Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Este trabalho foi financiado pelo NIH AI099854 e AI126742 a chave.

1. recozimento de vDNA
<ol><li>Combinar 1 X 10 Buffer (estoque de 10 X 10: 100 mM Tris-HCl, pH 8,0, 1 M NaCl, EDTA 10 mM), 10 µM 1 Oligo (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM de estoque) e 10 µM 2 Oligo (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM de estoque) em um volume final de 1,5 mL . Alíquota de 25 µ l para tubos de reação em cadeia (PCR) de 0,2 mL do polymerase sessenta. Nota: Dependendo da aplicação, oligómeros podem ser modificados com fluorophores ou tags 5'-na extremi...

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Retroviral INs formam uma complexo com DNA genômico viral para realizar a integração e continuar o ciclo de vida viral de multiméricas. O número de em monômeros por intasome pode ser tetrâmeros, octamers ou possivelmente maior ordem oriundas de11,12,13,14. PFV intasomes são um tetrâmero de recombinante com oligômeros de DNA dupla-hélice que imitam o DNA genômico viral termina<sup cl...

Integração do genoma viral no genoma do hospedeiro é um passo obrigatório no ciclo de vida de todos os retrovírus1. A enzima viral integrase (IN) catalisa a União covalente de cada extremidade do genoma de DNA viral para o host de DNA. Durante uma infecção celular, faz parte de um complexo de pré-integração que medeia a integração. Recombinante em complexado com oligômeros de DNA encalhados dobro imitando as extremidades de DNA virais também pode realizar a integração em um DNA alvo em vitro2. Um comum integração ensaio em vitro utiliza um plasmídeo supercoiled como o DNA alvo. Integração de ambos os oligómeros de DNA virais (vDNA) para o plasmídeo resulta em um produto linear e é denominada integração concertada (Figura 2A). A integração do ensaio em vitro pode também produzir produtos com apenas um vDNA covalentemente unida com o plasmídeo de alvo, resultando em um círculo relaxado. Este produto de integração de meia-site parece ser um artefato de ensaio in vitro.
Recombinante em e vDNA podem realizar integração em vitro, mas eles não são reagentes ideais para o estudo da dinâmica ou estrutura de complexos de integração quando monomérico IN poderia obscurecer visualização relevante. Purificado de integração complexos, ou "intasomes", são necessários estudos estruturais ou análise de dinâmica única molécula. PFV IN e vDNAs pode ser montado por diálise de um buffer de relativamente alta concentração de sal para uma baixa concentração de sal,3,4. Durante a diálise, um precipitate formulários. Esse precipitado é removido da diálise e a concentração de sal é aumentada. A maior concentração de sal solubiliza o precipitado contendo PFV intasomes. Os intasomes são então purificados por cromatografia de exclusão (SEC). IN de vírus espumoso (PFV) recombinante protótipo foi mostrado para existe como um monômero em solução em concentrações até 225 µM5. Fracionamento de SEC efetivamente separa o intasomes PFV (225.5 kDa), que inclui um tetrâmero de PFV IN e dois vDNAs, PFV monomérico em (44,4 kDa) e enciclopédia vDNA (24,0 kDa). O intasomes PFV pode ser congelado e manter a atividade de integração pelo menos seis meses de armazenamento a-80 ˚ c.
Recombinante PFV intasomes também pode ser modificado para incluir em substituições de aminoácidos ou mutações de truncamento ou vDNAs rotulado com fluorophores ou biotina4,6. Os purificado PFV intasomes executar prontamente integração em um alvo de plasmídeo supercoiled DNA em vitro. Ensaios de integração bioquímicos em massa com intasomes podem testar os efeitos de mutações, inibidores, ou outros aditivos químicos. Biotinilado intasomes pode ser usado para sondar a afinidade com os ácidos nucleicos e proteínas. PFV intasomes são funcionais à temperatura ambiente, permitindo a análise de microscopia única molécula por uma pinça magnética para medir o tempo entre juntar-se das duas extremidades vDNA ou fluorescência de reflexão interna total para visualizar a pesquisa de intasome no alvo DNA6. Além disso, PFV intasomes foram os primeiros a ser estruturalmente caracterizam afetar significativamente o campo de integração retroviral3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A definição de recurso e etapa necessária do ciclo de vida do retrovírus é a integração do genoma viral no genoma do hospedeiro. Todos os retrovírus codificam uma enzima integrase (IN) que cataliza a União covalente de viral para host de DNA, que é conhecido como transferência de vertente. Integração pode ser modelado em vitro com IN retroviral recombinante e oligómeros de DNA imitando as extremidades do genoma viral. Para recapitular mais de perto a reação de integração que ocorre na vivo, integração complexos são montados de recombinação IN e oligômeros sintéticos por diálise em um buffer de reduzida concentração de sal. A integração complexa, chamada um intasome, pode ser purificada por cromatografia de exclusão. No caso do vírus espumoso de protótipo (PFV), o intasome é um tetrâmero de IN e dois oligómeros de DNA e prontamente é separado do IN monomérico e livre oligómero de DNA. A eficiência de integração de intasomes PFV pode ser analisada sob uma variedade de condições experimentais para melhor compreender a dinâmica e mecânica de integração retroviral.

PFV intasomes são montados de recombinação IN e vDNA. Após a montagem, intasomes são purificados pela SEC (Figura 1). Atividade de integração de cada fração é analisada com um supercoiled DNA alvo e agarose electroforese do gel (Figura 2). Este gel é fotografado com um scanner fluorescente definido para detectar EtBr (e fluoróforo, se rotulado de fluoróforo vDNA é usado). Volumes de pixel de banda usando o software ...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Integrase retroviral recombinante e oligómeros de DNA imitando extremidades de DNA virais podem formar um complexo enzimaticamente ativo conhecido como um intasome. Intasomes pode ser utilizado para estudos bioquímicos, estruturais e cinéticos. Este protocolo fornece detalhes sobre como montar e purificar o protótipo vírus espumoso intasomes.

Montagem e purificação do protótipo vírus espumoso Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Research

JoVE Journal

Immunology and Infection

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simples e robusto In vivo E In vitro Abordagem para o Estudo Assembléia Virus

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Imunologia e Infecção

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Purificação por afinidade de Complexos de Influenza Virus ribonucleoproteína da cromatina de células infectadas

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purificação de vacúolos patógeno de<em&gt; Legionella</em&gt; Infectados Fagócitos

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Resgate de Vírus da Doença de Newcastle recombinante de cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Isolamento de neutrófilos e análise para determinar seu papel na linfoma sensibilidade das células a agentes terapêuticos

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Avaliação da eficácia e toxicidade de RNAs Segmentação HIV-1 Produção para uso em Gene ou Quimioterapia

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Salvamento e Caracterização do Vírus Recombinante de um Clone Infeccioso do Vírus do Novo Mundo Zika

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Geração de variantes de fuga de neutralizar os anticorpos monoclonais de vírus da gripe

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

Deteção e remoção de contaminação de Nuclease durante a purificação do protótipo recombinante vírus espumoso Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

Extração rápida, segura e simples Manual cabeceira de ácidos nucleicos para a detecção de vírus em amostras de sangue total

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...