Name: agrobacterium-mediated genetic transformation, transgenic production, and its application for the study of male reproductive development in rice
Uploaded: 2020-10-06T14:00:00
Description: Watch this Scientific Journal Video about Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice at JoVE.com

저자는 샤오페이 첸이 쌀 조직 배양 배지를 만드는 데 있어 젊은 쌀 꽃가루와 도움을 제공한 것에 대해 인정하고 자합니다. 이 작품은 중국 국립 자연 과학 재단 (31900611)에 의해 지원되었다.

1. sgRNA-CAS9 플랜트 발현 벡터 시공 및 아그로박테리움-중재된변환
<ol><li>발표된문헌(28)에따라 쌀에 남성 멸균 유전자 OsABCG15를 표적으로 한다.</li>
	<li>OsABCG15의 두 번째 엑소에서 106-125 bp 사이에 위치한 표적 부위에 대한 sgRNA설계(그림 1).</li>
	<li>T4 폴리뉴클레오티드 키나아제는 sgRNA 올리고(sgR-OsABCG15-F: 5'TGGCAAGCACATCCTCAAGGGAT3' 및 5'sgR-OsABCG1...

<ol>
	<li>Izawa, T., Shimamoto, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Becoming+a+model+plant:+The+importance+of+rice+to+plant+science.">Becoming a model plant: The importance of rice to plant science.</a> Trends in Plant Science. 1 (3), 95-99 (1996).</li><li>Shimamoto, K., Kyozuka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+as+a+model+for+comparative+genomics+of+plants.">Rice as a model for comparative genomics of plants.</a> Annual Review of Plant Biology. 53 (1), 399-419 (2002).</li><li>Selva, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybrid+breeding+in+wheat:+how+shaping+floral+biology+can+offer+new+perspectives.">Hybrid breeding in wheat: how shaping floral biology can offer new perspectives.</a> Functional Plant Biology. 47 (8), 675-694 (2020).</li><li>Lippman, Z. B., Zamir, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterosis:+revisiting+the+magic.">Heterosis: revisiting the magic.</a> Trends in Genetics. 23 (2), 60-66 (2007).</li><li>Zhang, D., Liang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+food+security:+using+male+fertility+for+hybrid+seed+breeding.">Improving food security: using male fertility for hybrid seed breeding.</a> Science. , 45-48 (2016).</li><li>Masters, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-Mediated+Immature+Embryo+Transformation+of+Recalcitrant+Maize+Inbred+Lines+Using+Morphogenic+Genes.">Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes.</a> Journal of Visualized Experiments. (156), e60782 (2020).</li><li>Laurenceau, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+type+IV+pilus+mediates+DNA+binding+during+natural+transformation+in+Streptococcus+pneumoniae.">A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.</a> PLoS Pathogens. 9 (6), 1003473 (2013).</li><li>Tzfira, T., Citovsky, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+genetic+transformation+of+plants:+biology+and+biotechnology.">Agrobacterium-mediated genetic transformation of plants: biology and biotechnology.</a> Current Opinion in Biotechnology. 17 (2), 147-154 (2006).</li><li>Gelvin, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+in+the+genomics+age.">Agrobacterium in the genomics age.</a> Plant Physiology. 150 (4), 1665-1676 (2009).</li><li>Lacroix, B., Citovsky, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+roles+of+bacterial+and+host+plant+factors+in+Agrobacterium-mediated+genetic+transformation.">The roles of bacterial and host plant factors in Agrobacterium-mediated genetic transformation.</a> International Journal of Developmental Biology. 57, 467-481 (2013).</li><li>Hiei, Y., Komari, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+rice+using+immature+embryos+or+calli+induced+from+mature+seed.">Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed.</a> Nature Protocols. 3 (5), 824 (2008).</li><li>Hiei, Y., Ohta, S., Komari, T., Kumashiro, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+rice+(Oryza+sativa+L.)+mediated+by+Agrobacterium+and+sequence+analysis+of+the+boundaries+of+the+T-DNA.">Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA.</a> The Plant Journal. 6 (2), 271-282 (1994).</li><li>Hiei, Y., Komari, T., Kubo, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+rice+mediated+by+Agrobacterium+tumefaciens.">Transformation of rice mediated by Agrobacterium tumefaciens.</a> Plant Molecular Biology. 35 (1-2), 205-218 (1997).</li><li>Nishimura, A., Aichi, I., Matsuoka, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+Agrobacterium-mediated+transformation+in+rice.">A protocol for Agrobacterium-mediated transformation in rice.</a> Nature Protocols. 1 (6), 2796 (2006).</li><li>Yara, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+transgenic+japonica+rice+(Oryza+sativa)+cultivar,+Taichung+65,+by+the+Agrobacterium-mediated+method.">Production of transgenic japonica rice (Oryza sativa) cultivar, Taichung 65, by the Agrobacterium-mediated method.</a> Plant Biotechnology. 18 (4), 305-310 (2001).</li><li>Cho, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+Korean+rice+cultivars+(Oryza+sativa+L.)+mediated+by+Agrobacterium+tumefaciens.">Efficient transformation of Korean rice cultivars (Oryza sativa L.) mediated by Agrobacterium tumefaciens.</a> Journal of Plant Biology. 41 (4), 262-268 (1998).</li><li>Toki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+efficient+Agrobacterium-mediated+transformation+in+rice.">Rapid and efficient Agrobacterium-mediated transformation in rice.</a> Plant Molecular Biology Reporter. 15, 16-21 (1997).</li><li>Zhang, J., Xu, R. j., Elliott, M. C., Chen, D. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+elite+indica+and+japonica+rice+cultivars.">Agrobacterium-mediated transformation of elite indica and japonica rice cultivars.</a> Molecular Biotechnology. 8 (3), 223-231 (1997).</li><li>Aldemita, R. R., Hodges, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+tumefaciens-mediated+transformation+of+japonica+and+indica+rice+varieties.">Agrobacterium tumefaciens-mediated transformation of japonica and indica rice varieties.</a> Planta. 199 (4), 612-617 (1996).</li><li>Rashid, H., Yokoi, S., Toriyama, K., Hinata, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+plant+production+mediated+by+Agrobacterium+in+indica+rice.">Transgenic plant production mediated by Agrobacterium in indica rice.</a> Plant Cell Reports. 15 (10), 727-730 (1996).</li><li>Sahoo, K. K., Tripathi, A. K., Pareek, A., Sopory, S. K., Singla-Pareek, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+protocol+for+efficient+transformation+and+regeneration+of+diverse+indica+rice+cultivars.">An improved protocol for efficient transformation and regeneration of diverse indica rice cultivars.</a> Plant Methods. 7 (1), 49 (2011).</li><li>Rachmawati, D., Hosaka, T., Inoue, E., Anzai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+Javanica+rice+cv.+Rojolele.">Agrobacterium-mediated transformation of Javanica rice cv. Rojolele.</a> Bioscience, Biotechnology, and Biochemistry. 68 (6), 1193-1200 (2004).</li><li>Dong, J., Teng, W., Buchholz, W. G., Hall, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium-mediated+transformation+of+Javanica+rice.">Agrobacterium-mediated transformation of Javanica rice.</a> Molecular Breeding. 2 (3), 267-276 (1996).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Li, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+japonica+photo-sensitive+genic+male+sterile+rice+lines+by+editing+carbon+starved+anther+using+CRISPR/Cas9.">Development of japonica photo-sensitive genic male sterile rice lines by editing carbon starved anther using CRISPR/Cas9.</a> Journal of Genetics and Genomics. 43 (6), 415 (2016).</li><li>Qin, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ABCG15+encodes+an+ABC+transporter+protein,+and+is+essential+for+Post-Meiotic+anther+and+pollen+exine+development+in+rice.">ABCG15 encodes an ABC transporter protein, and is essential for Post-Meiotic anther and pollen exine development in rice.</a> Plant and Cell Physiology. 54, (2013).</li><li>Mao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+CRISPR-Cas+system+for+efficient+genome+engineering+in+plants.">Application of the CRISPR-Cas system for efficient genome engineering in plants.</a> Molecular Plant. 6 (6), 2008-2011 (2013).</li><li>Itoh, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+plant+development:+from+zygote+to+spikelet.">Rice plant development: from zygote to spikelet.</a> Plant and Cell Physiology. 46 (1), 23-47 (2005).</li><li>Gawel, N. J., Jarret, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+CTAB+DNA+extraction+procedure+forMusa+andIpomoea.">A modified CTAB DNA extraction procedure forMusa andIpomoea.</a> Plant Molecular Biology Reporter. 9 (3), 262-266 (1991).</li><li>Wei, F. J., Droc, G., Guiderdoni, E., Hsing, Y. i. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=International+Consortium+of+Rice+Mutagenesis:+resources+and+beyond.">International Consortium of Rice Mutagenesis: resources and beyond.</a> Rice. 6 (1), 39 (2013).</li><li>Feng, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+editing+in+plants+using+a+CRISPR/Cas+system.">Efficient genome editing in plants using a CRISPR/Cas system.</a> Cell Research. 23 (10), 1229 (2013).</li></ol>

인공 유전자 남성 멸균 돌연변이는 전통적으로 무작위 물리적, 화학적, 또는 생물학적 돌연변이발생에 의해 생성됩니다. 이들은 강력한 기술이지만, 그들의 무작위 자연은 분자사육32에있는 맞춤형 개선을 제공할 수 있는 잠재력을 가지고 있는 현대 유전체 지식의 광대 한 양을 활용하지 못합니다. CRISPR-Cas9 시스템은 DNA29,,33을조작하?...

쌀은 특히 개발도상국에서 가장 중요한 식품 작물이며, 전 세계 인구의 절반 이상을 위한 주식 식품입니다. 전체적으로 쌀알에 대한 수요가 증가하고 있으며 2030년까지 50%, 2050년1,2에100% 증가할 것으로 예상됩니다.1 쌀 수율의 향후 개선은 쌀을 단장 식물 연구를위한 훌륭한 모델로 만드는 다양한 분자 및 유전 자원을 활용해야합니다. 여기에는 효율적인 변환 시스템, 고급 분자 맵 및 표현된 시퀀스 태그의 공개적으로 액세스할 수 있는 데이터베이스가 포함되며, 이는 수년 동안 생성된3,,4. 작물 수확량을 개선하기 위한 한 가지 전략은 하이브리드 종자 생산5이며,그 중 핵심 요소는 남성 다산을 조작하는 기능입니다. 시리얼 작물에서 남성 다산의 분자 제어를 이해 하이브리드 종자 생산을 개선 하 고 작물 생산성 향상 을 위해 실용적인 기술로 주요 지식을 번역 하는 데 도움이 될 수 있습니다6,,7.
유전자 변환은 작물 식물에 있는 외국 유전자의 소개 또는 내인성 유전자의 조작을 가능하게 하고, 유전자 변형 선의 생성귀착되기 때문에 기본적인 연구 및 상업적 농업을 위한 중요한 공구입니다. 적절한 변형 프로토콜은 유전자 조절8의근본적인 이해를 위한 유전 및 분자 생물학 연구를 가속화하는 데 도움이 될 수 있다. 박테리아에서, 유전 변환은 자연적으로 일어난다; 그러나, 식물에서는 분자 생물학 기법9,,10을사용하여 인위적으로 수행된다. Agrobacterium tumefaciens는 T-DNA를 전송하여 식물에 크라운 담즙 질환을 일으키는 토양 매개, 그램 음성 박테리아, T-DNA의 영역, 유형 IV 분비 시스템을 통해 식물 세포로11,,12. 식물에서, A. tumefaciens-매개변환은 숙주 게놈(13)으로 T-DNA의 안정적이고 낮은 복사13수 통합으로 유도되기 때문에 유전자 변형을 위한 광범위한 방법으로 간주됩니다. 트랜스제닉 쌀은 1990년대 중반 자포니카 품종14에서 아그로박테리움-중재유전자변환을 통해 처음 생성되었다. 이 프로토콜을 사용하여 변환 효율이 10%-30%인 4개월 이내에 여러 트랜스제닉 라인을 획득했습니다. 연구 결과는 성공적인 변환을 위한 2개의 중요한 단계가 있다는 것을 표시했습니다: 하나는 성숙한 씨앗에서 배아 원소의 유도이고 다른 하나는 식물14,,15에서더 높은 변환 효율성을 허용하는 공동 재배 도중 세균 문화에 아세토시링곤, 페놀 화합물의 추가입니다. 이 프로토콜은 japonica16,17,,,18,,19뿐만 아니라 인디카,20,21,22, 23및 열대 japonica23 ,24,,25와같은 다른 품종에서 사소한 변경으로 광범위하게 사용되었습니다., 실제로, 쌀 변환을 설명하는 기사의 80% 이상이 Agrobacterium-매개유전자 변환을 도구로사용한다(13). 현재까지, 여러 유전자 변형 프로토콜은,쌀 씨를 서두유도16,17,,18,19의시작 재료로 사용하여 개발되었다., 그러나, 거의 콜러스 생산을위한 흥분으로 젊은 꽃에 대해 알려져있다. 전반적으로 기능성 유전체학 및 작물 개선에 대한 연구를 위한 신속하고 재현 가능하며 효율적인 유전자 변환 및 재생 프로토콜을 확립하는 것이 중요합니다.
최근 몇 년 동안 CRISPR-Cas9 기술의 발전은 유전자 기능을 이해하고 식물 사육26,,27에대한 농업적으로 중요한 개선을 제공하는 정밀한 게놈 편집 메커니즘을 초래했다. CRISPR은 또한 남성 생식 개발 및 하이브리드 생산의 조작에 대한 상당한 약속을 제공합니다. 이 연구에서는 CRISPR-Cas9 기술을 이용한 유전자 녹아웃 시스템을 활용하여 젊은 꽃식물을 사용하여 효율적인 쌀 유전자 변형 프로토콜에 결합하여 생식 발달 연구를 위한 안정적인 남성 멸균 선을 생성했습니다.

<table>
	<tbody>
		<tr>
			<td>1-Naphthaleneacetic acid</td>
			<td>Sigma-Aldrich</td>
			<td>N0640</td>
			<td></td>
		</tr>
		<tr>
			<td>2&#65292;4-Dichlorophenoxyacetic Acid</td>
			<td>Sigma-Aldrich</td>
			<td>D7299</td>
			<td></td>
		</tr>
		<tr>
			<td>6-Benzylaminopurine (6-BA)</td>
			<td>Sigma-Aldrich</td>
			<td>B3408</td>
			<td></td>
		</tr>
		<tr>
			<td>Acetosyringone</td>
			<td>Sigma-Aldrich</td>
			<td>D134406</td>
			<td></td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10000561</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium sulfate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10002918</td>
			<td></td>
		</tr>
		<tr>
			<td>Aneurine hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td>T4625</td>
			<td></td>
		</tr>
		<tr>
			<td>Anhydrous ethanol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10009218</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacteriological peptone</td>
			<td>Sangon Biotech</td>
			<td>A100636</td>
			<td></td>
		</tr>
		<tr>
			<td>Beef extract</td>
			<td>Sangon Biotech</td>
			<td>A600114</td>
			<td></td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10004808</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium chloride dihydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>20011160</td>
			<td></td>
		</tr>
		<tr>
			<td>Casein acid hydrolysate</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>C184</td>
			<td></td>
		</tr>
		<tr>
			<td>Cobalt(&#8545;) chloride hexahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10007216</td>
			<td></td>
		</tr>
		<tr>
			<td>Copper(&#8545;) sulfate pentahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10008218</td>
			<td></td>
		</tr>
		<tr>
			<td>D(+)-Glucose anhydrous</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63005518</td>
			<td></td>
		</tr>
		<tr>
			<td>D-sorbitol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63011037</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA, Disodium Salt, Dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>E5134</td>
			<td></td>
		</tr>
		<tr>
			<td>EOS Digital SLR and Compact System Cameras</td>
			<td>Canon</td>
			<td>EOS 700D</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10010018</td>
			<td></td>
		</tr>
		<tr>
			<td>Fully Automated Rotary Microtome</td>
			<td>Leica Biosystems</td>
			<td>Leica RM 2265</td>
			<td></td>
		</tr>
		<tr>
			<td>Glacial acetic acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10000208</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62011516</td>
			<td></td>
		</tr>
		<tr>
			<td>Hygromycin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>H370</td>
			<td></td>
		</tr>
		<tr>
			<td>Inositol</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>63007738</td>
			<td></td>
		</tr>
		<tr>
			<td>Iodine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10011517</td>
			<td></td>
		</tr>
		<tr>
			<td>Iron(&#8545;) sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10012116</td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycine</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>K378</td>
			<td></td>
		</tr>
		<tr>
			<td>Kinetin</td>
			<td>Sigma-Aldrich</td>
			<td>K0753</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Arginine</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62004034</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Aspartic acid</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>62004736</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Glutamine</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>G229</td>
			<td></td>
		</tr>
		<tr>
			<td>L-proline</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>P698</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10013018</td>
			<td></td>
		</tr>
		<tr>
			<td>Manganese sulfate monohydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10013418</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscopes</td>
			<td>NIKON</td>
			<td>Eclipse 80i</td>
			<td></td>
		</tr>
		<tr>
			<td>MS</td>
			<td>Phytotech</td>
			<td>M519</td>
			<td></td>
		</tr>
		<tr>
			<td>Nicotinic acid</td>
			<td>Sigma-Aldrich</td>
			<td>N0765</td>
			<td></td>
		</tr>
		<tr>
			<td>Phytagel</td>
			<td>Sigma-Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10016308</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium dihydrogen phosphate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10017608</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium iodide</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10017160</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium nitrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>1001721933</td>
			<td></td>
		</tr>
		<tr>
			<td>Pyridoxine Hydrochloride (B6)</td>
			<td>Sigma-Aldrich</td>
			<td>47862</td>
			<td></td>
		</tr>
		<tr>
			<td>Rifampicin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>R501</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium hydroxide</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10019718</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium molybdate dihydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10019816</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereo microscopes</td>
			<td>Leica Microsystems</td>
			<td>Leica M205 A</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10021418</td>
			<td></td>
		</tr>
		<tr>
			<td>Technovit embedding Kits 7100</td>
			<td>Heraeus Teknovi, Germany</td>
			<td>14653</td>
			<td></td>
		</tr>
		<tr>
			<td>Timentin</td>
			<td>Beijing XMJ Scientific Co., Ltd</td>
			<td>T869</td>
			<td></td>
		</tr>
		<tr>
			<td>Toluidine Blue O</td>
			<td>Sigma-Aldrich</td>
			<td>T3260</td>
			<td></td>
		</tr>
		<tr>
			<td>Water bath for paraffin sections</td>
			<td>Leica Biosystems</td>
			<td>Leica HI1210</td>
			<td></td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>Sangon Biotech</td>
			<td>A515245</td>
			<td></td>
		</tr>
		<tr>
			<td>Zinc sulfate heptahydrate</td>
			<td>Sinopharm Chemical Reagent Co., Ltd</td>
			<td>10024018</td>
			<td></td>
		</tr>
	</tbody>
</table>

agrobacterium-mediated genetic transformation, transgenic production, and its application for the study of male reproductive development in rice

남성 멸균은 일반적으로 남성 생식 기관/게임테의 기능적 결함을 특징으로 하는 하이브리드 종자 생산을 위한 중요한 농업 특성입니다. CRISPR-Cas9 게놈 편집 기술의 최근 발전은 특정 사이트에서 내인성 후보 유전자의 높은 편집 효능 및 시간 절약 녹아웃 돌연변이를 허용합니다. 또한, 쌀의 아그로박테리움-중재된유전적 변화는 또한 많은 공공 및 민간 실험실에서 널리 채택된 유전자 변형을 위한 중요한 방법입니다. 이 연구에서는 CRISPR-Cas9 게놈 편집 도구를 적용하고 japonica 품종에서 OsABCG15의 표적 게놈 편집을 통해 3개의 남성 멸균 돌연변이 라인을 성공적으로 생성했습니다. 우리는 쌀에서 하이브리드 종자 생산을위한 유전 방출의 우수한 수단을 제공 할 수있는 수정 된 Agrobacterium-매개 쌀 변환 방법을 사용했다. 형질전환 식물은 2-3개월 이내에 얻을 수 있으며, 동종변성 변압제는 PCR 증폭 및 Sanger 시퀀싱을 사용하여 유전자를 사용하여 스크리닝하여 스크리닝하였다. 남성 멸균 균성 라인의 기본 피노티픽 특성화는 쌀 남성 생식 기관의 현미경 관찰에 의해 수행되었으며, 요오드 칼륨 요오드 (I2-KI)에 의한 꽃가루 생존 가능성 분석에 의해 개발 중인 멸균의 반 박형 단면화를 염색하였다.

여기에 입증 된 유전자 편집 기술은 쌀에 있는 Agrobacterium-매개 유전 변환에 의하여 미래 연구를 위한 남성 멸균 선을 만드는 것입니다. osabcg15의남성 멸균 라인을 생성하기 위해 CRISPR-CAS9 매개 돌연변이 발생은 이진 벡터 구조에 사용되었다. sgRNA는 OsU3 프로모터에 의해 구동된 반면, hSpCas9의 발현 카세트는 이중 35S 프로모터에 의해 구동되었고, 중간 벡터는 아그로박테리움을위?...

Watch this Scientific Journal Video about Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice at JoVE.com

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

이 작품은 CRISPR-Cas9 게놈 편집 기술을 사용하여 내인성 유전자 OsABCG15를 녹아웃한 다음 수정된 Agrobacterium-매개변환 프로토콜을 사용하여 쌀에서 안정적인 남성 멸균 라인을 생성합니다.

Agrobacterium-매개 유전 변환, 트랜스 제닉 생산, 그리고 쌀에서 남성 생식 개발의 연구에 대 한 그것의 응용 프로그램

Male sterility is an important agronomic trait for hybrid seed production that is usually characterized by functional defects in male reproductive ...

콜러스 생산을 위한 절제로서의 젊은 꽃피는 신속하고 효율적인 유전자 변환및 유전자 기능을 드러내는 재생 방법과 작물 개선을 위한 재생 방법을 확립하는 데 중요합니다. 콜러스 생산을 위한 절제로서 젊은 꽃피는 신속하고 효율적인 유전자 변환 및 유전자 기능을 드러내기 위한 재생 방법을 확립하는 데 중요합니다. 이 기술의 비디오 데모는 시청자가 시간과 노력을 낭비하지 않고 원하는 형질 전환기를 생성하는 재료를 유지하는 과정을 이해하는 데 도움이됩니다.논에서 어린 쌀 꽃집이나 메이오시스 단계에서 온실을 수집하여 잎 칼집으로 덮여 있는지 확인하십시오. 70%의 알코올 면봉으로 각 꽃집을 닦고 절단하기 전에 건조시키십시오. 멸균 실험실 벤치에 꽃집을 가져와 멸균 된 가위로 잘라낸 다음 절단을 NBD2 배지가 들어있는 페트리 플레이트로 옮길 수 있습니다.10~14일 동안 26°C에서 어둠 속에서 접시를 배양하여 콜러스를 유도합니다. 변환을 수행하기 위해, 50 밀리리터 원추형 멸균 시험관에서 동일한 항생제를 함유하는 액체 YEB 배지의 5밀리리터로 선택적 항생제를 가진 백색 EB 플레이트에서 단일 콜로니를 이송한다. 박테리아가 0.5의 OD 600로 성장할 때까지 250 배 g와 25 ~ 28섭씨에서 궤도 셰이커에 튜브를 흔들어.250 밀리리터 원뿔형 플라스크에 동일한 선택적 항생제를 가진 YEB 배지 의 100 밀리리터에 세균 현탁액 1 밀리리터를 추가하고 4 시간 동안 250 배 g및 28 섭씨에서 궤도 셰이커에 플라스크를 흔들어 줍니다. 원심분리기는 박테리아를 수집하기 위해 실온에서 10분 동안 4, 000g에서 배양한다. 상체를 버리고 AAM AS 매체로 펠릿을 다시 중단한 다음 서스펜션을 0.4의 OD 600으로 희석시 보디울 수 있습니다.인큐베이션 후, 약 150밀리리터 멸균 플라스크로 약 150개의 건강한 밝은 황색 배아 원내 캘리를 수집합니다. 플라스크에 세균세포 현탁액50~75밀리리터를 추가한 다음 신선한 AAM AS 배지 10~25밀리리터를 추가하여 10~20분 동안 칼리를 담그고 가끔 씩 씩씩하게 흔들어줍니다. 플라스크에서 세균 현탁액을 조심스럽게 붓고 멸균 필터 용지로 칼리를 말린 다음 NBD AS 매체로 페트리 접시에 놓고 필터 용지로 덮습니다.3 일 동안 어둠 속에서 25 ~ 28도의 칼리를 배양하여 세균 성 과성장을 확인합니다. 3일간의 공동 재배 후, 필터 용지를 사용하여 멸균 페트리 접시에 칼리를 옮은 다음 깨끗한 벤치에서 2 시간 동안 공기를 건조시하십시오. calli가 필터 용지에 부착되지 않았는지 확인하고 기본 선택 매체 NBD2로 전송합니다.2 주 후, 신선한 선택 매체를 포함하는 새로운 플레이트에 캘리를 균등하게 전송한 다음, 분화를 위해 신선한 MS 매체로 칼리를 이동하고 촬영 싹을 1리터 히그로마이신 당 10 밀리그램으로 MS 매체로 이동하여 더 많은 촬영을 증식합니다. 새로운 싹을 반 MS 매체로 옮겨 뿌리 유도를 위해 25~28도의 빛 아래에서 배양합니다. 변형 된 식물은 2 주 이내에 뿌리를 생산해야합니다.생식 표현형 관찰을 수행하려면, 플로리다에서 팔레아와 lemma를 제거하고 스테레오 현미경으로 전체 anthers를 이미지. 꽃가루 생존가능성을 관찰하려면 꽃무늬 가무늬 가루 전에 성숙한 쌀 스파이크를 선택하고 창백한 과 뢰마를 제거하여 마취기를 방출합니다. 여섯 개의 anther를 가지고 유리 슬라이드에 놓습니다.증류수 한 방울을 넣고 핀셋으로 앤터를 분쇄하여 꽃가루 곡물을 풀어주린 다음, 2~3방울의 요오드 용액을 넣고 커버슬립으로 덮습니다. 낮은 배율 현미경에서 슬라이드를 관찰하십시오. 검은 색으로 염색 된 꽃가루 곡물은 더 활발한 생존력을 나타내며 색상이 없거나 염색 된 노란색 갈색이 있는 곡물은 기절하거나 퇴화됩니다.횡단 면방향 현미경 검사를 수행하려면 0.5%의 toluidine 블루 용액을 사용하여 슬라이드를 30 분 동안 묻은 다음 물로 헹구고 연기 후드에서 건조하십시오. 일단 건조되면, 중립 나무 접착제로 슬라이드를 밀봉 부드럽게 슬라이드에 커버 슬립을 배치하고 연기 후드에 건조, 다음 현미경에서 샘플을 이미지. 이 프로토콜은 쌀에 있는 Agrobacterium 매개 유전 변환에 의해 남성 멸균 선을 만드는 데 사용되었다.배아원 캘리는 추가 감염을 위해 더 많은 calli를 얻기 위하여 증식을 위한 변환 또는 하위 배양을 위해 직접 이용되었습니다. 48시간 동안 공동 육성한 후, 칼리는 2라운드 선발 매체로 이동했다. 10~14일 후, 변형된 칼리는 새롭게 형성된 마이크로칼리를 보였고, 트랜스포메이션되지 않은 칼리는 갈색으로 변해 죽었다.나중에, 건강하고 크리미한 색깔의 칼리는 재생 매체로 옮겨졌습니다. 변형된 칼리는 점차 녹색 반점을 보였다. 이러한 녹색 반점은 재생 매체에서 배양되어 촬영 성장을 허용한 다음 뿌리를 유도하기 위해 절반 MS 매체로 이동하였다.나중에, 잘 발달 된 뿌리와 건강하고 활발한 성장 싹을 수확했다. 총 21마리의 재생된 묘목을 얻었다. Hygromycin 영역에 대한 PCR 증폭은 변환 주파수가 약 85.71%였으며 변압제는 sgRNA 표적 부위에서 돌연변이를 식별하기 위해 유전자형이 되었다.18개의 형질화 식물 중 8개의 이종수구와 3개의 동질성 라인은 CRISPR CAS9 양성이었다. 동종 구스 녹아웃 돌연변이는 기본적인 남성 생식 기관 관찰에 의해 검증되었다. osabcg15의 anthers는 야생 유형의 것보다 작고 창백했으며 성숙한 꽃가루 곡물이 부족했습니다.횡단 단면 현미경 검사는 osabcg15에서 개미 형태 학적 결함을 조사하기 위해 수행되었다. 10단계에서 야생형 마이크로포기는 둥근 모양으로 되어 진한 파란색 의 색소로 얼룩진 엑신으로 비우게 되었습니다. 대조적으로, osabcg15 마이크로포자는 붕괴되고 저하되었습니다.이 프로토콜을 시도할 때 수집된 물질이 음오사증 단계에 있는지 확인하고 칼리의 공기 건조 시간을 제어하는 것이 중요합니다.

Research

JoVE Journal

Biology

Agrobacterium-Mediated Genetic Transformation, Transgenic Production, and Its Application for the Study of Male Reproductive Development in Rice

Testing Visual Sensitivity to the Speed and Direction of Motion in Lizards

도마뱀의 운동의 속도와 방향에 시각 민감도 테스트

Testing visual sensitivity in any species provides basic information regarding behaviour, evolution, and ecology. However, testing specific features of ...

연구

생물학

The Ladder Rung Walking Task: A Scoring System and its Practical Application.

작업 워킹 레더 렁 : 채점 시스템과 실용적인 프로그램입니다.

Progress in the development of animal models for/stroke, spinal cord injury, and other neurodegenerative disease requires tests of high sensitivity to ...

Lens Transplantation in Zebrafish and its Application in the Analysis of Eye Mutants

렌즈 Zebrafish의 이식과 눈 돌연변이의 분석에의 응용

The lens plays an important role in the development of the optic cup[1,2]. Using the zebrafish as a model organism, questions regarding lens development ...

Generation of Transgenic C. elegans by Biolistic Transformation

Generation of Transgenic C. elegans by Biolistic Transformation

트렌스 제닉의 생성 C. 엘레간스 Biolistic 변환에 의해

The number of laboratories using the free living nematode C. elegans is rapidly growing. The popularity of this biological model is attributed to a rapid ...

Agrobacterium-Mediated Virus-Induced Gene Silencing Assay In Cotton

커튼에서 Agrobacterium - 중재 바이러스 유발 유전자 입을 분석

Cotton (Gossypium hirsutum) is one of the most important crops worldwide. Considerable efforts have been made on molecular breeding of new varieties.  The ...

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

최적화 및 활용<em&gt; 아그로 박테 리움</em에서&gt; 매개 과도 단백질 생산<em&gt;는 담배</em

Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short ...

Transgenic Rodent Assay for Quantifying Male Germ Cell Mutant Frequency

형질 전환 쥐 분석 정량화 남성 생식 세포 돌연변이 주파수에 대한

De novo mutations arise mostly in the male germline and may contribute to adverse health outcomes in subsequent generations. Traditional methods for ...

A Multi-hole Cryovial Eliminates Freezing Artifacts when Muscle Tissues are Directly Immersed in Liquid Nitrogen

근육 조직이 직접 액체 질소에 몰입 할 때 이슈 결빙 멀티 홀 Cryovial 제거

Studies on skeletal muscle physiology face the technical challenge of appropriately processing the specimens to obtain sections with clearly visible ...

Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes

Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes

아그로박테리움-형태유전자를 이용한 리칼시트 옥수수 근친선 미성숙 배아 변형 중재

Demonstrated here is a detailed protocol for Agrobacterium-mediated genetic transformation of maize inbred lines using morphogenic genes Baby boom (Bbm) ...

Real-Time Detection of Reactive Oxygen Species Production in Immune Response in Rice with a Chemiluminescence Assay

Chemiluminescence Assay를 통한 벼의 면역 반응에서 활성 산소 종 생산의 실시간 검출

Reactive oxygen species (ROS) play vital roles in a variety of biological processes, including the sensing of abiotic and biotic stresses. Upon pathogen ...