Name: identification of footprints of rna:protein complexes via rna immunoprecipitation in tandem followed by sequencing (ripit-seq)
Uploaded: 2019-07-10T14:30:00
Description: Watch this Scientific Journal Video about Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq at JoVE.com

Este trabajo fue apoyado por la subvención de NIH GM120209 (GS). Los autores agradecen al Núcleo de Recursos Compartidos de OSUCCC Genomics por sus servicios (CCC Support Grant NCI P30 CA16058).

1. Establecimiento de líneas de celda hek293 estables que expresan proteína de interés con etiqueta FLAG con etiqueta DE TETRA (POI)
<ol><li>Células HEK293 semillas con un objetivo de recombinación Flp establemente integrado (FRT) a una densidad de 10 x 104 células/ml en medio de crecimiento (medio de águila modificado de Dulbecco [DMEM] + 10% suero bovino fetal [FBS] + 1% penicilina-estreptomicina [penn/strep]) en 6- platos de pozo. Permitir que las células crezcan durante la noche en una </sub...

<ol>
	<li>Karousis, E. D., Nasif, S., M&#252;hlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonsense-mediated+mRNA+decay:+novel+mechanistic+insights+and+biological+impact.">Nonsense-mediated mRNA decay: novel mechanistic insights and biological impact.</a> Wiley Interdisciplinary Reviews: RNA. 7 (5), 661-682 (2016).</li><li>Ivanov, P. V., Gehring, N. H., Kunz, J. B., Hentze, M. W., Kulozik, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+UPF1,+eRFs,+PABP+and+the+exon+junction+complex+suggest+an+integrated+model+for+mammalian+NMD+pathways.">Interactions between UPF1, eRFs, PABP and the exon junction complex suggest an integrated model for mammalian NMD pathways.</a> The EMBO Journal. 27 (5), 736-747 (2008).</li><li>Papasaikas, P., Valc&#225;rcel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Spliceosome:+The+Ultimate+RNA+Chaperone+and+Sculptor.">The Spliceosome: The Ultimate RNA Chaperone and Sculptor.</a> Trends in Biochemical Sciences. 41 (1), 33-45 (2016).</li><li>Jensen, K. B., Darnell, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CLIP:+Crosslinking+and+ImmunoPrecipitation+of+In+Vivo+RNA+Targets+of+RNA-Binding+Proteins.">CLIP: Crosslinking and ImmunoPrecipitation of In Vivo RNA Targets of RNA-Binding Proteins.</a> Methods in Molecular Biology. 488, 85-98 (2008).</li><li>Garzia, A., Morozov, P., Sajek, M., Meyer, C., Tuschl, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PAR-CLIP+for+Discovering+Target+Sites+of+RNA-Binding+Proteins.">PAR-CLIP for Discovering Target Sites of RNA-Binding Proteins.</a> mRNA Decay: Methods and Protocols. 1720, 55-75 (2018).</li><li>Konig, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iCLIP+-+Transcriptome-wide+Mapping+of+Protein-RNA+Interactions+with+Individual+Nucleotide+Resolution.">iCLIP - Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution.</a> Journal of Visualized Experiments. (50), e2638 (2011).</li><li>Sibley, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Individual+Nucleotide+Resolution+UV+Cross-Linking+and+Immunoprecipitation+(iCLIP)+to+Determine+Protein-RNA+Interactions.">Individual Nucleotide Resolution UV Cross-Linking and Immunoprecipitation (iCLIP) to Determine Protein-RNA Interactions.</a> RNA Detection: Methods and Protocols. 1649, 427-454 (2018).</li><li>Wheeler, E. C., Van Nostrand, E. L., Yeo, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+and+challenges+in+the+detection+of+transcriptome&#8208;wide+protein-RNA+interactions.">Advances and challenges in the detection of transcriptome&#8208;wide protein-RNA interactions.</a> Wiley Interdisciplinary Reviews: RNA. 9 (1), (2018).</li><li>Singh, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Cellular+EJC+Interactome+Reveals+Higher-Order+mRNP+Structure+and+an+EJC-SR+Protein+Nexus.">The Cellular EJC Interactome Reveals Higher-Order mRNP Structure and an EJC-SR Protein Nexus.</a> Cell. 151, 750-764 (2012).</li><li>Singh, G., Ricci, E. P., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIPiT-Seq:+A+high-throughput+approach+for+footprinting+RNA:protein+complexes.">RIPiT-Seq: A high-throughput approach for footprinting RNA:protein complexes.</a> Methods. 65, 320-332 (2014).</li><li>Mabin, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Exon+Junction+Complex+Undergoes+a+Compositional+Switch+that+Alters+mRNP+Structure+and+Nonsense-Mediated+mRNA+Decay+Activity.">The Exon Junction Complex Undergoes a Compositional Switch that Alters mRNP Structure and Nonsense-Mediated mRNA Decay Activity.</a> Cell Reports. 25 (9), 2431-2446 (2018).</li><li>Gehring, N. H., Lamprinaki, S., Kulozik, A. E., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disassembly+of+Exon+Junction+Complexes+by+PYM.">Disassembly of Exon Junction Complexes by PYM.</a> Cell. 137 (3), 536-548 (2009).</li><li>Dostie, J., Dreyfuss, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+Is+Required+to+Remove+Y14+from+mRNAs+in+the+Cytoplasm.">Translation Is Required to Remove Y14 from mRNAs in the Cytoplasm.</a> Current Biology. 12 (13), 1060-1067 (2002).</li><li>Z&#252;nd, D., Gruber, A. R., Zavolan, M., M&#252;hlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation-dependent+displacement+of+UPF1+from+coding+sequences+causes+its+enrichment+in+3'+UTRs.">Translation-dependent displacement of UPF1 from coding sequences causes its enrichment in 3' UTRs.</a> Nature Structural &amp; Molecular Biology. 20 (8), 936-943 (2013).</li><li>Gangras, P., Dayeh, D. M., Mabin, J. W., Nakanishi, K., Singh, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+Identification+of+Recombinant+Argonaute-Bound+Small+RNAs+Using+Next-Generation+Sequencing.">Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing.</a> Argonaute Proteins: Methods and Protocols. 1680, 1-28 (2018).</li><li>Heyer, E. E., Ozadam, H., Ricci, E. P., Cenik, C., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+kit-free+method+for+making+strand-specific+deep+sequencing+libraries+from+RNA+fragments.">An optimized kit-free method for making strand-specific deep sequencing libraries from RNA fragments.</a> Nucleic Acids Research. 43 (1), 2 (2015).</li><li>Cameron, V., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3'-Phosphatase+activity+in+T4+polynucleotide+kinase.">3'-Phosphatase activity in T4 polynucleotide kinase.</a> Biochemistry. 16 (23), 5120-5126 (1977).</li><li>Ricci, E. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Staufen1+senses+overall+transcript+secondary+structure+to+regulate+translation.">Staufen1 senses overall transcript secondary structure to regulate translation.</a> Nature Structural &amp; Molecular Biology. 21 (1), 26-35 (2014).</li><li>Lackner, D. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+generic+strategy+for+CRISPR-Cas9-mediated+gene+tagging.">A generic strategy for CRISPR-Cas9-mediated gene tagging.</a> Nature Communications. 6, 10237 (2015).</li><li>Metkar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher-Order+Organization+Principles+of+Pre-translational+mRNPs.">Higher-Order Organization Principles of Pre-translational mRNPs.</a> Molecular Cell. 72 (4), 715-726 (2018).</li><li>Giudice, G., S&#225;nchez-Cabo, F., Torroja, C., Lara-Pezzi, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATtRACT-a+database+of+RNA-binding+proteins+and+associated+motifs.">ATtRACT-a database of RNA-binding proteins and associated motifs.</a> Database: The Journal of Biological Databases and Curation. 2016, (2016).</li><li>Paz, I., Kosti, I., Ares, M., Cline, M., Mandel-Gutfreund, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RBPmap:+a+web+server+for+mapping+binding+sites+of+RNA-binding+proteins.">RBPmap: a web server for mapping binding sites of RNA-binding proteins.</a> Nucleic Acids Research. 42, 361-367 (2014).</li><li>Sundararaman, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resources+for+the+Comprehensive+Discovery+of+Functional+RNA+Elements.">Resources for the Comprehensive Discovery of Functional RNA Elements.</a> Molecular Cell. 61 (6), 903-913 (2016).</li></ol>

Aquí analizamos algunas consideraciones clave para realizar correctamente RIPiT. En primer lugar, las IP individuales deben optimizarse para lograr la máxima eficiencia posible en cada paso. La cantidad de perlas de agarosa FLAG para el número de entrada de células descritas aquí ha demostrado ser robusta para una amplia gama de proteínas que hemos probado. Dado que sólo una pequeña fracción de las proteínas asociadas se coinmunopreciada con la proteína FLAG, la cantidad de anticuerpos necesarias para una segu...

Dentro de las células, el ARN existe en complejos con proteínas para formar complejos de ARN:proteínas (RNPs). Los RRP se ensamblan alrededor de proteínas de unión al ARN (RBP, aquellas que unen directamente el ARN) pero también comprenden los RBP no (aquellos que unen los PBP pero no el ARN), y a menudo son dinámicos en la naturaleza. Los BBP y sus cofactores funcionan colectivamente dentro de los RNP para ejecutar funciones regulatorias. Por ejemplo, en la vía de descomposición del ARNm mediado por tonterías (NMD), las proteínas UPF (UPF1, UPF2 y UPF3b) reconocen el ribosoma terminado prematuramente. Cada una de las proteínas UPF puede unirse al ARN, pero es sólo cuando se ensamblan juntas que comienza a formarse un complejo NMD activo. Dentro de este complejo, UPF1 se activa aún más por fosforilación por un SMG1 no RBP, y dicha activación UPF1 eventualmente conduce a la contratación de factores inductores de descomposición de ARNm1,2. En este ejemplo, los RBP requieren cofactores que no son DeRBP para el reclutamiento y la activación del complejo RNP que activa NMD. Otra propiedad de los RNPs es su heterogeneidad compositiva. Considere el spliceosoma, que existe en los complejos distintos E, A, B o C. Diferentes complejos de spliceos tienenproteínas superpuestas y distintas 3. Para estudiar las funciones de RNP, es importante dilucidar qué ARN están unidos por una RBP y sus proteínas asociadas. Existen muchos métodos para lograrlo, con cada enfoque teniendo sus claras ventajas y desventajas4,5,6,7.
Los métodos más populares para identificar los sitios de unión de la RBP —reticulación seguido de inmunoprecipitación (CLIP) y sus diversas variaciones— dependen de la luz ultravioleta (UV) para cruzar una RBP al ARN8. Sin embargo, este no es un enfoque eficaz para los no RBP dentro de los RMP, que no entran en contacto directamente con el ARN. Aquí, describimos un enfoque alternativo que es aplicable a los BBP y no BBP por igual, para aislar e identificar sus sitios de enlace de ARN. Este enfoque llamado inmunoprecipitación de ARN en tándem (RIPiT) consta de dos pasos de inmunoprecipitación, que ayudan a lograr una mayor especificidad en comparación con una sola purificación (Figura1)9,10. Como los pasos de inmunoprecipitación individual (IP) se pueden llevar a cabo con una cuerda más baja en comparación con CLIP, RIPiT no depende de la disponibilidad de anticuerpos que puedan soportar la presencia de detergentes fuertes durante la inmunoprecipitación. La ventaja más singular de RIPiT es la capacidad de apuntar a dos proteínas diferentes en dos pasos de purificación; esto proporciona una manera poderosa de enriquecer un complejo RNP diferenciado compositivamente de otros complejos similares11.
Pequeñas variaciones en el procedimiento RIPiT pueden mejorar aún más el enriquecimiento de RNP. Por ejemplo, algunas interacciones ARN-proteína o proteína-proteína dentro de los RNPs son transitorias y puede ser difícil purificar eficientemente las huellas de estos complejos. Para estabilizar tales interacciones, los RNP pueden ser reticulados dentro de las células con formaldehído antes de la lisis celular y RIPiT. Por ejemplo, hemos observado que una interacción débil entre el factor de núcleo del complejo de unión exón (EJC), EIF4AIII y el factor de desmontaje del EJC, PYM12 puede estabilizarse con el tratamiento de formaldehído de modo que se enriquezcan más huellas de ARN (datos no se muestra). Antes de la cosecha celular y RIPiT, las células también pueden ser tratadas con medicamentos para estabilizar o enriquecer los RMP en un estado particular. Por ejemplo, cuando se estudian proteínas que se eliminan del ARNm durante la traducción (por ejemplo, el EJC13, UPF114), el tratamiento con inhibidores de la traducción como la puromicina, la cicloheximida o la harringtonina puede proteínas en los ARN.
La cantidad de ARN recuperada de RIPiT suele ser baja (0,5-10 pmoles, es decir, 10-250 ng de ARN teniendo una longitud media de ARN de 75 nt). La razón principal de esto es que sólo una pequeña fracción de una proteína dada está presente en complejo con otras proteínas dentro de los NRP (cualquier proteína "libre" IP'ed en el primer paso se pierde durante el segundo IP). Para generar bibliotecas RNA-Seq a partir de este ARN, también describimos aquí una adaptación del protocolo publicado anteriormente adecuado para tales entradas de ARN bajas15,16 (Figura2), que produce muestras listas para secuenciación de alto rendimiento en 3 Días.

<table border="0" cellpadding="0" cellspacing="0" style="width:1167px;" width="1166">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Anti-FLAG Affinity Gel</td>
			<td style="width:112px;">Sigma</td>
			<td style="width:101px;">A2220</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">ATP, [&#947;-32P]- 3000Ci/mmol 10mCi/ml EasyTide, 250&#181;Ci</td>
			<td style="width:112px;">PerkinElmer</td>
			<td style="width:101px;">BLU502A250UC</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">BD Disposable Syringes with Luer-Lok Tips (200)</td>
			<td style="width:112px;">Fisher</td>
			<td>14-823-435</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Betaine 5M</td>
			<td style="width:112px;">Sigma</td>
			<td style="width:101px;">B0300</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">biotin-dATP</td>
			<td style="width:112px;">TriLink</td>
			<td style="width:101px;">N-5002</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">biotin-dCTP</td>
			<td style="width:112px;">Perkin Elmer</td>
			<td style="width:101px;">NEL540001EA</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Branson Sonifier, Model SSE-1</td>
			<td style="width:112px;">Branson</td>
			<td style="width:101px;"></td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">CircLigase I</td>
			<td style="width:112px;">VWR</td>
			<td style="width:101px;">76081-606</td>
			<td style="width:591px;">ssDNA ligase I</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">DMEM, High Glucose</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">11995-065</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">DNA load buffer NEB</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;"></td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Dynabeads Protein A</td>
			<td style="width:112px;">LifeTech</td>
			<td style="width:101px;">10002D</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Flp-In-T-REx 293 Cell Line</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">R78007</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">GeneRuler Low Range DNA Ladder</td>
			<td style="width:112px;">ThermoScientific</td>
			<td style="width:101px;">FERSM1203</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Hygromycin B</td>
			<td style="width:112px;">ThermoFisher</td>
			<td align="right" style="width:101px;">10687010</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mini-PROTEAN TBE Gel 10 well</td>
			<td style="width:112px;">Bio-Rad</td>
			<td align="right" style="width:101px;">4565013</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">Mini-PROTEAN TBE-Urea Gel</td>
			<td style="width:112px;">Bio-Rad</td>
			<td align="right" style="width:101px;">4566033</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">miRCAT-33 adapter 5&#8242;-TGGAATTCTCGGGTGCCAAGGddC-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mirus transIT-X2 transfection reagent</td>
			<td style="width:112px;">Mirus</td>
			<td style="width:101px;">MIR 6004</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Mth RNA ligase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">E2610S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PE1.0 5&#8242;-AATGATACGGCGACCACCGAGATCTACACT 
			CTTTCCCTACACGACGCTCTTCCGATC*T-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PE2.0 5&#8242;-CAAGCAGAAGACGGCATACGAGATCGGTCTC 
			GGCATTCCTGCTGAACCGCTCTTCCGATC*T-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Phenol/Chloroform/Isoamyl Alcohol (25:24:1, pH 6.7, 100ml)</td>
			<td style="width:112px;">Fisher</td>
			<td style="width:101px;">BP1752I-100</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Purple Gel Loading Dye (6x)</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">NEB #7025</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Q5 DNA Polymerase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0491S/L</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:23px;width:363px;">RNase I, E. coli, 1000 units</td>
			<td style="width:112px;">Eppicenter</td>
			<td style="width:101px;">N6901K</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">SPIN-X column</td>
			<td style="width:112px;">Corning</td>
			<td style="width:101px;">CLS8160-24EA</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">Streptavidin beads</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">60210</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Superscript III (SSIII)</td>
			<td style="width:112px;">ThermoScientific</td>
			<td align="right" style="width:101px;">18080044</td>
			<td style="width:591px;">reverse transcriptase enzyme</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">SybrGold</td>
			<td style="width:112px;">ThermoFisher</td>
			<td style="width:101px;">S11494</td>
			<td style="width:591px;">gold nucleic acid gel stain</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:363px;">T4 Polynucleotide Kinase-2500U</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0201L</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:363px;">T4RNL2 Tr. K227Q</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0351S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Tetracycline</td>
			<td style="width:112px;">Sigma</td>
			<td align="right" style="width:101px;">87128</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:363px;">Thermostable 5&#180; App DNA/RNA Ligase</td>
			<td style="width:112px;">NEB</td>
			<td style="width:101px;">M0319S</td>
			<td style="width:591px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE1 5&#8242;-pGGCACTANNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE10 5&#8242;-pGGTGTTCNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE11 5&#8242;-pGGTAAGTNNNNNAGATCGGAA 
			GAGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE12 5&#8242;-pGGAGATGNNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE2 5&#8242;-pGGGTAGCNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE35&#8242;-pGGTCGATNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT 
			CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE4 5&#8242;-pGGCCTCGNNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE5 5&#8242;-pGGTGACANNNNNAGATCGGAAGA 
			GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC 
			TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE6 5&#8242;-pGGTAGACNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC 
			CGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE7 5&#8242;-pGGGCCCTNNNNNAGATCGGAAG 
			AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCT 
			TCCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE8 5&#8242;-pGGATCGGNNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTT 
			CCGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TruSeq_SE9 5&#8242;-pGGACTGANNNNNAGATCGGAAGAG 
			CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC 
			CGATCTCCTTGGCACCCGAGAATTCCA-3&#8242;</td>
			<td>Any</td>
			<td></td>
			<td style="width:591px;">this protocol is only compatible with the Illumina sequencing platform</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:363px;">Typhoon 5 Bimolecular Imager</td>
			<td style="width:112px;">GE Healthcare Life Science</td>
			<td align="right" style="width:101px;">29187191</td>
			<td style="width:591px;"></td>
		</tr>
	</tbody>
</table>

identification of footprints of rna:protein complexes via rna immunoprecipitation in tandem followed by sequencing (ripit-seq)

La inmunoprecipitación de ARN en tándem (RIPiT) es un método para enriquecer las huellas de ARN de un par de proteínas dentro de un complejo de ARN:proteína (RNP). RIPiT emplea dos pasos de purificación. En primer lugar, la inmunoprecipitación de una subunidad RNP etiquetada es seguida por una digestión leve de RNase y una posterior elución de afinidad no desnaturalizante. Una segunda inmunoprecipitación de otra subunidad RNP permite el enriquecimiento de un complejo definido. Después de una eliminación desnaturalización de ARN y proteínas, las huellas de ARN se convierten en bibliotecas de secuenciación de ADN de alto rendimiento. A diferencia del más popular reticulación ultravioleta (UV) seguido de enfoque de inmunoprecipitación (CLIP) para enriquecer los sitios de unión RBP, RIPiT es independiente de la reticulación UV. Por lo tanto, RIPiT se puede aplicar a numerosas proteínas presentes en el interactome de ARN y más allá que son esenciales para la regulación del ARN, pero no contactan directamente con el ARN o UV-crosslink mal al ARN. Los dos pasos de purificación en RIPiT proporcionan una ventaja adicional de identificar sitios de unión donde una proteína de interés actúa en asociación con otro cofactor. La estrategia de doble purificación también sirve para mejorar la señal limitando el fondo. Aquí, proporcionamos un procedimiento paso a paso para realizar RIPiT y generar bibliotecas de secuenciación de alto rendimiento a partir de huellas de ARN aisladas. También describimos las ventajas y aplicaciones de RIPiT y discutimos algunas de sus limitaciones.

Un RIPiT exitoso resultará en la inmunoprecipitación de proteínas de interés y otras proteínas interactuantes conocidas, y la ausencia de proteínas no interactúas. Como se ve en la Figura 3A,magoh y EIF4AIII se detectaron en la elución RIPiT, pero HNRNPA1 no lo fue (carril 6). Paralelamente, las huellas de ARN que se han copurificado con los complejos RNP se detectaron mediante autoradiografía (Figura3B) o bioanalizador...

Watch this Scientific Journal Video about Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq at JoVE.com

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq

Identificación de Huellas de ARN:Complejos proteicos a través de la inmunoprecipitación de ARN en tándem seguido de secuenciación (RIPiT-Seq)

Aquí, presentamos un protocolo para enriquecer los sitios endógenos de unión al ARN o "huellas" de los complejos de ARN:proteína (RNP) de células de mamíferos. Este enfoque implica dos inmunoprecipitaciones de subunidades RNP y por lo tanto se denomina inmunoprecipitación de ARN en tándem (RIPiT).

RNA immunoprecipitation in tandem (RIPiT) is a method for enriching RNA footprints of a pair of proteins within an RNA:protein (RNP) complex. RIPiT ...

La inmunoprecipitación de ARN en tándem seguida de la secuenciación, o RIPiT-Seq, es un método para identificar qué regiones de ARN están unidas por un par particular de proteínas de unión al ARN. La ventaja más singular de RIPiT es su capacidad para apuntar a dos proteínas diferentes en dos purificaciones. Esto proporciona una manera poderosa de enriquecer para un complejo de proteínas de ARN compositivamente distinto de otros complejos.Además, RIPiT-Seq es independiente de la reticulación UV, y se puede aplicar a muchas proteínas que actúan sobre el ARN sin unirlo directamente. Si bien este método no se extiende directamente hacia la terapia o el diagnóstico, las proteínas de unión al ARN y el procesamiento de ARN se han asociado con varias enfermedades como las neuropatías y el cáncer. RIPiT-Seq proporciona una herramienta para estudiar las funciones de las proteínas de unión al ARN ligadas a la enfermedad.RIPiT-Seq requiere un sistema en el que se pueda expresar una proteína etiquetada con epitopo. Sólo se ha probado en células HEK293, y es más susceptible al cultivo celular. Sin embargo, ahora con nuestra capacidad de etiquetar proteínas usando CRISPR, RIPiT-Seq puede ser aplicable a diversos sistemas modernos.El éxito de RIPiT depende de dos inmunoprecipitaciones eficientes, por lo que será fundamental optimizar las condiciones de inmunoprecipitación para el anticuerpo que se utiliza. Además, trabajar con ARN requiere las precauciones adecuadas, por lo que se deben utilizar reactivos libres de RNase durante y después de la extracción de ARN. Demostrando el procedimiento estará Lauren Woodward, una estudiante graduada en mi laboratorio.Comience lavando las células monocapa suavemente con 15 mililitros de PBS refrigerado por placa de 15 centímetros. Luego raspa las células en 30 mililitros de PBS y recógelas en un tubo cónico de 50 mililitros. Pele el líquido de las células centrifugando a 400 g durante 10 minutos a 4 grados Centígrados, y deseche el sobrenadante.Agregue cuatro mililitros de tampón de lysis hipotónica helada y utilice una pipeta P1000 para volver a suspender las células. Transfiera el izado a un tubo de cinco mililitros e incubar sobre hielo durante 10 minutos. Coloque el izado en un baño de hielo y sonice de acuerdo con las instrucciones del manuscrito.A continuación, añada 108 microlitros de cinco molares de cloruro sódico para ajustar la concentración de sal a 150 mililitros. Luego, centrifugar el licato a 12.000 g durante 10 minutos a cuatro grados centígrados, y recoger 20 microlitros del sobrenadante para el análisis de manchas occidentales. Pre-lavado FLAG agarrose cuentas de acuerdo con las instrucciones del manuscrito y aplicar el sobrenadante restante a 750 microlitros de cuentas en un tubo de cinco mililitros.Incubar las cuentas de agarosa FLAG con el extracto de la célula durante una a tres horas a cuatro grados Centígrados con una mezcla suave. Después de la incubación, pele el descarte de las cuentas por centrifugación a 400 g durante un minuto a cuatro grados Celsius, y recoger 20 microlitros del sobrenadante para el análisis de manchas occidentales. Deseche el sobrenadante restante y lave las perlas resusppendándolas en cuatro mililitros de tampón de lavado iso.Pele las perlas de nuevo y retire el sobrenadante. Diluir RNase I en 750 microlitros de iso wash buffer de acuerdo con las instrucciones del manuscrito, y añadirlo a las cuentas de agarosa FLAG. Incubar la mezcla a cuatro grados centígrados con una mezcla suave, y luego peletizar las cuentas por centrifugación.Recoger 20 microlitros de sobrenadante para el análisis de manchas occidentales, y descartar el resto. A continuación, lave las perlas con el tampón de lavado iso como se describió anteriormente. A continuación, realice la elución de afinidad añadiendo 375 microlitros de tampón de elución a las cuentas, y agitando la mezcla suavemente a cuatro grados centígrados durante una a dos horas.Después de la incubación, pele el cordón de las cuentas y recoger una alícuota de 15 microlitros de la elución para el análisis de manchas occidentales. Mientras la elución de afinidad está en marcha, realice la conjugación magnética de anticuerpos de cuentas. Comience lavando 50 microlitros de cuentas magnéticas en un mililitro de tampón de lavado iso.Resuspender las perlas en 100 microlitros de tampón de conjugación y añadir la cantidad adecuada de anticuerpos. Luego, incuba las cuentas durante al menos 10 minutos a temperatura ambiente. Lave las perlas magnéticas dos veces con tampón de conjugación y resuspender las perlas en 375 microlitros de tampón de dilución RIPiT.Almacene las cuentas sobre hielo hasta la inmunoprecipitación. Aplique la elución de afinidad FLAG a las perlas magnéticas acopladas a anticuerpos e incubar con una mezcla suave durante una a dos horas a cuatro grados Centígrados. Captura las perlas magnéticas con un imán y recoge 15 microlitros de sobrenadantes para el análisis de manchas occidentales.A continuación, lave las cuentas siete veces con el tampón de lavado iso. Proceda con la elución de desnaturalización resuspendiendo las perlas magnéticas en 100 microlitros de tampón de muestra transparente e incubando la suspensión sobre hielo durante 10 minutos. Durante la incubación, deslice periódicamente las cuentas para resuspenderlas.Captura las perlas magnéticas en un imán y recoge 15 microlitros de elución para el análisis de manchas occidentales. Transfiera la elución restante a un nuevo tubo de 1,5 mililitros. Para extraer el ARN, agregue 320 microlitros de agua libre de RNase y 400 microlitros de alcohol isoamilo fenol-cloroformo a la elución RIPiT.Vórtice la mezcla y luego centrifugarlo a 12.000 g durante cinco minutos. Recoger 350 microlitros de la fase acuosa en un tubo separado. Añadir acetato de sodio, cloruro de magnesio, glucógeno y etanol a la muestra recogida e incubar la mezcla durante la noche a 20 grados Celsius negativos.Al día siguiente, pele el ARN por centrifugación a 12.000 g durante 30 minutos a cuatro grados centígrados y lávelo en 70%etanol. Después del lavado de etanol, tratar el ARN con T4 polinucleótido quinasa, o PNK, sin ningún ATP, y realizar la purificación de fenol-cloroformo de acuerdo con las instrucciones del manuscrito. Resuspender el ARN limpio en 4,5 microlitros de agua sin RNase.Para cuantificar el rendimiento del ARN, radioetiquete el ARN con PNK y los ATP etiquetados con PNK de acuerdo con las instrucciones del manuscrito. Utilice una escalera de ADN de rango bajo y un oligo sintético de 20 a 40 nucleótidos para estándares de tamaño y cantidad. Resuelva el ARN etiquetado en un gel de 26%urea-poliacrilamida.Seque el gel de acuerdo con las instrucciones del manuscrito y exponga el gel a una fosfobancia hasta que se detecte una señal adecuada. Esta técnica se ha utilizado para investigar las interacciones del complejo de unión de exones o EJC. El análisis de manchas occidentales de proteínas purificadas de cada paso importante del procedimiento RIPiT muestra que el EJC purificado contiene EIF4A3 y MAGOH.El control negativo, HNRNPA1, no se detecta en la elución. La fuerza de la señal de huella de ARN se correlaciona con la cantidad de interacción con la proteína de ARN. Se observa una huella más fuerte cuando se realizó RIPiT en células tratadas con puromicina, lo que aumenta la ocupación de LA ÉRH en el ARN.Para garantizar que el RIPiT ha sido eficaz, es importante probar la eficiencia de la IP por western blot. También es importante evaluar la cantidad y la calidad del ARN antes de proceder con secuenciación profunda. En 2018, el laboratorio de Singh utilizó con éxito esta técnica para purificar dos variaciones composicionalmente distintas del complejo de unión de exones e identificar patrones de unión de ARN.Si los investigadores optan por detectar huellas de ARN con autoradiografía, se deben seguir todos los procedimientos y protocolos adecuados de seguridad radiológica.

Research

JoVE Journal

Genetics

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing (RIPiT-Seq)

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

Generación de inmunoprecipitación de la cromatina nativa secuenciación bibliotecas para el análisis de densidad de nucleosoma

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

Investigación

Genética

Investigation of RNA Synthesis Using 5-Bromouridine Labelling and Immunoprecipitation

Investigación de la síntesis de RNA utilizando 5-Bromouridine etiquetado e inmunoprecipitación

When steady state RNA levels are compared between two conditions, it is not possible to distinguish whether changes are caused by alterations in ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

Detección de eventos raros usando ADN Error corregido y secuenciación de ARN

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Complejos de alargamiento de ARN polimerasa artificial II para disecar eventos de procesamiento de ARN co-transcripcional

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

Single-cell RNA Sequencing and Analysis of Human Pancreatic Islets

Secuenciación y análisis de islotes pancreáticos humanos de una sola célula

Pancreatic islets comprise of endocrine cells with distinctive hormone expression patterns. The endocrine cells show functional differences in response to ...

Identification of Circular RNAs using RNA Sequencing

Identificación de ARN circulares mediante secuenciación de ARN

Circular RNAs (circRNAs) are a class of non-coding RNAs involved in functions including micro-RNA (miRNA) regulation, mediation of protein-protein ...

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Transformación de raíz de tomate Seguida de inoculación con Ralstonia Solanacearum para el análisis genético directo de la enfermedad bacteriana de Wilt

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to ...

Screening and Identification of RNA Silencing Suppressors from Secreted Effectors of Plant Pathogens

Detección e identificación de supresores de silenciamiento de ARN de efectos secretos de patógenos vegetales

RNA silencing is an evolutionarily conserved, sequence-specific gene regulation mechanism in eukaryotes. Several plant pathogens have evolved proteins ...

Transcriptome-Wide Profiling of Protein-RNA Interactions by Cross-Linking and Immunoprecipitation Mediated by FLAG-Biotin Tandem Purification

Perfilado en todo el transcriptoma de las interacciones entre proteínas y ARN por enlace cruzado e inmunoprecipitación mediada por la purificación en tándem FLAG-Biotin

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate ...

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing (ChIP-seq)

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing ChIP-seq

Descubrimiento de objetivos reguladores de CsgD en biofilm de Salmonella utilizando inmunoprecipitación de cromatina y secuenciación de alto rendimiento (ChIP-seq)

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique that can be used to discover the regulatory targets of transcription ...