være modellert i vitro med rekombinant retroviral IN og DNA oligomers etterligne endene av viral genomet. For å nærmere recapitulate integrering reaksjonen som oppstår i vivo, integrering komplekser er satt sammen av rekombinant i og syntetisk oligomers av dialyse i en redusert saltkonsentrasjon buffer. Integrering komplekse, kalt en intasome, kan bli renset ved størrelse utelukkelse kromatografi. I prototype skummende virus (PFV), intasome er en tetramer av IN og to DNA oligomers og skilles lett fra monomerisk i og gratis oligomer DNA. Integrering effektiviteten av PFV intasomes kan være assayed under en rekke eksperimentelle forhold å bedre forstå dynamikken og mekanikken i retroviral integrering.

PFV intasomes er satt sammen av rekombinant i og vDNA. Etter forsamling, er intasomes renset sekund (figur 1). Integrering aktivitet av hver fraksjon er assayed med en supercoiled DNA målet og agarose gel geleelektroforese (figur 2). Denne gel er avbildet med en fluorescerende skanner sette å oppdage EtBr (og fluorophore, hvis fluorophore-merket vDNA brukes). Bruker analyseprogramvare, kan bandet pixel volumer brukes til å ber...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Rekombinant retroviral integrase og DNA oligomers etterligne viral DNA ender kan danne en enzymatisk aktive komplekset kalles en intasome. Intasomes kan brukes for biokjemiske, strukturelle og kinetisk studier. Denne protokollen detaljer kursen og rense prototype skummende virus intasomes.

Montering og rensing av Prototype skummende Virus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Research

JoVE Journal

Immunology and Infection

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Enkel og robust In vivo Og In vitro Approach for å studere Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Affinity Rensing av influensavirus ribonucleoprotein Komplekser fra Chromatin av infiserte celler

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Rensing av Patogen vakuoler fra<em&gt; Legionella</em&gt;-Infiserte fagocytter

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Redning av rekombinant Newcastle Disease Virus fra cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Nøytrofile Isolering og analyse for å fastslå deres rolle i lymfom Cell Følsomhet for Terapeutiske midler

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Evaluering av effekt og toksisitet av RNA Targeting HIV-1 Produksjon for bruk i Gene eller Medikamentell behandling

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Redning og karakterisering av rekombinant virus fra en ny verden Zika Virus smittsom klon

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Generasjon av Escape varianter av nøytralisere influensa Virus monoklonale antistoffer

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

Oppdagelse og fjerning av Nuclease forurensning under rensing av rekombinant Prototype skummende Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

Rask, sikker og enkel manuell sengen nukleinsyre utvinning for påvisning av Virus i hele blodprøver

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...