Name: isolation of murine retinal endothelial cells for next-generation sequencing
Uploaded: 2021-10-11T13:00:00
Description: Watch this Scientific Journal Video about Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing at JoVE.com

شكرا لمرفق قياس التدفق الخلوي بجامعة ييل ، والمرفق الأساسي لقياس التدفق الخلوي بجامعة فيرجينيا ، ومركز ييل للتحليل الجينومي ، وجامعة فيرجينيا لتحليل الجينوم والتكنولوجيا الأساسية على جهودهم وخبراتهم ونصائحهم في المساهمة في التجارب المقدمة. تم تمويل هذه الدراسة من خلال منح المعاهد الوطنية للصحة إلى N.W.C. (T32 HL007224 ، T32 HL007284) ، SC (T32 HL007284) ، KW (R01 HL142650) ، و K.K.H. (R01 HL146056 ، R01 DK118728 ، UH3 EB025765).

وافقت لجان رعاية واستخدام الحيوان المؤسسية في جامعة ييل وجامعة فيرجينيا على جميع التجارب على الحيوانات المدرجة في هذا البروتوكول.
1. الحصول على عيون الفأر لعزل الشبكية
<ol><li>قم بإعداد 1x PBS بارد وأضف 500 ميكرولتر إلى كل بئر من لوحة 48 بئر.</li>
	<li>القتل الرحيم للفئران حديث...

<ol>
	<li>Slatko, B. E., Gardner, A. F., Ausubel, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview+of+next-generation+sequencing+technologies.">Overview of next-generation sequencing technologies.</a> Current Protocols in Molecular Biology. 122 (1), 59 (2018).</li><li>Chavkin, N. W., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+cell+analysis+in+vascular+biology.">Single cell analysis in vascular biology.</a> Frontiers in Cardiovascular Medicine. 7, 42 (2020).</li><li>Ma, F., Hernandez, G. E., Romay, M., Iruela-Arispe, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+RNA+sequencing+to+study+vascular+diversity+and+function.">Single-cell RNA sequencing to study vascular diversity and function.</a> Current Opinion in Hematology. 28 (3), 221-229 (2021).</li><li>Potter, A. S., Potter, S. S., S, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissociation+of+tissues+for+single-cell+analysis.">Dissociation of tissues for single-cell analysis.</a> Methods in Molecular Biology. 1926, 55-62 (2019).</li><li>Braga, F. A. V., Miragaia, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+handling+and+dissociation+for+single-cell+RNA-seq.">Tissue handling and dissociation for single-cell RNA-seq.</a> Single Cell Methods: Methods in Molecular Biology. 1979, 9-21 (2019).</li><li>Brink, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+sequencing+reveals+dissociatin-induced+gene+expression+in+tissue+subpopulations.">Single-cell sequencing reveals dissociatin-induced gene expression in tissue subpopulations.</a> Nature Methods. 14 (10), 935-936 (2017).</li><li>Skulska, K., Wegrzyn, A. S., Chelmonska-Soyta, A., Chodaczek, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+tissue+enzymatic+digestion+on+analysis+of+immune+cells+in+mouse+reproductive+mucosa+with+a+focus+on+gammadelta+T+cells.">Impact of tissue enzymatic digestion on analysis of immune cells in mouse reproductive mucosa with a focus on gammadelta T cells.</a> Journal of Immunological Methods. 474, 112665 (2019).</li><li>Connolly, S., Hores, T., Smith, L., D'Amore, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+vascular+development+in+the+mouse+retina.">Characterization of vascular development in the mouse retina.</a> Microvascular Research. 36 (3), 275-290 (1988).</li><li>Crist, A., Young, C., Meadows, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+arteriovenous+identity+in+the+developing+neonate+mouse+retina.">Characterization of arteriovenous identity in the developing neonate mouse retina.</a> Gene Expression Patterns: GEP. 23-24, 22-31 (2017).</li><li>dela Paz, N. G., D'Amore, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterial+versus+venous+endothelial+cells.">Arterial versus venous endothelial cells.</a> Cell and Tissue Research. 335 (1), 5-16 (2009).</li><li>Fang, J. S., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+regulation+of+arteriovenous+endothelial+cell+specification.">Molecular regulation of arteriovenous endothelial cell specification.</a> F1000Res. 8, (2019).</li><li>Smith, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxygen-induced+retinopathy+in+the+mouse.">Oxygen-induced retinopathy in the mouse.</a> Investigative Ophthalmology and Visual Science. 35 (1), 101-111 (1994).</li><li>Pitulescu, M. E., Schmidt, I., Benedito, R., Adams, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+gene+targeting+in+the+neonatal+vasculature+and+analysis+of+retinal+angiogenesis+in+mice.">Inducible gene targeting in the neonatal vasculature and analysis of retinal angiogenesis in mice.</a> Nature Protocols. 5 (9), 1518-1534 (2010).</li><li>Ruiz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+of+hereditary+hemorrhagic+telangiectasia+generated+by+transmammary-delivered+immunoblocking+of+BMP9+and+BMP10.">A mouse model of hereditary hemorrhagic telangiectasia generated by transmammary-delivered immunoblocking of BMP9 and BMP10.</a> Scientific Reports. 6, 37366 (2016).</li><li>Fang, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shear-induced+Notch-Cx37-p27+axis+arrests+endothelial+cell+cycle+to+enable+arterial+specification.">Shear-induced Notch-Cx37-p27 axis arrests endothelial cell cycle to enable arterial specification.</a> Nature Communication. 8 (1), 2149 (2017).</li><li>Ola, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMAD4+prevents+flow+induced+arterial-venous+malformations+by+inhibiting+Casein+Kinase+2.">SMAD4 prevents flow induced arterial-venous malformations by inhibiting Casein Kinase 2.</a> Circulation. 138 (21), 2379-2394 (2018).</li><li>Chavkin, N. W., Walsh, K., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+highly+purified+and+viable+retinal+endothelial+cells.">Isolation of highly purified and viable retinal endothelial cells.</a> Journal of Vascular Research. 58 (1), 49-57 (2020).</li><li>Hulspas, R., O'Gorman, M. R. G., Wood, B. L., Gratama, J. W., Sutherland, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Considerations+for+the+control+of+background+fluorescence+in+clinical+flow+cytometry.">Considerations for the control of background fluorescence in clinical flow cytometry.</a> Cytometry PartB: Clinical Cytometry. 76 (6), 355-364 (2009).</li><li>Bachman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse-transcription+PCR+(RT-PCR).">Reverse-transcription PCR (RT-PCR).</a> Methods in Enzymology. 530, 67-74 (2013).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+RNA+by+real-time+Reverse+Transcription-Polymerase+Chain+Reaction+(RT-PCR).">Quantification of RNA by real-time Reverse Transcription-Polymerase Chain Reaction (RT-PCR).</a> Cold Spring Harbour Protocols. 2018 (10), (2018).</li><li>Liu, L., Shi, G. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD31:+beyond+a+marker+for+endothelial+cells.">CD31: beyond a marker for endothelial cells.</a> Cardiovascular Research. 94 (1), 3-5 (2012).</li><li>Zarkada, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+endothelial+tip+cells+guide+neuroretina+vascularization+and+blood-retina-barrier+formation.">Specialized endothelial tip cells guide neuroretina vascularization and blood-retina-barrier formation.</a> Developmental Cell. 56 (15), 2237-2251 (2021).</li><li>Su, X., Sorenson, C. M., Sheibani, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+murine+retinal+endothelial+cells.">Isolation and characterization of murine retinal endothelial cells.</a> Molecular Vision. 9, 171-178 (2003).</li><li>Benedito, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+notch+ligands+Dll4+and+Jagged1+have+opposing+effects+on+angiogenesis.">The notch ligands Dll4 and Jagged1 have opposing effects on angiogenesis.</a> Cell. 137 (6), 1124-1135 (2009).</li><li>Daneman, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt/beta-catenin+signaling+is+required+for+CNS,+but+not+non-CNS,+angiogenesis.">Wnt/beta-catenin signaling is required for CNS, but not non-CNS, angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (2), 641-646 (2009).</li><li>Okabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurons+limit+angiogenesis+by+titrating+VEGF+in+retina.">Neurons limit angiogenesis by titrating VEGF in retina.</a> Cell. 159 (3), 584-596 (2014).</li><li>Crist, A. M., Lee, A. R., Patel, N. R., Westhoff, D. E., Meadows, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vascular+deficiency+of+Smad4+causes+arteriovenous+malformations:+a+mouse+model+of+Hereditary+Hemorrhagic+Telangiectasia.">Vascular deficiency of Smad4 causes arteriovenous malformations: a mouse model of Hereditary Hemorrhagic Telangiectasia.</a> Angiogenesis. 21 (2), 363-380 (2018).</li><li>Kim, Y. H., Choe, S. W., Chae, M. Y., Hong, S., Oh, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMAD4+deficiency+leads+to+development+of+arteriovenous+malformations+in+neonatal+and+adult+mice.">SMAD4 deficiency leads to development of arteriovenous malformations in neonatal and adult mice.</a> Journal of the American Heart Association. 7 (21), 009514 (2018).</li><li>Ma, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absence+of+TGFbeta+signaling+in+retinal+microglia+induces+retinal+degeneration+and+exacerbates+choroidal+neovascularization.">Absence of TGFbeta signaling in retinal microglia induces retinal degeneration and exacerbates choroidal neovascularization.</a> eLife. 8, 42049 (2019).</li><li>Luo, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterialization+requires+the+timely+suppression+of+cell+growth.">Arterialization requires the timely suppression of cell growth.</a> Nature. 589 (7842), 437-441 (2021).</li><li>Lawson, N. D., Vogel, A. M., Weinstein, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=sonic+hedgehog+and+vascular+endothelial+growth+factor+act+upstream+of+the+Notch+pathway+during+arterial+endothelial+differentiation.">sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation.</a> Developmental Cell. 3 (1), 127-136 (2002).</li><li>Larrivee, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ALK1+signaling+inhibits+angiogenesis+by+cooperating+with+the+Notch+pathway.">ALK1 signaling inhibits angiogenesis by cooperating with the Notch pathway.</a> Developmental Cell. 22 (3), 489-500 (2012).</li><li>Wythe, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ETS+factors+regulate+Vegf-dependent+arterial+specification.">ETS factors regulate Vegf-dependent arterial specification.</a> Developmental Cell. 26 (1), 45-58 (2013).</li><li>Davis, D. M., Purvis, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+analysis+of+signaling+patterns+in+single+cells.">Computational analysis of signaling patterns in single cells.</a> Seminars in Cell and Developmental Biology. , 35-43 (2015).</li><li>Gaudet, S., Miller-Jensen, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redefining+signaling+pathways+with+an+expanding+single-cell+toolbox.">Redefining signaling pathways with an expanding single-cell toolbox.</a> Trends in Biotechnology. 34 (6), 458-469 (2016).</li><li>Aibar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SCENIC:+single-cell+regulatory+network+inference+and+clustering.">SCENIC: single-cell regulatory network inference and clustering.</a> Nature Methods. 14 (11), 1083-1086 (2017).</li><li>Trapnell, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dynamics+and+regulators+of+cell+fate+decisions+are+revealed+by+pseudotemporal+ordering+of+single+cells.">The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells.</a> Nature Biotechnology. 32 (4), 381-386 (2014).</li></ol>

يصف هذا البروتوكول طريقة لعزل الخلايا البطانية من أنسجة شبكية الفئران بعد الولادة والتي تم تحسينها للحصول على عدد خلايا مرتفع ونقاوة وقابلية للحياة. يتم الحصول على نقاء الخلية عن طريق عزل FACS لمجموعات الخلايا البطانية من معلق الخلية الواحدة المهضوم بواسطة CD31 + / CD45- التلوين المناعي. يتم قيا...

إن القدرة الإنتاجية العالية لتسلسل الأحماض النووية عبر مناهج التسلسل من الجيل التالي قد عززت بشكل كبير معرفة الباحثين بالبيولوجيا الجزيئية والخلوية. تشمل هذه التقنيات المتقدمة تسلسل الحمض النووي الريبي للنسخ الكامل ، وتسلسل الحمض النووي للمناطق المستهدفة لتحديد تعدد أشكال النوكليوتيدات المفردة (SNPs) ، وتسلسل الحمض النووي لعوامل النسخ المرتبطة في تسلسل الترسيب المناعي للكروماتين (ChIP) ، أو مناطق الكروماتين المفتوحة في الفحص لتسلسل الكروماتين الذي يمكن الوصول إليه بواسطة Transposase (ATAC) ، وتسلسل الحمض النووي الريبي أحادي الخلية1 . في بيولوجيا الأوعية الدموية ، سمحت هذه التطورات للباحثين بتوضيح الآليات المعقدة للتطور والمرض ، إلى جانب تمييز أنماط التعبير الجيني على طول سلسلة متصلة من الأنماط الظاهرية المختلفة 2,3. يمكن للتجارب المستقبلية تحديد الآليات المعقدة بشكل أكبر من خلال الجمع بين تسلسل الجيل التالي والنماذج المقيمة لتطور الأوعية الدموية ، ولكن يجب أن تكون طرق تحضير العينات متوافقة مع تقنيات التسلسل المتقدمة.
تعتمد جودة ودقة وقابلية استنساخ مناهج التسلسل من الجيل التالي على طريقة تحضير العينة. عند عزل مجموعة فرعية من الخلايا أو توليد معلقات أحادية الخلية من الأنسجة ، فإن طرق الهضم والتنقية المثلى ضرورية لزيادة عدد الخلايا وصلاحيتها ونقاوتها 4,5. يتطلب ذلك توازنا في طريقة الهضم: الهضم القوي ضروري لتحرير الخلايا من الأنسجة والحصول على خلايا كافية لنهج المصب ، لكن صلاحية الخلية ستتأثر سلبا إذا كان الهضم قويا جدا 6,7. بالإضافة إلى ذلك ، يعد نقاء عدد الخلايا ضروريا للحصول على نتائج قوية وتحليل دقيق للبيانات ، والتي يمكن تحقيقها من خلال FACS. هذا يسلط الضوء على أهمية تحسين طرق عزل الخلايا لتطبيق تسلسل الجيل التالي على النماذج الراسخة لتطور الأوعية الدموية.
نموذج مميز جيدا للتحقيق في تطور الأوعية الدموية هو نموذج تطوير الأوعية الدموية في شبكية العين. يتطور الأوعية الدموية الشبكية للفأر بعد الولادة في ضفيرة سطحية ثنائية الأبعاد ، مع ظهور نشوء وعائي أولي من العصب البصري في يوم ما بعد الولادة (P) 3 ، وجبهة وعائية مع خلايا ساق وطرف ونضوج أولي للأوعية مرئية عند P6 ، ونضوج الضفيرة الوعائية مرئية بعد P9 8,9. أثناء إعادة تشكيل الضفيرة الوعائية الأولية ، تخضع الخلايا البطانية لمواصفات نحو الأنماط الظاهرية الشريانية والشعيرية والوريدية في أوعية مختلفة لتوليد شبكة الدورة الدموية10,11. لذلك ، تسمح هذه الطريقة للباحثين بتصور تكوين الضفيرة الوعائية الوعائية والمواصفات البطانية الشريانية الوريدية والنضج في نقاط زمنية مختلفة أثناء التطور9. بالإضافة إلى ذلك ، يوفر هذا النموذج طريقة للتحقيق في آثار التلاعب المعدل وراثيا على تكوين الأوعية الدموية وتطور الضفيرة الوعائية ، والتي تم تطبيقها للتحقيق في تطور الأوعية الدموية ، والتشوهات الشريانية الوريدية ، والأوعية الدموية الجديدة التي يسببها الأكسجين12،13،14،15،16 . من أجل الجمع بين نهج تسلسل الجيل التالي مع نموذج تطوير الأوعية الدموية في شبكية العين ، من الضروري وجود بروتوكول محسن لعزل الخلايا البطانية من أنسجة الشبكية.
يصف هذا البروتوكول طريقة محسنة لهضم أنسجة الشبكية من الفئران في P6 لزيادة إنتاجية الخلايا ونقاوتها وقابليتها للحياة. يتم عزل أنسجة الشبكية من الفئران P6 ، ويتم هضمها لمدة 20 دقيقة ، وصبغها المناعي ل CD31 و CD45 ، وتنقيتها من خلال FACS لعزل تعليق خلية واحدة من الخلايا البطانية في حوالي 2.5 ساعة (الشكل 1 أ). تم العثور على هذه الخلايا البطانية للحفاظ على قابلية عالية للحياة لمدة 60 دقيقة بعد العزل17 ، مما يسمح للمكتبة الاستعدادات لطرق تسلسل الجيل التالي. بالإضافة إلى ذلك ، يتم توفير نتائج تمثيلية لبوابة FACS ونتائج مراقبة الجودة من طريقتين منفصلتين لتسلسل الجيل التالي باستخدام بروتوكول العزل هذا: تسلسل الحمض النووي الريبي الكامل للنسخ وتسلسل الحمض النووي الريبي أحادي الخلية. تسمح هذه الطريقة باستخدام مناهج تسلسل الجيل التالي جنبا إلى جنب مع نموذج الأوعية الدموية في شبكية العين لتوضيح آليات جديدة لتطور الأوعية الدموية.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2 mL Eppendorf&#160;safe-lock tubes</td>
			<td>USA Scientific</td>
			<td>4036-3352</td>
			<td></td>
		</tr>
		<tr>
			<td>5 ml Falcon Test Tubes with Cell Strainer Snap Cap</td>
			<td>Corning</td>
			<td>352235</td>
			<td></td>
		</tr>
		<tr>
			<td>60 mm Non TC-treated Culture Dish</td>
			<td>Corning</td>
			<td>430589</td>
			<td></td>
		</tr>
		<tr>
			<td>APC Rat Anti-Mouse CD31</td>
			<td>BD Biosciences</td>
			<td>551262</td>
			<td></td>
		</tr>
		<tr>
			<td>APC Rat IgG2a &#954; Isotype Control</td>
			<td>BD Biosciences</td>
			<td>553932</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSChorus Software</td>
			<td>BD Biosciences</td>
			<td>FACSCHORUS</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSMelody Cell Sorter</td>
			<td>BD Biosciences</td>
			<td>FACSMELODY</td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase Type II</td>
			<td>Sigma-Aldrich</td>
			<td>234115</td>
			<td></td>
		</tr>
		<tr>
			<td>Costar 48-well Clear TC-treated Multiple Well Plates, Individually Wrapped, Sterile</td>
			<td>Corning</td>
			<td>3548</td>
			<td></td>
		</tr>
		<tr>
			<td>D-Glucose</td>
			<td>Gibco</td>
			<td>A2494001</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Graduated Transfer Pipettes</td>
			<td>Fisher Scientific</td>
			<td>12-711-9AM</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissecting Pan Wax</td>
			<td>Carolina</td>
			<td>629100</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection scissors</td>
			<td>Fine Science Tools</td>
			<td>14085-08</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection Stereo Microscope M165 FC</td>
			<td>Leica</td>
			<td>M165FC</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Gibco</td>
			<td>11965-052</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Phosphate Buffered Saline (PBS)</td>
			<td>Gibco</td>
			<td>14190144</td>
			<td></td>
		</tr>
		<tr>
			<td>Eppendorf&#160;Flex-Tubes Microcentrifuge Tubes 1.5 mL</td>
			<td>Sigma-Aldrich</td>
			<td>22364120</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Gemini Bio</td>
			<td>100-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Fine dissection forceps</td>
			<td>Fine Science Tools</td>
			<td>11250-00</td>
			<td></td>
		</tr>
		<tr>
			<td>Hank&#39;s Buffered Salt Solution (HBSS)</td>
			<td>Gibco</td>
			<td>14175095</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES (1M)</td>
			<td>Gibco</td>
			<td>15630130</td>
			<td></td>
		</tr>
		<tr>
			<td>iScript cDNA Synthesis Kit</td>
			<td>Bio-Rad</td>
			<td>1708890</td>
			<td></td>
		</tr>
		<tr>
			<td>Isoflurane, USP</td>
			<td>Covetrus</td>
			<td>11695067772</td>
			<td></td>
		</tr>
		<tr>
			<td>Isotemp General Purpose Deluxe Water Bath</td>
			<td>Fisher Scientific</td>
			<td>FSGPD20</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: ActB_Forward: 5&#8217;- agagggaaatcgtgcgtgac -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: ActB_Reverse: 5&#8217;- caatagtgatgacctggccgt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD31_Forward: 5&#8217;- gagcccaatcacgtttcagttt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD31_Reverse: 5&#8217;- tccttcctgcttcttgctagct -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD45_Forward: 5&#8217;- gggttgttctgtgccttgtt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD45_Reverse: 5&#8217;- ctggacggacacagttagca -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: VE-Cadherin_Forward: 5&#8217;- tcctctgcatcctcactatcaca -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: VE-Cadherin_Reverse: 5&#8217;- gtaagtgaccaactgctcgtgaat -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium iodide</td>
			<td>Sigma-Aldrich</td>
			<td>P4864</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Plus Mini Kit</td>
			<td>Qiagen</td>
			<td>74134</td>
			<td></td>
		</tr>
		<tr>
			<td>Sorvall Legend Micro 21R Centrifuge, Refrigerated</td>
			<td>ThermoFisher</td>
			<td>75002477</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR-Green iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>172-5120</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution</td>
			<td>ThermoFisher</td>
			<td>15250061</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Rat Anti-Mouse CD45</td>
			<td>BD Biosciences</td>
			<td>560501</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Rat IgG2b, &#954; Isotype Control</td>
			<td>BD Biosciences</td>
			<td>560457</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of murine retinal endothelial cells for next-generation sequencing

أدت التحسينات الأخيرة في تسلسل الجيل التالي إلى تطوير معرفة الباحثين بالبيولوجيا الجزيئية والخلوية ، مع العديد من الدراسات التي كشفت عن نماذج جديدة في بيولوجيا الأوعية الدموية. يتطلب تطبيق هذه الأساليب على نماذج تطور الأوعية الدموية تحسين تقنيات عزل الخلايا من الأنسجة الجنينية وما بعد الولادة. يجب أن يكون كل من إنتاجية الخلية وقابليتها للحياة والنقاء الأقصى للحصول على نتائج دقيقة وقابلة للتكرار من مناهج التسلسل من الجيل التالي. يستخدم الباحثون نموذج الأوعية الدموية لشبكية العين للفأر الوليدي لدراسة آليات تطور الأوعية الدموية. استخدم الباحثون هذا النموذج للتحقيق في آليات تكوين الأوعية الدموية وتحديد مصير الشرايين الوريدية أثناء تكوين الأوعية الدموية ونضجها. يتطلب تطبيق تقنيات تسلسل الجيل التالي لدراسة نموذج تطور الأوعية الدموية في شبكية العين تحسين طريقة لعزل الخلايا البطانية الشبكية التي تزيد من إنتاجية الخلايا وصلاحيتها ونقاوتها. يصف هذا البروتوكول طريقة لعزل أنسجة شبكية الفئران والهضم والتنقية باستخدام فرز الخلايا المنشط بالفلورة (FACS). تشير النتائج إلى أن مجموعة الخلايا البطانية CD31 + / CD45 المنقاة ب FACS غنية للغاية للتعبير الجيني للخلايا البطانية ولا تظهر أي تغيير في الصلاحية لمدة 60 دقيقة بعد FACS. وشملت النتائج التمثيلية لنهج تسلسل الجيل التالي على الخلايا البطانية المعزولة باستخدام هذه الطريقة، بما في ذلك تسلسل الحمض النووي الريبي السائب وتسلسل الحمض النووي الريبي أحادي الخلية، مما يدل على أن هذه الطريقة لعزل الخلايا البطانية في شبكية العين متوافقة مع تطبيقات تسلسل الجيل التالي. ستسمح هذه الطريقة لعزل الخلايا البطانية في شبكية العين بتقنيات تسلسل متقدمة للكشف عن آليات جديدة لتطور الأوعية الدموية.

يؤدي هضم أنسجة الشبكية والتلطيخ المناعي ل CD31 و CD45 إلى مجموعة محددة من الخلايا البطانية CD31 + / CD45 بعد بوابة الخلايا والخلايا المفردة والقدرة على البقاء (الشكل 2 أ). مطلوب تلطيخ مناعي CD45 للقضاء على خلايا CD31 + / CD45 + ، والتي تشمل الصفائح الدموية وبعض الكريات البيض21. يج?...

Watch this Scientific Journal Video about Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing at JoVE.com

Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing

يصف هذا البروتوكول طريقة لعزل الخلايا البطانية الشبكية بعد الولادة للفئران المحسنة لإنتاجية الخلايا ونقاوتها وقابليتها للحياة. هذه الخلايا مناسبة لنهج تسلسل الجيل التالي.

عزل الخلايا البطانية الشبكية للجيل التالي

Recent improvements in next-generation sequencing have advanced researchers&#39; knowledge of molecular and cellular biology, with several studies ...

ستسمح هذه الطريقة لعزل الخلايا البطانية في شبكية العين بتقنيات تسلسل متقدمة للكشف عن آليات جديدة لتطور الأوعية الدموية. تم تحسين البروتوكول الموصوف للحصول على درجات عالية من الجدوى والنقاء ، والتي تعتبر ضرورية لتطبيقات التسلسل من الجيل التالي. سيوضح الإجراء شيلبي كاين ، طالب دراسات عليا من مختبر هيرشي.ابدأ في إزالة العينين من الفأر الوليدي المصاب بالقتل الرحيم عن طريق قطع الجلد والغشاء فوق العين بشق عمودي على الجفن باستخدام مقص التشريح. ثم استخدم الملقط للضغط لأسفل أعلى وأسفل العين بحيث تتحرك العين خارج التجويف. قرصة بعناية تحت العين مع ملقط وقطع العصب البصري الذي يبقي العين متصلة.ثم ضع كلتا العينين من الماوس في بئر من لوحة 48 بئر في PBS المثلج الطازج حتى الانتهاء من الحصاد. لعزل أنسجة شبكية الفأر ، قم بتعليق العينين في وسادة التشريح في طبق بتري مملوء ب 500 ميكرولتر من PBS المثلج باستخدام وسادة أنبوب نقل ذات طرف عريض. العمل تحت مجهر التشريح ، امسك العصب البصري بملقط دقيق واحد واستخدم الملقط الثاني لاختراق الثقب من خلال الغرفة الأمامية للعين حيث تتصل القرنية والصلبة.ثم تمزيق الثقب في دائرة حوالي 75 ٪ من الطريق حول القرنية. أثناء إمساك العصب البصري بملقط واحد ، استخدم الملقط الثاني لتمزيق الصلبة والجسم الزجاجي برفق من أنسجة الشبكية. لإزالة العدسة وأوعية الضفيرة الهيالويد ، قم بالوصول إلى شبكية العين باستخدام ملقط مفتوح حتى تلمسها تقريبا ثم أغلق الملقط للاستيلاء على العدسة وأوعية الضفيرة الهيالويد وسحبها من شبكية العين.عند إزالة جميع الأوعية ، ضع شبكية العين في أنبوبي الطرد المركزي الصغيرين المملليلتر المملوءين ب 500 ميكرولتر من جهاز PBS واحد بارد. قم بإزالة PBS الزائد من أنبوب الطرد المركزي الصغير سعة 2 ملليلتر باستخدام ماصة تاركا حوالي 100 ميكرولتر من PBS في الأنبوب لتغطية أنسجة الشبكية بالكامل. ثم أضف 500 ميكرولتر من محلول الهضم الطازج إلى الأنبوب.استخدم ماصة P1000 وطرف ماصة لتحريك أنسجة الشبكية لأعلى ولأسفل في محلول الهضم خمس مرات. عند الانتهاء ، احتضن خليط الهضم في حمام مائي 37 درجة مئوية لمدة 20 دقيقة مع سحب خليط الهضم لأعلى ولأسفل كل خمس دقائق كما هو موضح من قبل. بعد الحضانة ، سوف تذوب أنسجة الشبكية في تعليق خلية واحدة مما يجعل خليط الهضم غائما.بعد ذلك ، قم بتكوير الخلايا بالطرد المركزي عند 375 جم لمدة خمس دقائق عند أربع درجات مئوية. بعد الطرد المركزي ، قم بإزالة PBS من حبيبات الخلية المغسولة عن طريق السحب ثم قم بتلطيخ الخلايا المناعية عن طريق إعادة تعليق الحبيبات في 100 ميكرولتر من محلول تلطيخ الأجسام المضادة لكل 0.5 مرة 10 إلى الخلايا السادسة. احتضان معلق الخلية الواحدة بمحلول تلطيخ الأجسام المضادة لمدة 30 دقيقة على الثلج في الظلام مع النقر على الأنبوب كل 10 دقائق لخلط الخلايا برفق.لفرز الخلايا المنشطة بالفلورة ، قم بتكوير الخلايا عن طريق الطرد المركزي عند 375 جم لمدة خمس دقائق عند أربع درجات مئوية. بعد إزالة المادة الطافية ، اغسل الخلايا وحبيباتها في 500 ميكرولتر من PBS كما هو موضح من قبل. ثم أعد تعليق الخلايا في 300 ميكرولتر من فرز الخلايا المنشط بالفلورة أو المخزن المؤقت FACS عن طريق الخلط بلطف مع الماصة.بعد ذلك ، أضف يوديد البروبيديوم أو PI كعلامة جدوى إلى أنابيب العينة التي تحتوي على المخزن المؤقت FACS للحصول على تركيز نهائي قدره 0.5 ميكروغرام لكل ملليلتر. استخدم ماصة لنقل معلقات الخلايا من خلال غطاء مصفاة الخلية الذي يحتوي على مرشح 35 ميكرون في أنبوب اختبار سعة خمسة ملليلتر. بعد الترشيح ، احتفظ بأنبوب FACS على الجليد في الظلام ثم انقل الأنبوب إلى فارز الخلايا.قم بتشغيل جهاز FACS والكمبيوتر وافتح برنامج FACS لتشغيل وتشغيل جهاز FACS. إجراء اختبارات مراقبة الجودة الروتينية. قم بتحميل عينات بقعة التحكم في أداة FACS لضبط المحاور.ابدأ بخلايا الأجسام المضادة IgG فقط لتوليد وضبط التشتت الأمامي والتشتت الجانبي. ثم CD31 الجسم المضاد فقط لتوليد وضبط CD31. ثم الأجسام المضادة CD45 فقط لتوليد وضبط CD45.تسجيل البيانات من عينات التحكم. بعد ذلك ، قم بتحميل خلايا العينة الملطخة في أداة FACS وقم بتشغيل العينة. قم بمشية الخلايا بناء على معلمات التشتت الأمامي أو FSC والتشتت الجانبي أو SSC.خلايا المشي بواسطة FSCA و FSCH لتحديد مضاعفة الخلايا وجمع الخلايا المفردة فقط. خلايا المشي بواسطة PI و SSCA لتحديد الخلايا القابلة للحياة. اصنع مشية CD31 + CD45 باستخدام عناصر التحكم اصنع مشية CD31 + CD45 باستخدام عناصر التحكم وقم بمشية الخلايا بواسطة CD31 و CD45.أدخل أنبوب تجميع به 250 ميكرولتر من المخزن المؤقت FACS في الجهاز. بعد ذلك ، ابدأ في فرز الخلايا التي تكون CD31 + CD45 في أنبوب التجميع المثبت. احتفظ بأنابيب التجميع على الجليد لمزيد من التحليل.يمكن معالجة العينات لتطبيقات التسلسل من الجيل التالي. في الدراسة ، أثر تغيير وقت الهضم على إنتاجية الخلية ونسبة صلاحيتها. أدى وقت الهضم البالغ 20 دقيقة إلى تحقيق العائد الأمثل مع نسبة منخفضة من الخلايا البطانية غير القابلة للحياة.أظهر تلطيخ يوديد البروبيديوم اللاحق أن الخلايا البطانية المعزولة ظلت قابلة للحياة لمدة 60 دقيقة بعد العزل. تم تقييم نقاء عدد الخلايا من خلال تحليل PCR الكمي أو qPCRR للتعبير عن جينات الخلايا البطانية التي تظهر إثراء قويا لجينات الخلايا البطانية في مجموعة CD31 + CD45. تنقية الحمض النووي الريبي من الخلايا البطانية المعزولة تحويل وتضخيم cDNA من خلال إعداد المكتبة وتسلسلها أسفرت مكتبة cDNA عن أكثر من 16،000 جين تم تحديدها في تسع عينات مستقلة.لوحظ انخفاض في النصوص لكل مليون قراءة أو TPM في الجينات التي تقل عن هذه العتبة. أدى تسلسل الحمض النووي الريبي أحادي الخلية للخلايا البطانية الشبكية المعزولة من خلال خط أنابيب الجينوم 10x إلى متوسط 1،171 جينا لكل خلية ، و 15،247 جينا إجماليا مكتشفا ، ومتوسط 2،255 معرفا جزيئيا فريدا أو عدد UMI لكل خلية في 917 خلية. الخطوات الحاسمة في هذا البروتوكول هي عزل أنسجة الشبكية وهضم الأنسجة ، والتي يجب إجراؤها بدقة كما هو موضح لتحسين إنتاجية الخلايا وصلاحيتها.يمكن استخدام الخلايا البطانية المعزولة في تقنيات التسلسل المتقدمة مثل تسلسل الحمض النووي الريبي للنسخ الكامل ، وتسلسل الحمض النووي الريبي أحادي الخلية ، وتسلسل الترسيب المناعي للكروماتين ، ومقايسة تسلسل الكروماتين الذي يمكن الوصول إليه بواسطة transposase. يمكن أن يؤدي استخدام هذه الطريقة المحسنة جنبا إلى جنب مع طرق التسلسل من الجيل التالي والنهج الحسابية إلى توضيح آليات مسارات الإشارات المترابطة التي تنظم تطورات الأوعية الدموية.

Research

JoVE Journal

Developmental Biology

Efficient Derivation of Retinal Pigment Epithelium Cells from Stem Cells

اشتقاق كفاءة خلايا الظهارة الصبغية الشبكية من الخلايا الجذعية

No cure has been discovered for age-related macular degeneration  (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex ...

Murine Dermal Fibroblast Isolation by FACS

الفئران عن طريق الجلد الخلايا الليفية العزلة التي FACS

Fibroblasts are the principle cell type responsible for secreting extracellular matrix and are a critical component of many organs and tissues. Fibroblast ...

Isolation of Murine Embryonic Hemogenic Endothelial Cells

عزل خلايا الفئران الجنينية مكون للدم غشائي

The specification of hemogenic endothelial cells from embryonic vascular endothelium occurs during brief developmental periods within distinct tissues, ...

Isolation of Endothelial Progenitor Cells from Human Umbilical Cord Blood

عزل خلايا غشائي السلف من دم الحبل السري البشري

The existence of endothelial progenitor cells (EPCs) in peripheral blood and its involvement in vasculogenesis was first reported by Ashara and ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

التفريق بين الخلايا الظهارية الصبغية الشبكية من الخلايا الجذعية Pluripotent المستحث أو الجنينية البشرية سريعة وموجهة

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

في المختبر توليد المشتقات سميط من البشرية التي يسببها الخلايا الجذعية Pluripotent

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Multiplexed Single Cell mRNA Sequencing Analysis of Mouse Embryonic Cells

مولتيميد خليه واحده mRNA تحليل التسلسل من الخلايا الجنينية الماوس

Single cell mRNA sequencing has made significant progress in the last several years and has become an important tool in the field of developmental ...

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

إعداد مكتبات RNA الصغيرة لتسلسل من أجنة الماوس المبكر

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...

Isolation of Endocardial and Coronary Endothelial Cells from the Ventricular Free Wall of the Rat Heart

عزل الخلايا الإندوكاريال والشريان التاجي من الجدار الحر البطيني للقلب الجرذ

It has been shown that endocardial endothelial cells (EECs) and coronary endothelial cells (CECs) differ in origin, development, markers, and functions. ...

Isolation of Murine Spermatogenic Cells using a Violet-Excited Cell-Permeable DNA Binding Dye

عزل الخلايا المنوية مورين باستخدام البنفسجي-متحمس خلية نفاذة صبغة ملزمة

Isolation of meiotic spermatocytes is essential to investigate molecular mechanisms underlying meiosis and spermatogenesis. Although there are established ...