Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Эта работа была поддержана низ AI099854 и AI126742 к ключу.

1. отжиг из vDNA
<ol><li>Комбинат 1 X 10 буфера (10 X 10 складе: 100 мм трис-HCl, рН 8,0, 1 M NaCl, ЭДТА 10 мм), 10 мкм 1 Oligo (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 мкм складе) и 10 мкм Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', запас 100 мкм) в окончательном объеме 1,5 мл . Аликвота 25 мкл в шестьдесят 0,2 мл полимеразной цепной реакции (ПЦР) трубы....

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Антиретровирусные модулей образуют multimeric комплекс с вирусной геномной ДНК для выполнения интеграции и продолжить вирусный жизненного цикла. Количество в мономеров в intasome может быть тетрамера, octamers или возможно выше порядок мультимеры11,12,,<sup...

Интеграция вирусного генома в геноме хост это обязательный шаг в жизненном цикле все ретровирусы1. Вирусный фермент интеграза (IN) катализирует ковалентных присоединения каждого конца вирусной ДНК генома к хосту ДНК. Во время сотовой инфекции в является частью комплекса до интеграции, которая опосредует интеграции. В рекомбинантной complexed с двойной мель ДНК олигомеров, подражая вирусной ДНК концы можно также выполнить интеграцию целевых ДНК в пробирке2. Общей интеграции пробирного в vitro использует supercoiled плазмиды ДНАО цели. Интеграция обеих вирусной ДНК олигомеров (vDNA) для плазмида приводит в линейный продукт и называется согласованной интеграции (рисунок 2A). Интеграции пробирного в пробирке может также принести продуктов с ковалентно присоединены к целевой плазмида, что приводит к расслабленной круг только один vDNA. Этот продукт интеграции половину сайт, как представляется, артефакт пробирного в пробирке.
В рекомбинантной и vDNA могут выполнять интеграцию в пробирке, но они не являются идеальным реагенты для изучения динамики или структуры интеграции комплексов, когда мономерных в будет затушевывать соответствующие визуализации. Очищенный интеграции комплексов, или «intasomes,» необходимы для анализа или структурные исследования динамических одной молекулы. PFV IN и vDNAs могут собираться методом диализа с относительно высокой концентрации соли буфера меньше концентрация соли3,4. Во время диализа, преципитат формы. Этот осадок удаляется из диализа и увеличение концентрации соли. Более высокие концентрации соли solubilizes осадок содержащий PFV intasomes. Intasomes затем очищенная методом размер гель-проникающей хроматографии (SEC). Было показано, что рекомбинантных прототип пенистый вирус (PFV) в существование в качестве мономера в растворе в концентрациях до 225 мкм5. SEC фракционирование эффективно отделяет PFV intasomes (225.5 кДа), который включает в себя Тетрамер PFV в и два vDNAs, от мономерных PFV в (44,4 кДа) и бесплатные vDNA (24.0 кДа). PFV intasomes могут быть заморожены и удерживать интеграции деятельности по крайней мере шесть месяцев хранения на-80 градусов.
Рекомбинантных PFV intasomes также могут быть изменены для включения в аминокислотных замен или усечение мутации или vDNAs помечены флуорофоров или биотин4,6. Очищенный intasomes PFV легко выполнить интеграцию в мишень supercoiled плазмида ДНК в пробирке. Массовых анализов биохимической интеграции с intasomes может проверить последствия в мутации, ингибиторы, или других химических добавок. Биотинилированным intasomes может использоваться для датчика близости с нуклеиновых кислот и белков. PFV intasomes функционируют при температуре окружающей среды, позволяя одной молекулы микроскопии анализа Магнитные пинцеты для измерения времени между присоединения двух концах vDNA или полное внутреннее отражение флуоресценции для визуализации intasome Поиск цели ДНК6. Кроме того PFV intasomes были первым быть структурно характеризуется значительно влияющих области антиретровирусного лечения интеграции3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A определение функции и необходимый шаг жизненного цикла ретровируса является интеграция вирусного генома в геноме принимающей. Все ретровирусы кодировать фермент интеграза (IN), который катализирует ковалентных присоединения вирусных хост ДНК, который известен как стренги передачи. Интеграция может быть моделируется в пробирке с рекомбинантным антиретровирусного лечения в и ДНК олигомеров, подражая концы вирусного генома. Для того, чтобы более тесно пилки интеграции реакции, которая происходит в естественных условиях, интеграции комплексы собираются из рекомбинантных IN и синтетические олигомеров методом диализа в буфере снижение концентрации соли. Интеграции комплекса, называется intasome, может очистить хромотографией размер исключения. В случае прототип пенистый вирус (PFV) intasome Тетрамер IN и два ДНК олигомеров и легко отделяется от мономерных IN и бесплатные олигомера ДНК. Эффективность интеграции PFV intasomes может assayed под целый ряд экспериментальных условиях, чтобы лучше понять динамику и механики ретровирусной интеграции.

PFV intasomes собираются из рекомбинантных IN и vDNA. После сборки intasomes очищаются от SEC (рис. 1). Интеграция деятельности каждой фракции assayed с supercoiled цели и агарозы электрофорез геля дна (рис. 2). Этот гель образы с флуоресцентные сканера, набор для о...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Рекомбинантных ретровирусной интеграза и ДНК олигомеров, подражая вирусной ДНК концы могут образовывать ферментативно активный комплекс, известный как intasome. Intasomes может использоваться для исследования биохимических, структурных и кинетические. Этот протокол описывает собрать и очистить прототип пенистый вирус intasomes.

Ассамблея и очистки прототип пенистый вирус Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Research

JoVE Journal

Immunology and Infection

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Простая и надежная В естественных условиях И В пробирке Подход к изучению вируса Ассамблеи

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Affinity очистки вируса гриппа рибонуклеопротеидных комплексов с хроматина инфицированных клеток

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Очистка Возбудитель вакуоли с<em&gt; Legionella</em&gt;-Инфицированных Фагоциты

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Спасение рекомбинантный Ньюкасл вирусное заболевание из кДНК

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Нейтрофильная Выделение и анализ для определения их роли в клеточной лимфомы чувствительность к терапевтических агентов

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Оценка эффективности и токсичности РНК Ориентация ВИЧ-1 Производство для использования в генной или терапии наркотиками

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Спасение и характеристика рекомбинантного вируса из нового мира Инфекционный клон вируса Зика

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Поколение побег вариантов нейтрализующих антител моноклональных вирус гриппа

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

Обнаружение и удаление нуклеиназы загрязнения во время очистки рекомбинантных прототип пенистый вирус интеграза

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

Быстрый, безопасный и простой ручной прикроватные нуклеиновой кислоты извлечения для обнаружения вируса в пробах цельной крови

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...