Name: identification of footprints of rna:protein complexes via rna immunoprecipitation in tandem followed by sequencing (ripit-seq)
Uploaded: 2019-07-10T14:30:00
Description: Watch this Scientific Journal Video about Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq at JoVE.com

Dit werk werd ondersteund door de NIH Grant GM120209 (GS). De auteurs danken de OSUCCC Genomics gedeelde bronnen kern voor hun diensten (CCC ondersteuning Grant NCI P30 CA16058).

1. vaststelling van stabiele HEK293 cellijnen die tetracycline-induceerbaar markeren-gelabeld proteïne van belang (POI)
<ol><li>Seed HEK293 cellen met een stabiel geïntegreerde FLP recombinatie target (FRT)-site met een dichtheid van 10 x 104 cellen/ml in het groeimedium (dulbecco's gemodificeerde eagle's medium [DMEM] + 10% foetaal runderserum [FBS] + 1% penicillaire-streptomycine [Penn/STREP]) in 6- goed borden. Laat cellen 's nachts groeien in een bevoficeerde incubator bij 37 °C en 5% CO2 (...

<ol>
	<li>Karousis, E. D., Nasif, S., M&#252;hlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonsense-mediated+mRNA+decay:+novel+mechanistic+insights+and+biological+impact.">Nonsense-mediated mRNA decay: novel mechanistic insights and biological impact.</a> Wiley Interdisciplinary Reviews: RNA. 7 (5), 661-682 (2016).</li><li>Ivanov, P. V., Gehring, N. H., Kunz, J. B., Hentze, M. W., Kulozik, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+UPF1,+eRFs,+PABP+and+the+exon+junction+complex+suggest+an+integrated+model+for+mammalian+NMD+pathways.">Interactions between UPF1, eRFs, PABP and the exon junction complex suggest an integrated model for mammalian NMD pathways.</a> The EMBO Journal. 27 (5), 736-747 (2008).</li><li>Papasaikas, P., Valc&#225;rcel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Spliceosome:+The+Ultimate+RNA+Chaperone+and+Sculptor.">The Spliceosome: The Ultimate RNA Chaperone and Sculptor.</a> Trends in Biochemical Sciences. 41 (1), 33-45 (2016).</li><li>Jensen, K. B., Darnell, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CLIP:+Crosslinking+and+ImmunoPrecipitation+of+In+Vivo+RNA+Targets+of+RNA-Binding+Proteins.">CLIP: Crosslinking and ImmunoPrecipitation of In Vivo RNA Targets of RNA-Binding Proteins.</a> Methods in Molecular Biology. 488, 85-98 (2008).</li><li>Garzia, A., Morozov, P., Sajek, M., Meyer, C., Tuschl, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PAR-CLIP+for+Discovering+Target+Sites+of+RNA-Binding+Proteins.">PAR-CLIP for Discovering Target Sites of RNA-Binding Proteins.</a> mRNA Decay: Methods and Protocols. 1720, 55-75 (2018).</li><li>Konig, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iCLIP+-+Transcriptome-wide+Mapping+of+Protein-RNA+Interactions+with+Individual+Nucleotide+Resolution.">iCLIP - Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution.</a> Journal of Visualized Experiments. (50), e2638 (2011).</li><li>Sibley, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Individual+Nucleotide+Resolution+UV+Cross-Linking+and+Immunoprecipitation+(iCLIP)+to+Determine+Protein-RNA+Interactions.">Individual Nucleotide Resolution UV Cross-Linking and Immunoprecipitation (iCLIP) to Determine Protein-RNA Interactions.</a> RNA Detection: Methods and Protocols. 1649, 427-454 (2018).</li><li>Wheeler, E. C., Van Nostrand, E. L., Yeo, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+and+challenges+in+the+detection+of+transcriptome&#8208;wide+protein-RNA+interactions.">Advances and challenges in the detection of transcriptome&#8208;wide protein-RNA interactions.</a> Wiley Interdisciplinary Reviews: RNA. 9 (1), (2018).</li><li>Singh, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Cellular+EJC+Interactome+Reveals+Higher-Order+mRNP+Structure+and+an+EJC-SR+Protein+Nexus.">The Cellular EJC Interactome Reveals Higher-Order mRNP Structure and an EJC-SR Protein Nexus.</a> Cell. 151, 750-764 (2012).</li><li>Singh, G., Ricci, E. P., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIPiT-Seq:+A+high-throughput+approach+for+footprinting+RNA:protein+complexes.">RIPiT-Seq: A high-throughput approach for footprinting RNA:protein complexes.</a> Methods. 65, 320-332 (2014).</li><li>Mabin, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Exon+Junction+Complex+Undergoes+a+Compositional+Switch+that+Alters+mRNP+Structure+and+Nonsense-Mediated+mRNA+Decay+Activity.">The Exon Junction Complex Undergoes a Compositional Switch that Alters mRNP Structure and Nonsense-Mediated mRNA Decay Activity.</a> Cell Reports. 25 (9), 2431-2446 (2018).</li><li>Gehring, N. H., Lamprinaki, S., Kulozik, A. E., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disassembly+of+Exon+Junction+Complexes+by+PYM.">Disassembly of Exon Junction Complexes by PYM.</a> Cell. 137 (3), 536-548 (2009).</li><li>Dostie, J., Dreyfuss, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+Is+Required+to+Remove+Y14+from+mRNAs+in+the+Cytoplasm.">Translation Is Required to Remove Y14 from mRNAs in the Cytoplasm.</a> Current Biology. 12 (13), 1060-1067 (2002).</li><li>Z&#252;nd, D., Gruber, A. R., Zavolan, M., M&#252;hlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation-dependent+displacement+of+UPF1+from+coding+sequences+causes+its+enrichment+in+3'+UTRs.">Translation-dependent displacement of UPF1 from coding sequences causes its enrichment in 3' UTRs.</a> Nature Structural &amp; Molecular Biology. 20 (8), 936-943 (2013).</li><li>Gangras, P., Dayeh, D. M., Mabin, J. W., Nakanishi, K., Singh, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+Identification+of+Recombinant+Argonaute-Bound+Small+RNAs+Using+Next-Generation+Sequencing.">Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing.</a> Argonaute Proteins: Methods and Protocols. 1680, 1-28 (2018).</li><li>Heyer, E. E., Ozadam, H., Ricci, E. P., Cenik, C., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+kit-free+method+for+making+strand-specific+deep+sequencing+libraries+from+RNA+fragments.">An optimized kit-free method for making strand-specific deep sequencing libraries from RNA fragments.</a> Nucleic Acids Research. 43 (1), 2 (2015).</li><li>Cameron, V., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3'-Phosphatase+activity+in+T4+polynucleotide+kinase.">3'-Phosphatase activity in T4 polynucleotide kinase.</a> Biochemistry. 16 (23), 5120-5126 (1977).</li><li>Ricci, E. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Staufen1+senses+overall+transcript+secondary+structure+to+regulate+translation.">Staufen1 senses overall transcript secondary structure to regulate translation.</a> Nature Structural &amp; Molecular Biology. 21 (1), 26-35 (2014).</li><li>Lackner, D. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+generic+strategy+for+CRISPR-Cas9-mediated+gene+tagging.">A generic strategy for CRISPR-Cas9-mediated gene tagging.</a> Nature Communications. 6, 10237 (2015).</li><li>Metkar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher-Order+Organization+Principles+of+Pre-translational+mRNPs.">Higher-Order Organization Principles of Pre-translational mRNPs.</a> Molecular Cell. 72 (4), 715-726 (2018).</li><li>Giudice, G., S&#225;nchez-Cabo, F., Torroja, C., Lara-Pezzi, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATtRACT-a+database+of+RNA-binding+proteins+and+associated+motifs.">ATtRACT-a database of RNA-binding proteins and associated motifs.</a> Database: The Journal of Biological Databases and Curation. 2016, (2016).</li><li>Paz, I., Kosti, I., Ares, M., Cline, M., Mandel-Gutfreund, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RBPmap:+a+web+server+for+mapping+binding+sites+of+RNA-binding+proteins.">RBPmap: a web server for mapping binding sites of RNA-binding proteins.</a> Nucleic Acids Research. 42, 361-367 (2014).</li><li>Sundararaman, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resources+for+the+Comprehensive+Discovery+of+Functional+RNA+Elements.">Resources for the Comprehensive Discovery of Functional RNA Elements.</a> Molecular Cell. 61 (6), 903-913 (2016).</li></ol>

We bespreken hier enkele belangrijke overwegingen om RIPiT succesvol uit te voeren. In de allereerste plaats moeten individuele IPs worden geoptimaliseerd om bij elke stap de hoogst mogelijke efficiëntie te bereiken. De hoeveelheid vlag agarose kralen voor het ingevoerde aantal cellen die hier worden beschreven, heeft bewezen robuust te zijn voor een breed scala aan eiwitten die we hebben getest. Aangezien slechts een kleine fractie van partner eiwitten co-immunoprecipitated is met het vlag eiwit, is de hoeveelheid anti...

Binnen cellen bestaat RNA in complex met eiwitten om RNA te vormen: eiwitcomplexen (RNPs). RNPs worden geassembleerd rond RNA bindende eiwitten (RBPs, die direct binden RNA) maar ook bestaan uit niet-RBPs (die binden RBPs maar niet RNA), en zijn vaak dynamisch van aard. RBPs en hun cofactoren functioneren collectief binnen RNPs om regelgevende functies uit te voeren. Bijvoorbeeld, in de nonsens-gemedieerde mRNA Decay (NMD)-pathway herkennen de UPF-eiwitten (UPF1, UPF2 en UPF3b) het voortijdig beëindigde ribosome. Elk van de UPF eiwitten kan binden aan RNA, maar het is pas wanneer ze samen assembleren dat een actief NMD-complex begint te vormen. Binnen dit complex wordt UPF1 verder geactiveerd door fosforylering door een niet-RBP SMG1, en een dergelijke UPF1 activering leidt uiteindelijk tot de werving van mRNA Decay inducerende factoren1,2. In dit voorbeeld vereisen Rbp's niet-RBP-cofactoren voor werving en activering van het RNP-complex dat NMD activeert. Nog een andere eigenschap van RNPs is hun compositorische heterogeniteit. Overweeg de spliceosome, die bestaat in verschillende E, A, B of C complexen. Verschillende spliceosoom complexen hebben overlappende en uitgesproken eiwitten3. Om RNP-functies te bestuderen, is het belangrijk om te verhelmaken welke Rna's gebonden zijn aan een RBP en de bijbehorende eiwitten. Er zijn veel methoden om dit te bereiken, waarbij elke benadering zijn duidelijke voor-en nadelen heeft4,5,6,7.
De meest populaire methoden om RBP binding sites te identificeren-crosslinking gevolgd door immunoprecipitatie (clip) en de verschillende variaties-vertrouw op ultraviolet (UV) licht om een RBP te crosslinken naar RNA8. Echter, dit is niet een effectieve aanpak voor niet-RBPs binnen RNPs, die niet rechtstreeks contact opnemen met het RNA. Hier beschrijven we een alternatieve aanpak die van toepassing is op Rbp's en niet-RBPs, om hun RNA binding-sites te isoleren en te identificeren. Deze aanpak genoemd RNA-immunoprecipitatie in tandem (ripit) bestaat uit twee immunoprecipitatie-stappen, die helpen bij het bereiken van een hogere specificiteit in vergelijking met een enkele zuivering (Figuur 1)9,10. Aangezien de individuele immunoprecipitatie (IP)-stappen met een lagere stringentie kunnen worden uitgevoerd in vergelijking met de clip, is ripit niet afhankelijk van de beschikbaarheid van antilichamen die de aanwezigheid van sterke detergenten tijdens immunoprecipatie kunnen weerstaan. Het meest unieke voordeel van RIPiT is de mogelijkheid om twee verschillende eiwitten te targeten in twee zuiveringsstappen; Dit biedt een krachtige manier om een compositioneel verschillend RNP-complex van andere vergelijkbare complexen11te verrijken.
Kleine variaties op de RIPiT-procedure kunnen de RNP-verrijking verder verbeteren. Sommige interacties van RNA-eiwit of eiwit-eiwit binnen RNPs zijn bijvoorbeeld van voorbijgaande aard en het kan moeilijk zijn om voetafdrukken van dergelijke complexen efficiënt te zuiveren. Om dergelijke interacties te stabiliseren, kan rnps worden gecrosslinkt in cellen met formaldehyde voorafgaand aan cel lysis en ripit. We hebben bijvoorbeeld geconstateerd dat een zwakke interactie tussen de kernfactor van Exon Junction (EJC), EIF4AIII en de disassemblage factor van EJC, PYM12 kan worden gestabiliseerd met een formaldehyde-behandeling, zodat meer RNA-voetafdrukken worden verrijkt (gegevens niet weergegeven). Voorafgaand aan de celoogst en de RIPiT, cellen kunnen ook worden behandeld met drugs te stabiliseren of te verrijken RNPs in een bepaalde staat. Bijvoorbeeld, bij het bestuderen van eiwitten die worden verwijderd uit mRNA tijdens de vertaling (bijvoorbeeld, de EJC13, UPF114), behandeling met Vertaal remmers zoals puromycine, haring of harringtonine kan leiden tot verhoogde bezetting van eiwitten op Rna's.
De hoeveelheid RNA teruggewonnen uit RIPiT is meestal laag (0,5-10 pmollen, dat wil zeggen, 10-250 ng RNA gezien een gemiddelde RNA-lengte van 75 NT). De belangrijkste reden hiervoor is dat slechts een klein deel van een gegeven eiwit aanwezig is in complex met andere eiwitten binnen RNPs (elk "vrij" eiwit dat IP'ed in de eerste stap gaat verloren tijdens het tweede IP). Om RNA-SEQ-bibliotheken van dit RNA te genereren, schetsen we hier ook een aanpassing van het eerder gepubliceerde protocol dat geschikt is voor dergelijke lage RNA-ingangen15,16 (Figuur 2), die een high-throughput sequencing voorbereide samples in 3 oplevert Dagen.

<table border="0" cellpadding="0" cellspacing="0" style="width:1167px;" width="1166">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Anti-FLAG Affinity Gel</td>
			<td style="width:112px;">Sigma</td>
			<td style="width:101px;">A2220</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">ATP, [&#947;-32P]- 3000Ci/mmol 10mCi/ml EasyTide, 250&#181;Ci</td>
			<td style="width:112px;">PerkinElmer</td>
			<td style="width:101px;">BLU502A250UC</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">BD Disposable Syringes with Luer-Lok Tips (200)</td>
			<td style="width:112px;">Fisher</td>
			<td>14-823-435</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Betaine 5M</td>
			<td style="width:112px;">Sigma</td>
			<td style="width:101px;">B0300</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">biotin-dATP</td>
			<td style="width:112px;">TriLink</td>
			<td style="width:101px;">N-5002</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">biotin-dCTP</td>
			<td style="width:112px;">Perkin Elmer</td>
			<td style="width:101px;">NEL540001EA</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Branson Sonifier, Model SSE-1</td>
			<td style="width:112px;">Branson</td>
			<td style="width:101px;"></td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">CircLigase I</td>
			<td style="width:112px;">VWR</td>
			<td style="width:101px;">76081-606</td>
			<td style="width:591px;">ssDNA ligase I</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">DMEM, High Glucose</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">11995-065</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">DNA load buffer NEB</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;"></td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Dynabeads Protein A</td>
			<td style="width:112px;">LifeTech</td>
			<td style="width:101px;">10002D</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Flp-In-T-REx 293 Cell Line</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">R78007</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">GeneRuler Low Range DNA Ladder</td>
			<td style="width:112px;">ThermoScientific</td>
			<td style="width:101px;">FERSM1203</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Hygromycin B</td>
			<td style="width:112px;">ThermoFisher</td>
			<td align="right" style="width:101px;">10687010</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mini-PROTEAN TBE Gel 10 well</td>
			<td style="width:112px;">Bio-Rad</td>
			<td align="right" style="width:101px;">4565013</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">Mini-PROTEAN TBE-Urea Gel</td>
			<td style="width:112px;">Bio-Rad</td>
			<td align="right" style="width:101px;">4566033</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">miRCAT-33 adapter 5&#8242;-TGGAATTCTCGGGTGCCAAGGddC-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mirus transIT-X2 transfection reagent</td>
			<td style="width:112px;">Mirus</td>
			<td style="width:101px;">MIR 6004</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mth RNA ligase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">E2610S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PE1.0 5&#8242;-AATGATACGGCGACCACCGAGATCTACACT 
			CTTTCCCTACACGACGCTCTTCCGATC*T-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PE2.0 5&#8242;-CAAGCAGAAGACGGCATACGAGATCGGTCTC 
			GGCATTCCTGCTGAACCGCTCTTCCGATC*T-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Phenol/Chloroform/Isoamyl Alcohol (25:24:1, pH 6.7, 100ml)</td>
			<td style="width:112px;">Fisher</td>
			<td style="width:101px;">BP1752I-100</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Purple Gel Loading Dye (6x)</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">NEB #7025</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Q5 DNA Polymerase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0491S/L</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:363px;">RNase I, E. coli, 1000 units</td>
			<td style="width:112px;">Eppicenter</td>
			<td style="width:101px;">N6901K</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">SPIN-X column</td>
			<td style="width:112px;">Corning</td>
			<td style="width:101px;">CLS8160-24EA</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">Streptavidin beads</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">60210</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Superscript III (SSIII)</td>
			<td style="width:112px;">ThermoScientific</td>
			<td align="right" style="width:101px;">18080044</td>
			<td style="width:591px;">reverse transcriptase enzyme</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">SybrGold</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">S11494</td>
			<td style="width:591px;">gold nucleic acid gel stain</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:363px;">T4 Polynucleotide Kinase-2500U</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0201L</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">T4RNL2 Tr. K227Q</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0351S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Tetracycline</td>
			<td style="width:112px;">Sigma</td>
			<td align="right" style="width:101px;">87128</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Thermostable 5&#180; App DNA/RNA Ligase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0319S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE1 5&#8242;-pGGCACTANNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE10 5&#8242;-pGGTGTTCNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE11 5&#8242;-pGGTAAGTNNNNNAGATCGGAA 
			GAGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE12 5&#8242;-pGGAGATGNNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE2 5&#8242;-pGGGTAGCNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE35&#8242;-pGGTCGATNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE4 5&#8242;-pGGCCTCGNNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE5 5&#8242;-pGGTGACANNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE6 5&#8242;-pGGTAGACNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC 
			CGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE7 5&#8242;-pGGGCCCTNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCT 
			TCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE8 5&#8242;-pGGATCGGNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTT 
			CCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE9 5&#8242;-pGGACTGANNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC 
			CGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Typhoon 5 Bimolecular Imager</td>
			<td style="width:112px;">GE Healthcare Life Science</td>
			<td align="right" style="width:101px;">29187191</td>
			<td style="width:591px;"></td>
		</tr>
	</tbody>
</table>

identification of footprints of rna:protein complexes via rna immunoprecipitation in tandem followed by sequencing (ripit-seq)

RNA-immunoprecipitatie in tandem (RIPiT) is een methode voor het verrijken van RNA-voetafdrukken van een paar eiwitten binnen een RNA: proteïne (RNP)-complex. RIPiT maakt gebruik van twee zuiveringsstappen. Ten eerste wordt immunoprecipitatie van een gelabelde RNP-subeenheid gevolgd door milde RNase-spijsvertering en daaropvolgende niet-denaturerende affiniteits elutie. Een tweede immunoprecipitatie van een andere RNP-subeenheid maakt verrijking van een gedefinieerd complex mogelijk. Na een denaturerende elutie van Rna's en eiwitten worden de RNA-voetafdrukken omgezet in bibliotheken met een hoge doorvoer voor DNA-sequencing. In tegenstelling tot de meer populaire ultraviolet (UV) crosslinking gevolgd door immunoprecipitatie (clip) benadering om RBP binding sites te verrijken, ripit is UV-crosslinking onafhankelijk. Vandaar RIPiT kan worden toegepast op talrijke eiwitten aanwezig in het RNA interactome en daarbuiten die essentieel zijn voor RNA verordening, maar niet direct contact op met het RNA of UV-crosslink slecht om RNA. De twee zuiveringsstappen in RIPiT bieden een bijkomend voordeel van het identificeren van bindende locaties waar een eiwit van belang in samenwerking met een andere cofactor fungeert. De dubbele zuiverings strategie dient ook om het signaal te verbeteren door de achtergrond te beperken. Hier bieden we een stapsgewijze procedure voor het uitvoeren van RIPiT en het genereren van high-throughput sequencing-bibliotheken van geïsoleerde RNA-voetafdrukken. We schetsen ook de voordelen en toepassingen van RIPiT en bespreken enkele van de beperkingen.

Een succesvolle RIPiT zal resulteren in de immunoprecipitatie van zowel eiwitten van belang en andere bekende interactie eiwitten, en de afwezigheid van niet-interagerende eiwitten. Zoals te zien in Figuur 3A, werden zowel magoh als EIF4AIII aangetroffen in de ripit ELUTION, maar HNRNPA1 was niet (Lane 6). Tegelijkertijd werden RNA-voetafdrukken die samen met de RNP-complexen zijn gezuiverd, gedetecteerd via autoradiografie (Figuur 3B</s...

Watch this Scientific Journal Video about Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq at JoVE.com

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq

Identificatie van voetafdrukken van RNA: eiwitcomplexen via RNA-immunoprecipitatie in tandem gevolgd door sequencing (RIPiT-SEQ)

Hier presenteren we een protocol om endogene RNA binding sites of "Footprints" van RNA: proteïne (RNP) complexen uit zoogdiercellen te verrijken. Deze aanpak omvat twee immunoprecipitaties van RNP-subeenheden en wordt daarom nagesynchroniseerde RNA-immunoprecipitatie in tandem (RIPiT).

RNA immunoprecipitation in tandem (RIPiT) is a method for enriching RNA footprints of a pair of proteins within an RNA:protein (RNP) complex. RIPiT ...

RNA immunoprecipitatie in tandem gevolgd door sequencing, of RIPiT-Seq, is een methode om te bepalen welke regio's van RNA gebonden zijn door een bepaald paar RNA-bindende eiwitten. Het meest unieke voordeel van RIPiT is de mogelijkheid om twee verschillende eiwitten te targeten in twee zuiveringen. Dit biedt een krachtige manier om te verrijken voor een compositorisch onderscheiden RNA-eiwitcomplex uit andere complexen.Ook RIPiT-Seq is UV-crosslinking onafhankelijk, en kan worden toegepast op vele eiwitten die werken op RNA zonder direct binding. Hoewel deze methode zich niet rechtstreeks uitstrekt tot therapie of diagnose, zijn RNA-bindende eiwitten en RNA-verwerking geassocieerd met verschillende ziekten zoals neuropathieën en kanker. RIPiT-Seq biedt een hulpmiddel voor het bestuderen van functies van aan ziekten verbonden RNA-bindende eiwitten.RIPiT-Seq vereist een systeem waarbij een epitoop-tagged eiwit kan worden uitgedrukt. Het is alleen getest in HEK293 cellen, en is het meest vatbaar voor celcultuur. Echter, nu met ons vermogen om eiwitten te taggen met behulp van CRISPR, RIPiT-Seq kan worden toepasbaar op diverse moderne systemen.Het succes van RIPiT hangt af van twee efficiënte immunoprecipitaties, dus het zal van cruciaal belang zijn om immunoprecipitatievoorwaarden te optimaliseren voor het antilichaam dat wordt gebruikt. Ook het werken met RNA vereist de juiste voorzorgsmaatregelen, dus RNase-vrije reagentia moeten worden gebruikt tijdens en na RNA-extractie. Het aantonen van de procedure zal Lauren Woodward zijn, een afgestudeerde student in mijn lab.Begin met het wassen van monolagencellen voorzichtig met 15 milliliter gekoelde PBS per 15 centimeter plaat. Schraap cellen vervolgens af in 30 milliliter PBS en verzamel ze in een conische buis van 50 milliliter. Pellet de cellen door centrifugeren op 400 g gedurende 10 minuten op 4 graden Celsius, en gooi de supernatant.Voeg vier milliliter ijskoude hypotonische lyse buffer toe en gebruik een P1000 pipet om de cellen opnieuw op te schorten. Breng het lysaat over op een buis van vijf milliliter en incubeer 10 minuten op ijs. Plaats het lysaat in een ijsbad en sonicate volgens manuscript richtingen.Voeg vervolgens 108 microliter van vijf molaire natriumchloride toe om de zoutconcentratie aan te passen aan 150 millimolar. Dan, centrifuge het lysaat op 12,000 g gedurende 10 minuten op vier graden Celsius, en verzamel 20 microliter van de supernatant voor westerse vlek analyse. Pre-wash FLAG agarose kralen volgens manuscript aanwijzingen en van toepassing resterende supernatant tot 750 microliter van kralen in een vijf milliliter buis.Incubeer de VLAG agarose kralen met de cel extract voor een tot drie uur op vier graden Celsius met zachte mengen. Na incubatie, pellet de kralen door centrifugatie op 400 g gedurende een minuut op vier graden Celsius, en verzamelen 20 microliters van de supernatant voor westerse vlek analyse. Gooi de resterende supernatant en was de kralen door ze opnieuw in vier milliliter iso wasbuffer.Pellet de kralen weer en verwijder de supernatant. Verdun RNase I in 750 microliters van iso wassen buffer volgens manuscript richtingen, en voeg het toe aan de VLAG agarose kralen. Incubeer het mengsel op vier graden Celsius met zachte mengen, en vervolgens pellet de kralen door centrifugatie.Verzamel 20 microliters supernatant voor westerse vlekanalyse en gooi de rest weg. Was vervolgens de kralen met iso wasbuffer zoals eerder beschreven. Voer vervolgens affiniteit elutie uit door 375 microliters van elutiebuffer toe te voegen aan de kralen, en schud het mengsel zachtjes op vier graden Celsius gedurende een tot twee uur.Na incubatie, pellet de kralen en het verzamelen van een 15 microliter aliquot van de elutie voor westerse vlek analyse. Terwijl affiniteit elutie aan de gang is, uitvoeren magnetische kraal antilichaam vervoeging. Begin met het wassen van 50 microliter magnetische kralen in een milliliter iso wassen buffer.Resuspend de kralen in 100 microliter van vervoeging buffer en voeg de juiste hoeveelheid antilichaam. Vervolgens, incubeer de kralen voor ten minste 10 minuten op kamertemperatuur. Was de magnetische kralen twee maal met vervoegingsbuffer en verdring de kralen in 375 microliter van RIPiT verdunningsbuffer.Bewaar de kralen op ijs tot immunoprecipitatie. Breng de VLAG affiniteit elutie aan op de antilichaam gekoppelde magnetische kralen en incubeer met zachte mengen gedurende een tot twee uur bij vier graden Celsius. Leg de magnetische kralen vast met een magneet en verzamel 15 microliter supernatant voor western blot-analyse.Was vervolgens de kralen zeven keer met iso wasbuffer. Ga verder met het denatureren van elutie door magnetische kralen in 100 microliter duidelijke monsterbuffer te hergebruiken en de suspensie op ijs gedurende 10 minuten uit te broeden. Tijdens incubatie, periodiek flick de kralen om ze opnieuw op te stellen.Leg de magnetische kralen vast op een magneet en verzamel 15 microliter elutie voor westerse vlekkenanalyse. Breng de resterende elutie over naar een nieuwe buis van 1,5 milliliter. Om het RNA te extraheren, voeg je 320 microliter RNase-vrij water en 400 microliter fenol-chloroforme isoamylalcohol toe aan de RIPiT-elutie.Vortex het mengsel en dan centrifugeren op 12,000 g gedurende vijf minuten. Verzamel 350 microliter van de waterige fase in een aparte buis. Voeg natriumacetaat, magnesiumchloride, glycogeen en ethanol toe aan het verzamelde monster en broed het mengsel 's nachts uit bij negatieve 20 graden Celsius.Op de volgende dag, pellet het RNA door centrifugatie op 12,000 g gedurende 30 minuten op vier graden Celsius en was het in 70%ethanol. Behandel na de ethanolwas het RNA met T4 polynucleotide kinase, of PNK, zonder ATP, en voer fenol-chloroform zuivering uit volgens de handschriftrichtingen. Resuspend het schone RNA in 4,5 microliter RNase-vrij water.Om de RNA-opbrengst te kwantificeren, radiolabelt het RNA met PNK en 32P gelabelde ATP's volgens de handschriftaanwijzing. Gebruik een lage afstand DNA ladder en een 20 tot 40 nucleotide synthetische oligo voor grootte en kwantiteit normen. Los het gelabelde RNA op op een 26%ureum-polyacrylamide gel.Droog de gel volgens de handschriftrichtingen en stel de gel bloot aan een fosfoscreen totdat er voldoende signaal wordt gedetecteerd. Deze techniek is gebruikt om de interacties van het exon junction complex of EJC te onderzoeken. Westerse vlekanalyse van eiwitten gezuiverd van elke belangrijke stap in de RIPiT-procedure blijkt dat gezuiverd EJC zowel EIF4A3 als MAGOH bevat.De negatieve controle, HNRNPA1, wordt niet gedetecteerd in de elutie. De sterkte van het RNA footprint signaal correleert met de hoeveelheid RNA eiwit interactie. Een sterkere voetafdruk wordt waargenomen wanneer RIPiT werd uitgevoerd op cellen die met puromycine worden behandeld, wat de EJC-bezetting op RNA verhoogt.Om ervoor te zorgen dat de RIPiT effectief is geweest, is het belangrijk om de efficiëntie van het IP te testen door westerse vlek. Het is ook belangrijk om de hoeveelheid en de kwaliteit van het RNA te beoordelen voordat u verder gaat met diepe sequencing. In 2018 heeft het Singh-lab deze techniek met succes gebruikt om twee compositorisch verschillende variaties van het exonverbindingscomplex te zuiveren en RNA-bindingspatronen te identificeren.Als onderzoekers ervoor kiezen om RNA-voetafdrukken met autoradiografie te detecteren, moeten alle juiste procedures en protocollen voor stralingsveiligheid worden gevolgd.

Research

JoVE Journal

Genetics

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing (RIPiT-Seq)

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

Generatie van inheemse chromatine Immunoprecipitation Sequencing bibliotheken nucleosoom dichtheid p.a.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

Investigation of RNA Synthesis Using 5-Bromouridine Labelling and Immunoprecipitation

Onderzoek van RNA-synthese met behulp van de 5-Bromouridine etikettering en Immunoprecipitation

When steady state RNA levels are compared between two conditions, it is not possible to distinguish whether changes are caused by alterations in ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

Zeldzame gebeurtenis detectie met behulp van fout-gecorrigeerd DNA en RNA Sequencing

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Kunstmatige RNA polymerase II-rek complexen voor het ontleden van co-transcriptionele RNA-verwerkings gebeurtenissen

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

Single-cell RNA Sequencing and Analysis of Human Pancreatic Islets

Eencellige RNA-sequencing en analyse van menselijke pancreatic eilandjes

Pancreatic islets comprise of endocrine cells with distinctive hormone expression patterns. The endocrine cells show functional differences in response to ...

Identification of Circular RNAs using RNA Sequencing

Identificatie van circulaire Rna's met RNA-sequencing

Circular RNAs (circRNAs) are a class of non-coding RNAs involved in functions including micro-RNA (miRNA) regulation, mediation of protein-protein ...

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Tomato Root Transformatie gevolgd door inenting met Ralstonia Solanacearum voor eenvoudige genetische analyse van bacteriële wilt ziekte

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to ...

Screening and Identification of RNA Silencing Suppressors from Secreted Effectors of Plant Pathogens

Screening en identificatie van RNA Silencing Suppressors van secreted effectors of Plant Pathogens

RNA silencing is an evolutionarily conserved, sequence-specific gene regulation mechanism in eukaryotes. Several plant pathogens have evolved proteins ...

Transcriptome-Wide Profiling of Protein-RNA Interactions by Cross-Linking and Immunoprecipitation Mediated by FLAG-Biotin Tandem Purification

Transcriptome-Wide Profilering van Protein-RNA Interacties door Cross-Linking en Immunoprecipitatie Gemedieerd door FLAG-Biotine Tandem Purification

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate ...

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing (ChIP-seq)

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing ChIP-seq

Het ontdekken van de regulatoire doelen van CsgD in salmonella biofilm met Chromatin-immunoprecipitatie en high-throughput sequencing (chip-SEQ)

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique that can be used to discover the regulatory targets of transcription ...