A subscription to JoVE is required to view this content. Sign in or start your free trial.
R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.
R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.
R-loops are three-stranded nucleic acid structures that form primarily during transcription upon hybridization of the nascent RNA transcript to the template DNA strand. This results in the formation of an RNA:DNA hybrid and causes the displacement of the non-template DNA strand in a single-stranded looped state. Biochemical reconstitution1,2,3,4 and mathematical modeling5, in combination with other biophysical measurements6,7, have established that R-loops are....
The following protocol is optimized for the human Ntera-2 cell line grown in culture, but it has been successfully adapted without modification to a range of other human cell lines (HEK293, K562, HeLa, U2OS), primary cells (fibroblasts, B-cells) as well as in other organisms with small modifications (mice, flies).
1. Cell harvest and lysis
DRIP as well as sDRIP can be analyzed through qPCR (Figure 2A) and/or sequencing (Figure 2B). After the immunoprecipitation step, the quality of the experiment must be first confirmed by qPCR on positive and negative control loci, as well as with RNase H-treated controls. Primers corresponding to frequently used loci in multiple human cell lines are provided in Table 2. The results from qPCR should be displayed as a percentage of input, which co.......
Described here are two protocols to map R-loop structures in potentially any organism using the S9.6 antibody. DRIP-seq represents the first genome-wide R-loop mapping technique developed. It is an easy, robust, and reproducible technique that allows one to map the distribution of R-loops along any genome. The second technique, termed sDRIP-seq, is also robust and reproducible but achieves higher resolution and strand-specificity owing to the inclusion of a sonication step and a stranded sequencing library construction p.......
Work in the Chedin lab is supported by a grant from the National Institutes of Health (R01 GM120607).
....Name | Company | Catalog Number | Comments |
15 mL tube High density Maxtract phase lock gel | Qiagen | 129065 | |
2 mL tube phase lock gel light | VWR | 10847-800 | |
Agarose A/G beads | ThermoFisher Scientific | 20421 | |
Agencourt AMPure XP beads | Beckman Coulter | A63881 | |
AmpErase Uracil N-glycosylase | ThermoFisher Scientific | N8080096 | |
Index adapters | Illumina | Corresponds to the TrueSeq Single indexes | |
Klenow fragment (3’ to 5’ exo-) | New England BioLabs | M0212S | |
NEBNext End repair module | New England BioLabs | E6050 | |
PCR primers for library amplification | primer 1.0 P5 (5’ AATGATACGGCGACCACCGAGA TCTACACTCTTTCCCTACACGA 3’) | ||
PCR primers for library amplification | PCR primer 2.0 P7 (5’ CAAGCAGAAGACGGCATACG AGAT 3’) | ||
Phenol/Chloroform Isoamyl alcohol 25:24:1 | Affymetrix | 75831-400ML | |
Phusion Flash High-Fidelity PCR master mix | ThermoFisher Scientific | F548S | |
Quick Ligation Kit | New England BioLabs | M2200S | |
Ribonuclease H | New England BioLabs | M0297S | |
S9.6 Antibody | Kerafast | ENH001 | These three sources are equivalent |
S9.6 Antibody | Millipore/Sigma | MABE1095 | |
S9.6 Antibody | Abcam | ab234957 |
This article has been published
Video Coming Soon
ABOUT JoVE
Copyright © 2025 MyJoVE Corporation. All rights reserved