Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Este trabajo fue apoyado por NIH AI099854 y AI126742 a la clave.

1. recocido de vDNA
<ol><li>Combinar 1 X Buffer 10 (10 X 10 stock: 100 mM Tris-HCl, pH 8,0, 1 M NaCl, 10 mM EDTA), 10 μm 1 Oligo (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 acciones μm) y 10 μm 2 Oligo (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 acciones μm) en un volumen final de 1.5 mL . Alícuota de 25 μL en tubos de reacción en cadena (PCR) de 0.2 mL polimerasa sesenta. Nota: Dependiendo de la aplicación, oligómeros pueden modificarse con fluoróforos o etiquetas en el extremo 5'-2 Oligo ...

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Retroviral INs forman un complejo con DNA genómica viral para realizar integración y continuar el ciclo de vida viral multimérica. El número de monómeros por intasome puede ser tetrámeros, octamers o posiblemente mayor orden Multímeros11,12,13,14. Intasomes PFV son un tetrámero de recombinante con oligómeros de ADN bicatenario que imitan la DNA genomic viral termina3<...

Integración del genoma viral en el genoma del anfitrión es un paso obligatorio en el ciclo de vida de todos los retrovirus1. La enzima viral integrasa (IN) cataliza la unión covalente de los extremos del genoma viral de la DNA al anfitrión DNA. Durante una infección celular, en forma parte de un complejo de pre-integración que media integración. Recombinante en complexed con oligómeros de ADN de doble trenzados mímico los extremos del ADN virales también puede realizar la integración en un ADN en vitrode objetivo2. Un común integración análisis en vitro utiliza un plásmido superenrollado como el ADN diana. Integración de ambos oligómeros de ADN virales (vDNA) para el plásmido da lugar a un producto lineal y se denomina integración concertada (figura 2A). La integración análisis de vitro también se pueden producir productos con sólo un vDNA covalentemente unido al plásmido de blanco dando como resultado un círculo relajado. Este producto de la integración de medio sitio parece ser un artefacto del ensayo in vitro.
Recombinante en y vDNA pueden realizar integración en vitro, pero no son reactivos ideal para el estudio de la dinámica o estructura de los complejos de integración cuando IN monomérica oscurecería visualización pertinente. Complejos de integración purificado, o "intasomes," son necesarios para estudios de análisis o estructural dinámico a la sola molécula. EN PFV y vDNAs puede ser montada por diálisis de un búfer relativamente alta concentración de sal a una baja concentración de sal3,4. Durante la diálisis, un precipitado formas. Este precipitado se elimina de la diálisis y se aumenta la concentración de sal. La mayor concentración de sal solubiliza el precipitado que contiene intasomes PFV. El intasomes entonces se purifican por cromatografía por exclusión de tamaño (SEC). Prototipo recombinante virus espumoso (PFV) IN se ha demostrado que existe como monómero en solución a concentraciones de hasta 225 μm5. Fraccionamiento s efectivamente separa la intasomes PFV (225,5 kDa), que incluye un tetrámero en PFV y dos vDNAs, PFV monomérica en (44,4 kDa) y vDNA gratis (24.0 kDa). La intasomes PFV pueden congelar y conservar actividad de integración para al menos seis meses de almacenamiento a-80 ° c.
Recombinante intasomes PFV también puede ser modificada para incluir en las substituciones del aminoácido o mutaciones de truncamiento o vDNAs con fluoróforos o biotina4,6. Las intasomes PFV purificados fácilmente realizar integración en un objetivo de plásmido superenrollado ADN en vitro. Ensayos de integración bioquímica a granel con intasomes pueden probar los efectos de en mutaciones, inhibidores, o otros aditivos químicos. Biotinilado intasomes puede utilizarse para sonda afinidad con proteínas o ácidos nucleicos. Intasomes PFV funcionan a temperatura ambiente permitiendo análisis de microscopia sola molécula por pinza magnética para medir el tiempo entre la Unión de los dos extremos de vDNA o fluorescencia de la reflexión interna total para visualizar la búsqueda intasome en blanco De ADN6. Además, PFV intasomes fueron los primeros en ser estructuralmente caracterizan impactando significativamente el campo de la integración retroviral3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A definición de función y paso necesario del ciclo de vida de retrovirus es la integración del genoma viral en el genoma del anfitrión. Los retrovirus codifican enzima integrasa (IN) que cataliza la unión covalente de viral a anfitrión DNA, que se conoce como transferencia de cadena. Integración puede ser modelada en vitro con IN retrovirus recombinante y oligómeros de ADN mímico los extremos del genoma viral. Con el fin de recapitular más de cerca la reacción de integración que se presenta en vivo, integración complejos son ensamblados de oligómeros sintéticos y recombinante IN por diálisis en un tampón de menor concentración de sal. La integración compleja, llamada un intasome, puede ser purificada por cromatografía por exclusión de tamaño. En el caso de virus espumoso de los prototipos (PFV), el intasome es un tetrámero de IN y oligómeros de ADN dos y se separa fácilmente en monomérica y oligómero gratuito ADN. La eficacia de la integración de intasomes PFV puede ensayarse bajo una variedad de condiciones experimentales para comprender mejor la dinámica y la mecánica de integración retroviral.

Intasomes PFV son ensamblados de IN recombinante y vDNA. Después del montaje, intasomes son purificadas por segundos (figura 1). Actividad de integración de cada fracción se ensayaron con un superenrollado ADN blanco y agarosa electroforesis en gel (figura 2). Este gel es reflejado con un analizador fluorescente para detectar EtBr (y fluoróforo, si se utiliza el fluoróforo vDNA). Usando software de análisis de imagen, volú...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Integrasa de retrovirus recombinante y oligómeros de ADN mímico extremos de DNA virales pueden formar un complejo enzimático activo conocido como un intasome. Intasomes puede ser usada para estudios bioquímicos, estructurales y cinéticos. Este protocolo detalla cómo montar y purificar el prototipo virus espumoso de los intasomes.

Asamblea y purificación del prototipo Virus espumoso de los Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Research

JoVE Journal

Immunology and Infection

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple y robusto En vivo Y In vitro Enfoque para el estudio de ensamblaje del virus

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Investigación

Inmunología e Infección

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Purificación por afinidad de los complejos de ribonucleoproteína Influenza Virus de la cromatina de las células infectadas

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

La purificación del patógeno a partir de vacuolas<em&gt; Legionella</em&gt; Infectados por fagocitos

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Rescate del virus de la enfermedad de Newcastle recombinante a partir de cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Aislamiento de neutrófilos y análisis para determinar su papel en el linfoma de células sensibles a los agentes terapéuticos

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Evaluación de la eficacia y la toxicidad de los ARN del VIH-1 Orientación de la producción para uso en terapia génica o de drogas

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Rescate y Caracterización del Virus Recombinante de un Nuevo Mundo Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Generación de variantes de Escape de neutralizar anticuerpos Monoclonal del Virus de la Influenza

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

Detección y eliminación de nucleasa contaminación durante la purificación de prototipo recombinante Virus Espumoso integrasa

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

Extracción rápido, seguro y sencillo Manual cabecera de ácido nucleico para la detección del Virus en muestras de sangre entera

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...