Name: assembly and purification of prototype foamy virus intasomes
Uploaded: 2018-03-19T15:00:00
Description: Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Bu eser NIH AI099854 ve AI126742 için anahtar tarafından desteklenmiştir.

1. tavlama, vDNA
<ol><li>Birleştirme 1 X on tampon (10 X 10 hisse senedi: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA), 10 µM Oligo 1 (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM hisse senedi) ve 10 µM Oligo 2 (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM hisse senedi) son hacmi 1.5 mL ' . Aliquot 25 µL altmış 0,2 mL Polimeraz zincir reaksiyonu (PCR) tüpler içine. Not: fluorophores veya Etiketler sonunda 5'-Oligo 2 veya bir iç amino-T 5'-sonundan itibaren Oligo 1 temel 13 olarak reaks...

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Retroviral Ins entegrasyonu gerçekleştirmek için ve viral ömrünün devam viral genomik DNA ile karmaşık bir multimeric oluştururlar. Monomer intasome başına sayısı tetramers, octamers ya da muhtemelen daha yüksek sipariş multimers11,12,13,14olabilir. PFV intasomes3. bir tetramer rekombinant viral genomik DNA taklit çift iplikçikli DNA reaksiyonla...

Ana bilgisayar genom viral genom entegrasyonu döngüsündeki tüm Retrovirüsler1zorunlu bir adımdır. Viral enzim integrase (IN) viral DNA genom DNA ağırlamaktan her iki ucuna kovalent katılmadan tromboksan. Hücresel bir enfeksiyon sırasında Tümleştirme aracılık eder öncesi entegrasyonu karmaşık bir parçasıdır. Rekombinant inç viral DNA uçları taklit çift iplikçikli DNA reaksiyonlar ile complexed da bir hedef DNA vitro2entegrasyon gerçekleştirebilirsiniz. Bir ortak Tümleştirme tahlil vitro supercoiled plazmid DNA hedef kullanır. Her iki viral DNA reaksiyonlar (vDNA) için plazmid bütünleştirilmesi doğrusal bir üründe sonuçları ve uyumlu entegrasyon (şekil 2A) olarak adlandırılır. Entegrasyon tahlil vitro da tek bir vDNA kovalent rahat bir daire içinde sonuçlanan hedef plazmid katıldı ile ürün verim. Bu yarı-site Tümleştirme ürün tahlil içinde in vitrobir eşya gibi görünüyor.
Rekombinant inç ve vDNA entegrasyonu vitrogerçekleştirebilir, ama monomeric inç ilgili görselleştirme karanlık onlar Tümleştirme kompleksleri yapısını veya çalışması dinamikleri ile ideal Kimyasalları değil. Arıtılmış Tümleştirme kompleksleri veya "intasomes," dinamik tek molekül analiz veya yapısal çalışmalar için gereklidir. PFV inç ve vDNAs diyaliz tarafından bir daha düşük tuz konsantrasyonu3,4' e bir nispeten yüksek tuz konsantrasyonu arabelleğinden monte. Diyaliz, bir çökelti sırasında formları. Bu çökelti diyaliz kaldırılır ve tuz konsantrasyonu artar. Yüksek tuz konsantrasyonu acele içeren PFV intasomes solubilizes. İntasomes o zaman boyutu dışlama Kromatografi (sn) tarafından saf. Rekombinant prototip köpüklü virüs (PFV) inç 225 µM5konsantrasyonlarda çözümde bir monomer olarak bulunmaya gösterilmiştir. SN ayırma etkili bir tetramer PFV inç ve iki vDNAs içeren PFV intasomes (225.5 kDa), monomeric PFV (44,4 kDa) ve ücretsiz vDNA (24.0 kDa) ayırır. PFV intasomes dondurulmuş olabilirler ve en az altı ay-80 ˚C, Muhafazası için Tümleştirme etkinliğini korumak.
Rekombinant PFV intasomes de amino asit oyuncu değişikliği veya kesilme mutasyonlar veya fluorophores veya biotin4,6ile etiketli vDNAs içerecek şekilde değiştirilmiş. Saf PFV intasomes kolayca supercoiled plazmid hedef DNA vitroentegrasyonu gerçekleştirmek. Toplu biyokimyasal Tümleştirme deneyleri ile intasomes etkilerini mutasyonların inhibitörleri veya diğer maddeleri, kimyevî test. Biotinylated intasomes nükleik asit veya proteinler ile ilgi soruşturma için kullanılabilir. PFV intasomes iki vDNA ucu veya intasome arama hedef görselleştirmek için toplam iç yansıma Floresans katılmadan arasında geçen zamanı ölçmek için manyetik cımbız tarafından tek molekül mikroskobu analiz için izin ortam sıcaklığında işlevsel olduğundan DNA6. Ayrıca, PFV intasomes ilk yapısal olarak olacak önemli ölçüde etkileyen retroviral entegrasyon3alan ile karakterize edildi.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A özelliği ve gerekli adım retrovirüsü yaşam döngüsünün tanimlar viral genom entegrasyon ana bilgisayar genom. Tüm Retrovirüsler kovalent ana bilgisayara strand transfer olarak bilinen DNA viral birleştirilmesi tromboksan integrase (IN) enzim kodlamak. Entegrasyon modellenmiş vitro rekombinant retroviral inç ile olmak ve viral genom uçları taklit eden DNA reaksiyonlar olabilir. Daha yakından vivo içindeentegrasyon oluşur Tümleştirme tepki özetlemek için kompleksleri rekombinant inç ve sentetik reaksiyonlar diyaliz azaltılmış tuz konsantrasyonu arabellekte tarafından monte edilir. Entegrasyonu karmaşık, bir intasome olarak adlandırılan boyut dışlama Kromatografi tarafından saf. Prototip köpüklü virüs (PFV), söz konusu olduğunda intasome inç bir tetramer ve iki DNA reaksiyonlar ve kolayca monomeric inç ve ücretsiz oligomer DNA ayrılır. PFV intasomes entegrasyon verimliliği daha iyi dinamiklerini anlamak için deneysel koşullar çeşitli ve mekanik retroviral entegrasyon altında denetlesinler.

PFV intasomes rekombinant inç vDNA toplanır. Derleme sonra intasomes (şekil 1) SEC tarafından saf. Entegrasyon etkinliği her kesir bir supercoiled DNA hedef ve özel Jel Elektroforez ile (Şekil 2) denetlesinler. Bu jel EtBr (ve fluorophore, fluorophore etiketli vDNA kullanılırsa) algılamak için ayarla floresan tarayıcıyla görüntüsü. Görüntü analiz yazılımı kullanarak, grup piksel birimleri entegrasyon veriml...

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Rekombinant retroviral integrase ve DNA reaksiyonlar viral DNA uçları taklit eden bir intasome bilinen bir enzimatik etkin kompleks oluşabilir. Intasomes biyokimyasal, yapısal ve Kinetik çalışmalar için kullanılır. Bu protokolü nasıl bir araya getiren ve prototip köpüklü virüs intasomes arındırmak ayrıntılı.

Derleme ve prototip köpüklü virüs Intasomes arıtma

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Research

JoVE Journal

Immunology and Infection

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

Basit ve Sağlam In vivo Ve In vitro</emVirüs Meclisi Öğrenmenin> Yaklaşım

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Enfekte Hücre Kromatin gelen Gribi ribonükleoprotein Komplekslerinin Affinity Arıtma

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

Patojen Vakuoller saflaştırılması gelen<em&gt; Legionella</em&gt;-Enfekte Fagositler

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

CDNA&#39;dan rekombinant Newcastle Hastalığı Virüsü Rescue

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Nötrofil İzolasyon ve Analiz Terapötik Ajanların için Lenfoma Hücre Duyarlılık kendi Rolü belirleme

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Bir gen ya da ilaç terapisinde kullanım için, HIV-1 üretim yapan RNA&#39;lar etkinlik ve toksisite Değerlendirilmesi

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Yeni Bir Dünyadan Rekombinant Virüsün Kurtarılması ve Karakterizasyonu Zika Virüsü Bulaşıcı Klon

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Grip virüsü monoklonal antikorları nötralize kaçış türevleri üretimi

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

Algılama ve kaldırma nükleaz kirlenme rekombinant prototip köpüklü virüs Integrase saflaştırılması sırasında

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

Tam kan örneklerinde virüs tespiti için hızlı, güvenli ve basit el ile başucu nükleik asit çıkarma

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...