Name: identification of footprints of rna:protein complexes via rna immunoprecipitation in tandem followed by sequencing (ripit-seq)
Uploaded: 2019-07-10T14:30:00
Description: Watch this Scientific Journal Video about Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq at JoVE.com

이 작품은 NIH 보조금 GM120209 (GS)에 의해 지원되었다. 저자는 OSUCCC 유전체학 공유 자원 코어의 서비스에 대해 감사드립니다 (CCC 지원 보조금 NCI P30 CA16058).

1. 테트라사이클린 유도성 플래그 태그 단백질을 발현하는 안정적인 HEK293 세포주 구축 (POI)
<ol><li>안정적으로 통합 된 Flp 재조합 대상 (FRT) 성장 매체에서 10 x 104 세포 / mL의 밀도를 가진 종자 HEK293 세포 (DMEM의 변형 된 독수리배지 [DMEM] + 10 % 태아 소 혈청 [FBS] + 1 % 페니실린 - 스트렙토마이신 [펜 / 연골]) 6- 잘 접시. 세포가 37°C 및 5% CO2에서 가습 된 인큐베이터에서 하룻밤 사이에 성장하도?...

<ol>
	<li>Karousis, E. D., Nasif, S., M&#252;hlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonsense-mediated+mRNA+decay:+novel+mechanistic+insights+and+biological+impact.">Nonsense-mediated mRNA decay: novel mechanistic insights and biological impact.</a> Wiley Interdisciplinary Reviews: RNA. 7 (5), 661-682 (2016).</li><li>Ivanov, P. V., Gehring, N. H., Kunz, J. B., Hentze, M. W., Kulozik, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+UPF1,+eRFs,+PABP+and+the+exon+junction+complex+suggest+an+integrated+model+for+mammalian+NMD+pathways.">Interactions between UPF1, eRFs, PABP and the exon junction complex suggest an integrated model for mammalian NMD pathways.</a> The EMBO Journal. 27 (5), 736-747 (2008).</li><li>Papasaikas, P., Valc&#225;rcel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Spliceosome:+The+Ultimate+RNA+Chaperone+and+Sculptor.">The Spliceosome: The Ultimate RNA Chaperone and Sculptor.</a> Trends in Biochemical Sciences. 41 (1), 33-45 (2016).</li><li>Jensen, K. B., Darnell, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CLIP:+Crosslinking+and+ImmunoPrecipitation+of+In+Vivo+RNA+Targets+of+RNA-Binding+Proteins.">CLIP: Crosslinking and ImmunoPrecipitation of In Vivo RNA Targets of RNA-Binding Proteins.</a> Methods in Molecular Biology. 488, 85-98 (2008).</li><li>Garzia, A., Morozov, P., Sajek, M., Meyer, C., Tuschl, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PAR-CLIP+for+Discovering+Target+Sites+of+RNA-Binding+Proteins.">PAR-CLIP for Discovering Target Sites of RNA-Binding Proteins.</a> mRNA Decay: Methods and Protocols. 1720, 55-75 (2018).</li><li>Konig, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iCLIP+-+Transcriptome-wide+Mapping+of+Protein-RNA+Interactions+with+Individual+Nucleotide+Resolution.">iCLIP - Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution.</a> Journal of Visualized Experiments. (50), e2638 (2011).</li><li>Sibley, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Individual+Nucleotide+Resolution+UV+Cross-Linking+and+Immunoprecipitation+(iCLIP)+to+Determine+Protein-RNA+Interactions.">Individual Nucleotide Resolution UV Cross-Linking and Immunoprecipitation (iCLIP) to Determine Protein-RNA Interactions.</a> RNA Detection: Methods and Protocols. 1649, 427-454 (2018).</li><li>Wheeler, E. C., Van Nostrand, E. L., Yeo, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+and+challenges+in+the+detection+of+transcriptome&#8208;wide+protein-RNA+interactions.">Advances and challenges in the detection of transcriptome&#8208;wide protein-RNA interactions.</a> Wiley Interdisciplinary Reviews: RNA. 9 (1), (2018).</li><li>Singh, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Cellular+EJC+Interactome+Reveals+Higher-Order+mRNP+Structure+and+an+EJC-SR+Protein+Nexus.">The Cellular EJC Interactome Reveals Higher-Order mRNP Structure and an EJC-SR Protein Nexus.</a> Cell. 151, 750-764 (2012).</li><li>Singh, G., Ricci, E. P., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIPiT-Seq:+A+high-throughput+approach+for+footprinting+RNA:protein+complexes.">RIPiT-Seq: A high-throughput approach for footprinting RNA:protein complexes.</a> Methods. 65, 320-332 (2014).</li><li>Mabin, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Exon+Junction+Complex+Undergoes+a+Compositional+Switch+that+Alters+mRNP+Structure+and+Nonsense-Mediated+mRNA+Decay+Activity.">The Exon Junction Complex Undergoes a Compositional Switch that Alters mRNP Structure and Nonsense-Mediated mRNA Decay Activity.</a> Cell Reports. 25 (9), 2431-2446 (2018).</li><li>Gehring, N. H., Lamprinaki, S., Kulozik, A. E., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disassembly+of+Exon+Junction+Complexes+by+PYM.">Disassembly of Exon Junction Complexes by PYM.</a> Cell. 137 (3), 536-548 (2009).</li><li>Dostie, J., Dreyfuss, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+Is+Required+to+Remove+Y14+from+mRNAs+in+the+Cytoplasm.">Translation Is Required to Remove Y14 from mRNAs in the Cytoplasm.</a> Current Biology. 12 (13), 1060-1067 (2002).</li><li>Z&#252;nd, D., Gruber, A. R., Zavolan, M., M&#252;hlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation-dependent+displacement+of+UPF1+from+coding+sequences+causes+its+enrichment+in+3'+UTRs.">Translation-dependent displacement of UPF1 from coding sequences causes its enrichment in 3' UTRs.</a> Nature Structural &amp; Molecular Biology. 20 (8), 936-943 (2013).</li><li>Gangras, P., Dayeh, D. M., Mabin, J. W., Nakanishi, K., Singh, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+Identification+of+Recombinant+Argonaute-Bound+Small+RNAs+Using+Next-Generation+Sequencing.">Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing.</a> Argonaute Proteins: Methods and Protocols. 1680, 1-28 (2018).</li><li>Heyer, E. E., Ozadam, H., Ricci, E. P., Cenik, C., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+kit-free+method+for+making+strand-specific+deep+sequencing+libraries+from+RNA+fragments.">An optimized kit-free method for making strand-specific deep sequencing libraries from RNA fragments.</a> Nucleic Acids Research. 43 (1), 2 (2015).</li><li>Cameron, V., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3'-Phosphatase+activity+in+T4+polynucleotide+kinase.">3'-Phosphatase activity in T4 polynucleotide kinase.</a> Biochemistry. 16 (23), 5120-5126 (1977).</li><li>Ricci, E. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Staufen1+senses+overall+transcript+secondary+structure+to+regulate+translation.">Staufen1 senses overall transcript secondary structure to regulate translation.</a> Nature Structural &amp; Molecular Biology. 21 (1), 26-35 (2014).</li><li>Lackner, D. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+generic+strategy+for+CRISPR-Cas9-mediated+gene+tagging.">A generic strategy for CRISPR-Cas9-mediated gene tagging.</a> Nature Communications. 6, 10237 (2015).</li><li>Metkar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher-Order+Organization+Principles+of+Pre-translational+mRNPs.">Higher-Order Organization Principles of Pre-translational mRNPs.</a> Molecular Cell. 72 (4), 715-726 (2018).</li><li>Giudice, G., S&#225;nchez-Cabo, F., Torroja, C., Lara-Pezzi, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATtRACT-a+database+of+RNA-binding+proteins+and+associated+motifs.">ATtRACT-a database of RNA-binding proteins and associated motifs.</a> Database: The Journal of Biological Databases and Curation. 2016, (2016).</li><li>Paz, I., Kosti, I., Ares, M., Cline, M., Mandel-Gutfreund, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RBPmap:+a+web+server+for+mapping+binding+sites+of+RNA-binding+proteins.">RBPmap: a web server for mapping binding sites of RNA-binding proteins.</a> Nucleic Acids Research. 42, 361-367 (2014).</li><li>Sundararaman, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resources+for+the+Comprehensive+Discovery+of+Functional+RNA+Elements.">Resources for the Comprehensive Discovery of Functional RNA Elements.</a> Molecular Cell. 61 (6), 903-913 (2016).</li></ol>

여기에서 RIPiT를 성공적으로 수행하기 위한 몇 가지 주요 고려 사항에 대해 설명합니다. 무엇보다도 개별 IP는 각 단계에서 가능한 최고의 효율성을 달성하기 위해 최적화되어야 합니다. 여기에 기술된 세포의 입력 수에 대한 FLAG 아가로즈 비드의 양은 우리가 시험한 광범위한 단백질에 대해 견고하다는 것이 입증되었습니다. 파트너 단백질의 극히 일부만이 FLAG 단백질과 공존하기 때문에, 효율적?...

세포 내에서 RNA는 RNA를 형성하는 단백질과 복합체에 존재합니다: 단백질 복합체 (RNPs). RNP는 RNA 결합 단백질 (RBPs, RNA를 직접 결합하는 단백질)의 주위에 조립되고 또한 비 RBCPs (RBPs를 결합하지만 RNA를 결합하지 않는) 또한 포함하고, 종종 자연에서 동적입니다. RP와 그 보조 인자는 RP 내에서 총체적으로 기능하여 규제 기능을 실행합니다. 예를 들어, 말도 안되는 매개 mRNA 붕괴(NMD) 통로에서, UPF 단백질(UPF1, UPF2, 및 UPF3b)은 조기에 종단된 리보솜을 인식한다. 각각의 UPF 단백질은 RNA에 결합할 수 있지만, 활성 NMD 복합체가 형성되기 시작하는 것은 함께 조립할 때만 가능합니다. 이러한 복합체 내에서, UPF1은 비-RBP SMG1에 의한 인산화에 의해 더욱 활성화되고, 이러한 UPF1 활성화는 결국 mRNA 부패 유도 인자1,2의모집으로 이끈다. 이 예에서, RbP는 NMD를 트리거하는 RNP 복합체의 모집 및 활성화를 위한 비 RBP 공동 인자가 필요합니다. 그러나 RNP의 또 다른 재산은 그들의 조성 이질성이다. 별개의 E, A, B 또는 C 복합체에 존재하는 스플리세오좀을 고려하십시오. 다른 스플리세오좀 복합체는 중첩되고뚜렷한 단백질 3. RNP 기능을 연구하기 위하여는, 어떤 RNA가 RBP 및 그것의 관련단백질에 의해 구속되는지 밝히는 것이 중요합니다. 이를 달성하기 위해 많은 방법이 존재하며, 각 접근법은 4,5,6,7.
RBP 결합 부위를 식별하는 널리 널리 사용되는 방법 - 면역 침전 (CLIP) 및 다양한 변화에 이어 가교 - RNA8에RBP를 교차 연결하기 위해 자외선 (UV) 빛에 의존. 그러나, 이것은 RNA를 직접 접촉하지 않는 RNPs 내의 비 RP를 위한 효과적인 접근이 아닙니다. 여기서, 우리는 그들의 RNA 결합 사이트를 격리하고 확인하기 위하여, RbP 및 비 RP 에 모두 적용할 수 있는 대안 적인 접근을 기술합니다. 이러한 접근법은 RNA 면역침전과 탠덤(RIPiT)으로 구성되어 있으며, 이는 단일 정제에 비해 더 높은 특이성을 달성하는데 도움이 되는 두 가지 면역 침전 단계로 구성된다(도 1)9,10. 개별 면역 침전 (IP) 단계는 CLIP에 비해 더 낮은 순도에서 수행 될 수 있기 때문에, RIPiT는 면역 침전 동안 강한 세제의 존재를 견딜 수있는 항체의 가용성에 의존하지 않는다. RIPiT의 가장 독특한 장점은 두 가지 정제 단계에서 두 개의 서로 다른 단백질을 대상으로 하는 능력입니다. 이는 다른 유사한 복합체(11)로부터 조성적으로 구별되는RNP 복합체를 풍부하게 하는 강력한 방법을 제공한다.
RIPiT 절차에 작은 변화는 RNP 농축을 더욱 향상시킬 수 있습니다. 예를 들면, RNPs 내의 몇몇 RNA 단백질 또는 단백질 단백질 상호 작용은 일시적이고 그 같은 복합물의 발자국을 능등하게 정화하는 것은 어려울 지도 모릅니다. 이러한 상호 작용을 안정화하기 위해, RNP는 세포 포름 포름과 RIPiT 전에 세포 내에서 상호 연결 될 수있다. 예를 들어, 우리는 엑시온 접합 복합체(EJC) 코어 팩터, EIF4AIII 및 EJC 분해 인자 사이의 약한 상호작용이 관찰되었으며, PYM12는 포름알데히드 처리로 안정화될 수 있어 더 많은 RNA 발자국이 풍부해지는 것을 관찰했습니다(데이터는 를 표시합니다). 세포 수확 및 RIPiT 이전에, 세포는 또한 특정 상태에서 RNPs를 안정화또는 풍부하게 하는 약물로 치료될 수 있다. 예를 들어, 번역 중에 mRNA에서 제거되는 단백질을 연구할 때(예를 들어, EJC13,UPF114),푸로마이신, 사이클로헴시미드 또는 해링턴틴과 같은 번역 억제제로 치료하는 경우, RNA에 단백질.
RIPiT로부터 회수된 RNA의 양은 보통 낮다(0.5-10 페몰, 즉, 평균 RNA 길이를 고려한 10-250 ng RNA 75 nt). 이를 위한 주된 이유는 주어진 단백질의 극히 일부분만이 RNP 내의 다른 단백질과 복합체로 존재하기 때문입니다(첫 번째 단계에서 의 임의의 "자유" 단백질 IP'ed는 두 번째 IP 동안 손실됩니다). 이 RNA에서 RNA-Seq 라이브러리를 생성하기 위해, 우리는 또한 여기에 이러한 낮은 RNA 입력에 적합한 이전에 게시 된 프로토콜의 적응개요15,16 (그림2),이는 3에서 높은 처리량 시퀀싱 준비 샘플을 산출 일.

<table border="0" cellpadding="0" cellspacing="0" style="width:1167px;" width="1166">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Anti-FLAG Affinity Gel</td>
			<td style="width:112px;">Sigma</td>
			<td style="width:101px;">A2220</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">ATP, [&#947;-32P]- 3000Ci/mmol 10mCi/ml EasyTide, 250&#181;Ci</td>
			<td style="width:112px;">PerkinElmer</td>
			<td style="width:101px;">BLU502A250UC</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">BD Disposable Syringes with Luer-Lok Tips (200)</td>
			<td style="width:112px;">Fisher</td>
			<td>14-823-435</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Betaine 5M</td>
			<td style="width:112px;">Sigma</td>
			<td style="width:101px;">B0300</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">biotin-dATP</td>
			<td style="width:112px;">TriLink</td>
			<td style="width:101px;">N-5002</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">biotin-dCTP</td>
			<td style="width:112px;">Perkin Elmer</td>
			<td style="width:101px;">NEL540001EA</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Branson Sonifier, Model SSE-1</td>
			<td style="width:112px;">Branson</td>
			<td style="width:101px;"></td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">CircLigase I</td>
			<td style="width:112px;">VWR</td>
			<td style="width:101px;">76081-606</td>
			<td style="width:591px;">ssDNA ligase I</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">DMEM, High Glucose</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">11995-065</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">DNA load buffer NEB</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;"></td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Dynabeads Protein A</td>
			<td style="width:112px;">LifeTech</td>
			<td style="width:101px;">10002D</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Flp-In-T-REx 293 Cell Line</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">R78007</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">GeneRuler Low Range DNA Ladder</td>
			<td style="width:112px;">ThermoScientific</td>
			<td style="width:101px;">FERSM1203</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Hygromycin B</td>
			<td style="width:112px;">ThermoFisher</td>
			<td align="right" style="width:101px;">10687010</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mini-PROTEAN TBE Gel 10 well</td>
			<td style="width:112px;">Bio-Rad</td>
			<td align="right" style="width:101px;">4565013</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">Mini-PROTEAN TBE-Urea Gel</td>
			<td style="width:112px;">Bio-Rad</td>
			<td align="right" style="width:101px;">4566033</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">miRCAT-33 adapter 5&#8242;-TGGAATTCTCGGGTGCCAAGGddC-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mirus transIT-X2 transfection reagent</td>
			<td style="width:112px;">Mirus</td>
			<td style="width:101px;">MIR 6004</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mth RNA ligase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">E2610S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PE1.0 5&#8242;-AATGATACGGCGACCACCGAGATCTACACT 
			CTTTCCCTACACGACGCTCTTCCGATC*T-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PE2.0 5&#8242;-CAAGCAGAAGACGGCATACGAGATCGGTCTC 
			GGCATTCCTGCTGAACCGCTCTTCCGATC*T-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Phenol/Chloroform/Isoamyl Alcohol (25:24:1, pH 6.7, 100ml)</td>
			<td style="width:112px;">Fisher</td>
			<td style="width:101px;">BP1752I-100</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Purple Gel Loading Dye (6x)</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">NEB #7025</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Q5 DNA Polymerase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0491S/L</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:363px;">RNase I, E. coli, 1000 units</td>
			<td style="width:112px;">Eppicenter</td>
			<td style="width:101px;">N6901K</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">SPIN-X column</td>
			<td style="width:112px;">Corning</td>
			<td style="width:101px;">CLS8160-24EA</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">Streptavidin beads</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">60210</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Superscript III (SSIII)</td>
			<td style="width:112px;">ThermoScientific</td>
			<td align="right" style="width:101px;">18080044</td>
			<td style="width:591px;">reverse transcriptase enzyme</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">SybrGold</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">S11494</td>
			<td style="width:591px;">gold nucleic acid gel stain</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:363px;">T4 Polynucleotide Kinase-2500U</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0201L</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">T4RNL2 Tr. K227Q</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0351S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Tetracycline</td>
			<td style="width:112px;">Sigma</td>
			<td align="right" style="width:101px;">87128</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Thermostable 5&#180; App DNA/RNA Ligase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0319S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE1 5&#8242;-pGGCACTANNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE10 5&#8242;-pGGTGTTCNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE11 5&#8242;-pGGTAAGTNNNNNAGATCGGAA 
			GAGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE12 5&#8242;-pGGAGATGNNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE2 5&#8242;-pGGGTAGCNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE35&#8242;-pGGTCGATNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE4 5&#8242;-pGGCCTCGNNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE5 5&#8242;-pGGTGACANNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE6 5&#8242;-pGGTAGACNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC 
			CGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE7 5&#8242;-pGGGCCCTNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCT 
			TCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE8 5&#8242;-pGGATCGGNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTT 
			CCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE9 5&#8242;-pGGACTGANNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC 
			CGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Typhoon 5 Bimolecular Imager</td>
			<td style="width:112px;">GE Healthcare Life Science</td>
			<td align="right" style="width:101px;">29187191</td>
			<td style="width:591px;"></td>
		</tr>
	</tbody>
</table>

identification of footprints of rna:protein complexes via rna immunoprecipitation in tandem followed by sequencing (ripit-seq)

나란히 RNA 면역 침전 (RIPiT)는 RNA: 단백질 (RNP) 복합체 내의 단백질 쌍의 RNA 발자국을 풍부하게하는 방법입니다. RIPiT는 두 가지 정화 단계를 사용합니다. 먼저, 태그된 RNP 소단위의 면역침전은 경증 RNase 소화 및 후속 비-비-비-변성 친화성 용출이 뒤따른다. 다른 RNP 소단위의 두 번째 면역 침전은 정의된 복합체의 농축을 허용한다. RNA 및 단백질의 변성 용출 후, RNA 발자국은 고처리량 DNA 시퀀싱 라이브러리로 변환됩니다. RBP 결합 부위를 풍부하게 하기 위한 면역 침전(CLIP) 접근법에 이어 보다 대중적인 자외선(UV) 가교 와는 달리, RIPiT는 UV-가교 독립적이다. 따라서 RIPiT는 RNA 상호 작용에 존재하는 수많은 단백질에 적용될 수 있으며 그 이상으로 RNA 조절에 필수적이지만 RNA 또는 UV-크로스링크와 직접 접촉하지 않아 RNA에 제대로 접촉하지 않는다. RIPiT의 2가지 정제 단계는 관심 있는 단백질이 다른 보조 인자와 협력하여 작용하는 결합 부위를 식별하는 추가적인 이점을 제공합니다. 이중 정제 전략은 또한 배경을 제한하여 신호를 향상시키는 역할을합니다. 여기서는 RIPiT를 수행하고 격리된 RNA 발자국에서 고처리량 시퀀싱 라이브러리를 생성하는 단계별 절차를 제공합니다. 또한 RIPiT의 장점과 응용 프로그램에 대해 간략하게 설명하고 몇 가지 제한 사항에 대해 설명합니다.

성공적인 RIPiT는 관심 있는 단백질과 다른 알려진 상호 작용 단백질의 면역 침전, 비 상호 작용하는 단백질의 부재를 초래할 것이다. 도 3A에서볼 수 있듯이, 마고 및 EIF4AIII 모두 RIPiT 용출에서 검출되었지만 HNRNPA1은 아니었다(레인 6). 병렬로, RNP 복합체와 공존한 RNA 발자국은 자가방사선(도3B) 또는 생체분석기(도...

Watch this Scientific Journal Video about Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq at JoVE.com

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq

RNA의 발자국 의 식별:연속RNA 면역 침전을 통한 단백질 복합체 시퀀싱 (RIPiT-Seq)

여기에서, 우리는 포유류 세포에서 내인성 RNA 결합 사이트 또는 RNA의 "발자국"을 풍부하게 하는 프로토콜을 제시합니다:단백질 (RNP) 복합체. 이 접근은 RNP 소단위의 2개의 면역 강절을 관련시키고 그러므로 나란히 RNA 면역 침전이라고 불립니다 (RIPiT).

RNA immunoprecipitation in tandem (RIPiT) is a method for enriching RNA footprints of a pair of proteins within an RNA:protein (RNP) complex. RIPiT ...

RNA 면역침전은 시퀀싱, 또는 RIPiT-Seq에 선행된 탠덤의 RNA 면역침전은, RNA의 특정 한 쌍의 RNA 결합 단백질에 의해 결합되는 RNA의 어떤 지구를 확인하는 방법이다. RIPiT의 가장 독특한 장점은 두 가지 정제에서 두 가지 단백질을 표적으로 하는 능력입니다. 이것은 다른 복합체에서 조성으로 구별되는 RNA 단백질 복합체를 위해 풍부하게 하는 강력한 방법을 제공합니다.또한, RIPiT-Seq는 UV-크로스링크 독립적이며, 직접적으로 결합하지 않고 RNA에 작용하는 많은 단백질에 적용될 수 있다. 이 방법은 치료 또는 진단쪽으로 직접 확장되지 않는 동안, RNA 결합 단백질 및 RNA 처리는 신경병증과 암 같이 몇몇 질병과 연관되었습니다. RIPiT-Seq는 질병 관련 RNA 결합 단백질의 기능을 연구하기 위한 도구를 제공합니다.RIPiT-Seq는 에피토프 태그 단백질을 발현할 수 있는 시스템이 필요합니다. HEK293 세포에서만 테스트되었으며 세포 배양에 가장 순종합니다. 그러나 이제 CRISPR을 사용하여 단백질에 태그를 붙일 수 있는 RIPiT-Seq는 다양한 현대 시스템에 적용할 수 있습니다.RIPiT의 성공은 두 가지 효율적인 면역 침전도에 따라 달라지므로 사용되는 항체에 대한 면역 침전 조건을 최적화하는 것이 중요합니다. 또한 RNA로 작업하려면 적절한 예방 조치가 필요하므로 RNA 추출 중 및 후에 RNase 가없는 시약을 사용해야합니다. 절차를 시연하는 것은 내 실험실대학원생인 로렌 우드워드가 될 것입니다.15센티미터 플레이트당 15밀리리터의 냉장 PBS로 단층 세포를 부드럽게 세척합니다. 그런 다음 세포를 PBS 30 밀리리터로 긁어 50 밀리리터 원내 튜브로 수집합니다. 섭씨 4도에서 10분 동안 400g에서 원심분리하여 세포를 펠렛하고, 상류부를 폐기한다.얼음 차가운 저혈압 용해 버퍼 4 밀리리터를 추가하고 P1000 파이펫을 사용하여 세포를 다시 일시 중단합니다. 용양을 5밀리리터 튜브로 옮기고 얼음에 10분 간 배양합니다. 얼음 욕조에 lysate를 놓고 원고 의 지시에 따라 초음파 처리합니다.그런 다음 염분 농도를 150 밀리머로 조정하기 위해 염화 나트륨 5개중 108마이크로리터를 첨가합니다. 이어서, 12, 000g에서 100g의 리세지를 섭씨 4도에서 원심분리하고, 서부 블롯 분석을 위해 20마이크로리터를 수집한다. 사전 세척 플래그 아가로즈 구슬 원고 방향에 따라 5 밀리리터 튜브에 구슬의 750 마이크로 리터에 남아있는 슈퍼 너티드를 적용합니다.플래그 아가로즈 구슬을 셀 추출물과 함께 4°C에서 1~3시간 동안 부드러운 믹싱으로 배양합니다. 인큐베이션 후, 4°C에서 1분 동안 400g의 원심분리로 구슬을 펠릿하고, 서부 블롯 분석을 위해 20마이크로리터를 수집한다. 남은 상체를 버리고 이소 세척 버퍼 4밀리리터로 재보설하여 구슬을 씻으십시오.구슬을 다시 펠릿하고 상체를 제거합니다. RNase I를 원고 방향에 따라 이소 세척 버퍼750 마이크로리터에 희석하고 플래그 아가로즈 구슬에 추가합니다. 부드러운 혼합과 섭씨 4도에서 혼합물을 배양한 다음 구슬을 원심분리로 펠릿합니다.서부 얼룩 분석을 위해 20 마이크로리터의 상체를 수집하고 나머지는 폐기하십시오. 그런 다음, 앞서 설명한 대로 이소 세척 버퍼로 구슬을 씻는다. 다음으로, 구슬에 용출 버퍼 375 마이크로리터를 추가하고, 1~2시간 동안 섭씨 4도에서 부드럽게 혼합물을 흔들어 친화성 용출을 수행한다.인큐베이션 후, 구슬을 펠릿과 서쪽 블롯 분석을 위한 용출의 15 마이크로리터 알리쿼트를 수집한다. 친화성 용출이 진행되는 동안 자기 비드 항체 연상을 수행하십시오. 이소 세척 버퍼의 1 밀리리터에 자기 구슬 50 마이크로 리터를 세척하여 시작합니다.구슬을 100 마이크로리터의 인주화 완충제에서 재보중단하고 적절한 양의 항체를 첨가한다. 그런 다음 실온에서 구슬을 10 분 이상 배양하십시오. 자기 구슬을 컨쥬게이션 버퍼로 두 번 세척하고 RIPiT 희석 버퍼의 375 마이크로 리터에서 구슬을 재연하십시오.면역 침전될 때까지 구슬을 얼음에 보관하십시오. FLAG 선호도 용출을 항체 결합 마그네틱 구슬에 적용하고 섭씨 4도에서 1~2시간 동안 부드러운 혼합으로 인큐베이션을 적용합니다. 자석으로 마그네틱 구슬을 캡처하고 서부 블롯 분석을 위해 15 마이크로리터의 상피리터를 수집합니다.그런 다음, 이소 세척 버퍼로 구슬을 7 번 씻는다. 투명 시료 버퍼 100마이크로리터에서 자기 구슬을 재연하고 10분 동안 얼음에 현탁액을 배양하여 용출을 제거합니다. 인큐베이션 중에 주기적으로 구슬을 쓸어 다시 보입니다.자석에 자기 구슬을 캡처하고 서쪽 얼룩 분석을 위해 용출의 15 마이크로 리터를 수집합니다. 남은 용용을 새로운 1.5 밀리리터 튜브로 옮는다. RNA를 추출하려면 RNase 가 없는 물 320마이크로리터와 400마이크로리터의 페놀 클로로폼 이소아밀 알코올을 RIPiT 용출에 추가합니다.혼합물을 소용돌이시키고 원심분리기는 12, 000g에서 5분간 분리합니다. 수성 상 350마이크로리터를 별도의 튜브로 수집합니다. 아세테이트 나트륨, 염화 마그네슘, 글리코겐 및 에탄올을 수집된 샘플에 넣고 밤새 음수 섭씨 20도에서 혼합물을 배양합니다.다음 날, RNA는 12, 000g에서 30분간 섭씨 4도에서 원심분리로 RNA를 환전하여 70%에탄올로 세척합니다. 에탄올 세척 후, ATP 없이 T4 폴리뉴클레오티드 키나아제 또는 PNK로 RNA를 치료하고 원고 방향에 따라 페놀 클로로포름 정제를 수행한다. RNase 가 없는 물의 4.5 마이크로리터에서 깨끗한 RNA를 다시 중단합니다.RNA 수율을 정량화하기 위하여는, 원고 지침에 따라 AtPs를 표시한 PNK 및 32P로 RNA를 라디오 라벨. 크기 및 수량 표준에 대해 저거리 DNA 사다리와 20~40개의 뉴클레오티드 합성 올리고를 사용합니다. 26%의 우레아 폴리아크라이아미드 젤로 표지된 RNA를 해결한다.원고 의 지시에 따라 젤을 건조하고 적절한 신호가 감지 될 때까지 인스크린에 젤을 노출. 이 기술은 엑슨 접합 복합체 또는 EJC의 상호 작용을 조사하는 데 사용되었습니다. RIPiT 절차의 각 주요 단계에서 정제된 단백질의 서양 얼룩 분석은 정제된 EJC가 EIF4A3과 MAGOH를 모두 포함하고 있음을 보여줍니다.음의 대조군 HNRNPA1은 용출에서 검출되지 않는다. RNA 발자국 신호의 강도는 RNA 단백질 상호작용의 양과 상관관계가 있다. RIPiT가 RNA에 EJC 점유율을 증가 puromycin로 처리된 세포에 RIPiT가 수행될 때 더 강한 발자국이 관찰됩니다.RIPiT가 효과적이도록 하려면 서부 얼룩별로 IP의 효율성을 테스트하는 것이 중요합니다. 심층 시퀀싱을 진행하기 전에 RNA의 양과 품질을 평가하는 것도 중요합니다. 2018년 Singh 연구소는 이 기술을 사용하여 엑슨 접합 복합체의 두 가지 구성적으로 뚜렷한 변이를 정화하고 RNA 결합 패턴을 식별했습니다.연구원이 사인 방사선 사진으로 RNA 발자국을 검출하기로 결정하면 모든 적절한 방사선 안전 절차 및 프로토콜을 따라야합니다.

Research

JoVE Journal

Genetics

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing (RIPiT-Seq)

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

네이티브 Chromatin Immunoprecipitation Nucleosome 밀도 분석을 위한 라이브러리를 시퀀싱의 세대

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

연구

유전학

Investigation of RNA Synthesis Using 5-Bromouridine Labelling and Immunoprecipitation

5-Bromouridine 라벨 및 Immunoprecipitation를 사용 하 여 RNA 합성의 조사

When steady state RNA levels are compared between two conditions, it is not possible to distinguish whether changes are caused by alterations in ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

드문 이벤트 감지 오류 수정 DNA와 RNA 시퀀싱을 사용 하 여

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

인공 RNA 폴리머라제 II 연신복합체 해부 공동 전사 RNA 처리 이벤트

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

Single-cell RNA Sequencing and Analysis of Human Pancreatic Islets

단세포 RNA 시퀀싱 및 인간 췌장 섬 분석

Pancreatic islets comprise of endocrine cells with distinctive hormone expression patterns. The endocrine cells show functional differences in response to ...

Identification of Circular RNAs using RNA Sequencing

RNA 시퀀싱을 사용하는 원형 RNA 식별

Circular RNAs (circRNAs) are a class of non-coding RNAs involved in functions including micro-RNA (miRNA) regulation, mediation of protein-protein ...

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

세균성 윌트 질병의 간단한 유전 분석을 위한 랄스토니아 솔라나세아룸에 의한 접종에 이어 토마토 뿌리 변환

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to ...

Screening and Identification of RNA Silencing Suppressors from Secreted Effectors of Plant Pathogens

식물 병원균의 분비 이펙터에서 RNA 침묵 억제제의 스크리닝 및 식별

RNA silencing is an evolutionarily conserved, sequence-specific gene regulation mechanism in eukaryotes. Several plant pathogens have evolved proteins ...

Transcriptome-Wide Profiling of Protein-RNA Interactions by Cross-Linking and Immunoprecipitation Mediated by FLAG-Biotin Tandem Purification

플래그-비오틴 탠덤 정화에 의해 중재된 상호 연결 및 면역 침전을 통해 단백질-RNA 상호 작용의 전사-전체 프로파일링

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate ...

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing (ChIP-seq)

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing ChIP-seq

크로마틴 면역침전 및 고처리량 시퀀싱(ChIP-seq)을 이용한 살모넬라 바이오필름의 CsgD 규제 목표 발견

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique that can be used to discover the regulatory targets of transcription ...