Name: isolation of murine retinal endothelial cells for next-generation sequencing
Uploaded: 2021-10-11T13:00:00
Description: Watch this Scientific Journal Video about Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing at JoVE.com

Dank aan de Yale Flow Cytometry Facility, de University of Virginia Flow Cytometry Core Facility, het Yale Center for Genomic Analysis en de University of Virginia Genome Analysis and Technology Core voor hun inspanningen, expertise en advies om bij te dragen aan de gepresenteerde experimenten. Deze studie werd gefinancierd door NIH-subsidies aan N.W.C. (T32 HL007224, T32 HL007284), S.C. (T32 HL007284), K.W. (R01 HL142650) en K.K.H. (R01 HL146056, R01 DK118728, UH3 EB025765).

De Institutional Animal Care and Use Committees van Yale University en de University of Virginia hebben alle dierproeven goedgekeurd die in dit protocol worden vermeld.
1. Verkrijg muizenogen voor retinale isolatie
<ol><li>Bereid 1x ijskoude PBS en voeg 500 μL toe aan elk putje van een 48-well plaat.</li>
	<li>Euthanaseer neonatale muizen op postnatale dag zes (P6) volgens goedgekeurde institutionele richtlijnen. Voor dit experiment worden nesten van ongeveer 4-8 neonatale ...

<ol>
	<li>Slatko, B. E., Gardner, A. F., Ausubel, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview+of+next-generation+sequencing+technologies.">Overview of next-generation sequencing technologies.</a> Current Protocols in Molecular Biology. 122 (1), 59 (2018).</li><li>Chavkin, N. W., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+cell+analysis+in+vascular+biology.">Single cell analysis in vascular biology.</a> Frontiers in Cardiovascular Medicine. 7, 42 (2020).</li><li>Ma, F., Hernandez, G. E., Romay, M., Iruela-Arispe, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+RNA+sequencing+to+study+vascular+diversity+and+function.">Single-cell RNA sequencing to study vascular diversity and function.</a> Current Opinion in Hematology. 28 (3), 221-229 (2021).</li><li>Potter, A. S., Potter, S. S., S, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissociation+of+tissues+for+single-cell+analysis.">Dissociation of tissues for single-cell analysis.</a> Methods in Molecular Biology. 1926, 55-62 (2019).</li><li>Braga, F. A. V., Miragaia, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+handling+and+dissociation+for+single-cell+RNA-seq.">Tissue handling and dissociation for single-cell RNA-seq.</a> Single Cell Methods: Methods in Molecular Biology. 1979, 9-21 (2019).</li><li>Brink, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+sequencing+reveals+dissociatin-induced+gene+expression+in+tissue+subpopulations.">Single-cell sequencing reveals dissociatin-induced gene expression in tissue subpopulations.</a> Nature Methods. 14 (10), 935-936 (2017).</li><li>Skulska, K., Wegrzyn, A. S., Chelmonska-Soyta, A., Chodaczek, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+tissue+enzymatic+digestion+on+analysis+of+immune+cells+in+mouse+reproductive+mucosa+with+a+focus+on+gammadelta+T+cells.">Impact of tissue enzymatic digestion on analysis of immune cells in mouse reproductive mucosa with a focus on gammadelta T cells.</a> Journal of Immunological Methods. 474, 112665 (2019).</li><li>Connolly, S., Hores, T., Smith, L., D'Amore, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+vascular+development+in+the+mouse+retina.">Characterization of vascular development in the mouse retina.</a> Microvascular Research. 36 (3), 275-290 (1988).</li><li>Crist, A., Young, C., Meadows, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+arteriovenous+identity+in+the+developing+neonate+mouse+retina.">Characterization of arteriovenous identity in the developing neonate mouse retina.</a> Gene Expression Patterns: GEP. 23-24, 22-31 (2017).</li><li>dela Paz, N. G., D'Amore, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterial+versus+venous+endothelial+cells.">Arterial versus venous endothelial cells.</a> Cell and Tissue Research. 335 (1), 5-16 (2009).</li><li>Fang, J. S., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+regulation+of+arteriovenous+endothelial+cell+specification.">Molecular regulation of arteriovenous endothelial cell specification.</a> F1000Res. 8, (2019).</li><li>Smith, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxygen-induced+retinopathy+in+the+mouse.">Oxygen-induced retinopathy in the mouse.</a> Investigative Ophthalmology and Visual Science. 35 (1), 101-111 (1994).</li><li>Pitulescu, M. E., Schmidt, I., Benedito, R., Adams, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+gene+targeting+in+the+neonatal+vasculature+and+analysis+of+retinal+angiogenesis+in+mice.">Inducible gene targeting in the neonatal vasculature and analysis of retinal angiogenesis in mice.</a> Nature Protocols. 5 (9), 1518-1534 (2010).</li><li>Ruiz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+of+hereditary+hemorrhagic+telangiectasia+generated+by+transmammary-delivered+immunoblocking+of+BMP9+and+BMP10.">A mouse model of hereditary hemorrhagic telangiectasia generated by transmammary-delivered immunoblocking of BMP9 and BMP10.</a> Scientific Reports. 6, 37366 (2016).</li><li>Fang, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shear-induced+Notch-Cx37-p27+axis+arrests+endothelial+cell+cycle+to+enable+arterial+specification.">Shear-induced Notch-Cx37-p27 axis arrests endothelial cell cycle to enable arterial specification.</a> Nature Communication. 8 (1), 2149 (2017).</li><li>Ola, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMAD4+prevents+flow+induced+arterial-venous+malformations+by+inhibiting+Casein+Kinase+2.">SMAD4 prevents flow induced arterial-venous malformations by inhibiting Casein Kinase 2.</a> Circulation. 138 (21), 2379-2394 (2018).</li><li>Chavkin, N. W., Walsh, K., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+highly+purified+and+viable+retinal+endothelial+cells.">Isolation of highly purified and viable retinal endothelial cells.</a> Journal of Vascular Research. 58 (1), 49-57 (2020).</li><li>Hulspas, R., O'Gorman, M. R. G., Wood, B. L., Gratama, J. W., Sutherland, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Considerations+for+the+control+of+background+fluorescence+in+clinical+flow+cytometry.">Considerations for the control of background fluorescence in clinical flow cytometry.</a> Cytometry PartB: Clinical Cytometry. 76 (6), 355-364 (2009).</li><li>Bachman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse-transcription+PCR+(RT-PCR).">Reverse-transcription PCR (RT-PCR).</a> Methods in Enzymology. 530, 67-74 (2013).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+RNA+by+real-time+Reverse+Transcription-Polymerase+Chain+Reaction+(RT-PCR).">Quantification of RNA by real-time Reverse Transcription-Polymerase Chain Reaction (RT-PCR).</a> Cold Spring Harbour Protocols. 2018 (10), (2018).</li><li>Liu, L., Shi, G. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD31:+beyond+a+marker+for+endothelial+cells.">CD31: beyond a marker for endothelial cells.</a> Cardiovascular Research. 94 (1), 3-5 (2012).</li><li>Zarkada, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+endothelial+tip+cells+guide+neuroretina+vascularization+and+blood-retina-barrier+formation.">Specialized endothelial tip cells guide neuroretina vascularization and blood-retina-barrier formation.</a> Developmental Cell. 56 (15), 2237-2251 (2021).</li><li>Su, X., Sorenson, C. M., Sheibani, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+murine+retinal+endothelial+cells.">Isolation and characterization of murine retinal endothelial cells.</a> Molecular Vision. 9, 171-178 (2003).</li><li>Benedito, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+notch+ligands+Dll4+and+Jagged1+have+opposing+effects+on+angiogenesis.">The notch ligands Dll4 and Jagged1 have opposing effects on angiogenesis.</a> Cell. 137 (6), 1124-1135 (2009).</li><li>Daneman, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt/beta-catenin+signaling+is+required+for+CNS,+but+not+non-CNS,+angiogenesis.">Wnt/beta-catenin signaling is required for CNS, but not non-CNS, angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (2), 641-646 (2009).</li><li>Okabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurons+limit+angiogenesis+by+titrating+VEGF+in+retina.">Neurons limit angiogenesis by titrating VEGF in retina.</a> Cell. 159 (3), 584-596 (2014).</li><li>Crist, A. M., Lee, A. R., Patel, N. R., Westhoff, D. E., Meadows, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vascular+deficiency+of+Smad4+causes+arteriovenous+malformations:+a+mouse+model+of+Hereditary+Hemorrhagic+Telangiectasia.">Vascular deficiency of Smad4 causes arteriovenous malformations: a mouse model of Hereditary Hemorrhagic Telangiectasia.</a> Angiogenesis. 21 (2), 363-380 (2018).</li><li>Kim, Y. H., Choe, S. W., Chae, M. Y., Hong, S., Oh, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMAD4+deficiency+leads+to+development+of+arteriovenous+malformations+in+neonatal+and+adult+mice.">SMAD4 deficiency leads to development of arteriovenous malformations in neonatal and adult mice.</a> Journal of the American Heart Association. 7 (21), 009514 (2018).</li><li>Ma, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absence+of+TGFbeta+signaling+in+retinal+microglia+induces+retinal+degeneration+and+exacerbates+choroidal+neovascularization.">Absence of TGFbeta signaling in retinal microglia induces retinal degeneration and exacerbates choroidal neovascularization.</a> eLife. 8, 42049 (2019).</li><li>Luo, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterialization+requires+the+timely+suppression+of+cell+growth.">Arterialization requires the timely suppression of cell growth.</a> Nature. 589 (7842), 437-441 (2021).</li><li>Lawson, N. D., Vogel, A. M., Weinstein, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=sonic+hedgehog+and+vascular+endothelial+growth+factor+act+upstream+of+the+Notch+pathway+during+arterial+endothelial+differentiation.">sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation.</a> Developmental Cell. 3 (1), 127-136 (2002).</li><li>Larrivee, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ALK1+signaling+inhibits+angiogenesis+by+cooperating+with+the+Notch+pathway.">ALK1 signaling inhibits angiogenesis by cooperating with the Notch pathway.</a> Developmental Cell. 22 (3), 489-500 (2012).</li><li>Wythe, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ETS+factors+regulate+Vegf-dependent+arterial+specification.">ETS factors regulate Vegf-dependent arterial specification.</a> Developmental Cell. 26 (1), 45-58 (2013).</li><li>Davis, D. M., Purvis, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+analysis+of+signaling+patterns+in+single+cells.">Computational analysis of signaling patterns in single cells.</a> Seminars in Cell and Developmental Biology. , 35-43 (2015).</li><li>Gaudet, S., Miller-Jensen, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redefining+signaling+pathways+with+an+expanding+single-cell+toolbox.">Redefining signaling pathways with an expanding single-cell toolbox.</a> Trends in Biotechnology. 34 (6), 458-469 (2016).</li><li>Aibar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SCENIC:+single-cell+regulatory+network+inference+and+clustering.">SCENIC: single-cell regulatory network inference and clustering.</a> Nature Methods. 14 (11), 1083-1086 (2017).</li><li>Trapnell, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dynamics+and+regulators+of+cell+fate+decisions+are+revealed+by+pseudotemporal+ordering+of+single+cells.">The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells.</a> Nature Biotechnology. 32 (4), 381-386 (2014).</li></ol>

Dit protocol beschrijft een methode voor de isolatie van endotheelcellen uit postnatale murine retinale weefsel die is geoptimaliseerd voor een hoog celaantal, zuiverheid en levensvatbaarheid. Celzuiverheid wordt verkregen door FACS-isolatie van endotheelcelpopulaties uit de verteerde eencellige suspensie door CD31 +/CD45-immunostaining. Kwaliteit van isolatie wordt gekwantificeerd in testen op levensvatbaarheid door Trypan blauwe kleuring en genexpressie door qPCR voor CD31, CD45 en VE-Cadherine (hoewel VE-Cadherine nie...

De hoge doorvoercapaciteit van het sequentiëren van nucleïnezuren via next-generation sequencing-benaderingen heeft de kennis van onderzoekers over moleculaire en cellulaire biologie enorm verbeterd. Deze geavanceerde technieken omvatten whole transcriptome RNA sequencing, DNA sequencing van doelgebieden om Single Nucleotide Polymorphisms (SNP's) te identificeren, DNA sequencing van gebonden transcriptiefactoren in Chromatine Immunoprecipitation (ChIP) sequencing, of open chromatine regio's in Assay for Transposase-Accessible Chromatin (ATAC) sequencing, en single-cell RNA sequencing1 . In de vasculaire biologie hebben deze ontwikkelingen onderzoekers in staat gesteld om gecompliceerde mechanismen van ontwikkeling en ziekte op te helderen, samen met onderscheidende genexpressiepatronen langs een continuüm van verschillende fenotypen 2,3. Toekomstige experimenten kunnen complexe mechanismen verder definiëren door de volgende generatie sequencing te combineren met geëvalueerde modellen van vasculaire ontwikkeling, maar de methoden voor monstervoorbereiding moeten compatibel zijn met de geavanceerde sequencingtechnieken.
De kwaliteit, nauwkeurigheid en reproduceerbaarheid van de volgende generatie sequencingbenaderingen zijn afhankelijk van de methode van monstervoorbereiding. Bij het isoleren van een subset van cellen of het genereren van eencellige suspensies uit weefsels, zijn optimale verterings- en zuiveringsmethoden essentieel voor het maximaliseren van het celaantal, de levensvatbaarheid en de zuiverheid van de celpopulatie 4,5. Dit vereist een balans in de verteringsmethode: een sterke spijsvertering is nodig om cellen uit het weefsel vrij te maken en voldoende cellen te verkrijgen voor stroomafwaartse benaderingen, maar de levensvatbaarheid van cellen zal negatief worden beïnvloed als de spijsvertering te sterk is 6,7. Bovendien is zuiverheid van de celpopulatie noodzakelijk voor robuuste resultaten en nauwkeurige analyse van gegevens, die kunnen worden bereikt via FACS. Dit benadrukt het belang van het optimaliseren van celisolatiemethoden om next-generation sequencing toe te passen op gevestigde modellen van vasculaire ontwikkeling.
Een goed gekarakteriseerd model voor het onderzoeken van vasculaire ontwikkeling is het murine retinale vasculaire ontwikkelingsmodel. Murine retinale vasculatuur ontwikkelt zich postnataal in een tweedimensionale oppervlakkige plexus, met initiële angiogene kieming uit de oogzenuw zichtbaar op postnatale dag (P)3, angiogene front met stengel- en tipcellen en initiële vaatrijping zichtbaar bij P6, en rijping van de vasculaire plexus zichtbaar na P9 8,9. Tijdens de remodellering van de initiële vasculaire plexus ondergaan endotheelcellen specificatie voor arteriële, capillaire en veneuze fenotypen in verschillende vaten om een bloedsomloopnetwerk te genereren 10,11. Daarom stelt deze methode onderzoekers in staat om angiogene vasculaire plexusvorming en endotheel arteriële-veneuze specificatie en rijping op verschillende tijdstippen tijdens ontwikkeling9 te visualiseren. Daarnaast biedt dit model een methode voor het onderzoeken van de effecten van transgene manipulatie op angiogenese en vasculaire plexusontwikkeling, die is toegepast voor het onderzoek naar vasculaire ontwikkeling, arteriaal-veneuze malformaties en zuurstof-geïnduceerde neovascularisatie 12,13,14,15,16 . Om de volgende generatie sequencingbenaderingen te combineren met het murine retinale vasculaire ontwikkelingsmodel, is een geoptimaliseerd protocol voor de isolatie van endotheelcellen uit netvliesweefsel noodzakelijk.
Dit protocol beschrijft een geoptimaliseerde methode voor het verteren van netvliesweefsel van muizen op P6 om de celopbrengst, zuiverheid en levensvatbaarheid te maximaliseren. Retinaal weefsel wordt geïsoleerd uit P6-muizen, gedurende 20 minuten verteerd, immunostained voor CD31 en CD45 en gezuiverd door FACS om een eencellige suspensie van endotheelcellen in ongeveer 2,5 uur te isoleren (figuur 1A). Deze endotheelcellen bleken gedurende 60 minuten na isolatie17 een hoge levensvatbaarheid te behouden, waardoor bibliotheekvoorbereidingen voor sequencingmethoden van de volgende generatie mogelijk waren. Daarnaast worden representatieve resultaten verstrekt voor FACS gating en kwaliteitscontroleresultaten van twee afzonderlijke next-generation sequencingmethoden met behulp van dit isolatieprotocol: whole transcriptome RNA sequencing en single-cell RNA sequencing. Deze methode maakt het mogelijk om next-generation sequencingbenaderingen te gebruiken in combinatie met het retinale vascularisatiemodel om nieuwe mechanismen van vasculaire ontwikkeling op te helderen.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2 mL Eppendorf&#160;safe-lock tubes</td>
			<td>USA Scientific</td>
			<td>4036-3352</td>
			<td></td>
		</tr>
		<tr>
			<td>5 ml Falcon Test Tubes with Cell Strainer Snap Cap</td>
			<td>Corning</td>
			<td>352235</td>
			<td></td>
		</tr>
		<tr>
			<td>60 mm Non TC-treated Culture Dish</td>
			<td>Corning</td>
			<td>430589</td>
			<td></td>
		</tr>
		<tr>
			<td>APC Rat Anti-Mouse CD31</td>
			<td>BD Biosciences</td>
			<td>551262</td>
			<td></td>
		</tr>
		<tr>
			<td>APC Rat IgG2a &#954; Isotype Control</td>
			<td>BD Biosciences</td>
			<td>553932</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSChorus Software</td>
			<td>BD Biosciences</td>
			<td>FACSCHORUS</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSMelody Cell Sorter</td>
			<td>BD Biosciences</td>
			<td>FACSMELODY</td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase Type II</td>
			<td>Sigma-Aldrich</td>
			<td>234115</td>
			<td></td>
		</tr>
		<tr>
			<td>Costar 48-well Clear TC-treated Multiple Well Plates, Individually Wrapped, Sterile</td>
			<td>Corning</td>
			<td>3548</td>
			<td></td>
		</tr>
		<tr>
			<td>D-Glucose</td>
			<td>Gibco</td>
			<td>A2494001</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Graduated Transfer Pipettes</td>
			<td>Fisher Scientific</td>
			<td>12-711-9AM</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissecting Pan Wax</td>
			<td>Carolina</td>
			<td>629100</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection scissors</td>
			<td>Fine Science Tools</td>
			<td>14085-08</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection Stereo Microscope M165 FC</td>
			<td>Leica</td>
			<td>M165FC</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Gibco</td>
			<td>11965-052</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Phosphate Buffered Saline (PBS)</td>
			<td>Gibco</td>
			<td>14190144</td>
			<td></td>
		</tr>
		<tr>
			<td>Eppendorf&#160;Flex-Tubes Microcentrifuge Tubes 1.5 mL</td>
			<td>Sigma-Aldrich</td>
			<td>22364120</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Gemini Bio</td>
			<td>100-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Fine dissection forceps</td>
			<td>Fine Science Tools</td>
			<td>11250-00</td>
			<td></td>
		</tr>
		<tr>
			<td>Hank&#39;s Buffered Salt Solution (HBSS)</td>
			<td>Gibco</td>
			<td>14175095</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES (1M)</td>
			<td>Gibco</td>
			<td>15630130</td>
			<td></td>
		</tr>
		<tr>
			<td>iScript cDNA Synthesis Kit</td>
			<td>Bio-Rad</td>
			<td>1708890</td>
			<td></td>
		</tr>
		<tr>
			<td>Isoflurane, USP</td>
			<td>Covetrus</td>
			<td>11695067772</td>
			<td></td>
		</tr>
		<tr>
			<td>Isotemp General Purpose Deluxe Water Bath</td>
			<td>Fisher Scientific</td>
			<td>FSGPD20</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: ActB_Forward: 5&#8217;- agagggaaatcgtgcgtgac -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: ActB_Reverse: 5&#8217;- caatagtgatgacctggccgt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD31_Forward: 5&#8217;- gagcccaatcacgtttcagttt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD31_Reverse: 5&#8217;- tccttcctgcttcttgctagct -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD45_Forward: 5&#8217;- gggttgttctgtgccttgtt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD45_Reverse: 5&#8217;- ctggacggacacagttagca -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: VE-Cadherin_Forward: 5&#8217;- tcctctgcatcctcactatcaca -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: VE-Cadherin_Reverse: 5&#8217;- gtaagtgaccaactgctcgtgaat -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium iodide</td>
			<td>Sigma-Aldrich</td>
			<td>P4864</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Plus Mini Kit</td>
			<td>Qiagen</td>
			<td>74134</td>
			<td></td>
		</tr>
		<tr>
			<td>Sorvall Legend Micro 21R Centrifuge, Refrigerated</td>
			<td>ThermoFisher</td>
			<td>75002477</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR-Green iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>172-5120</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution</td>
			<td>ThermoFisher</td>
			<td>15250061</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Rat Anti-Mouse CD45</td>
			<td>BD Biosciences</td>
			<td>560501</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Rat IgG2b, &#954; Isotype Control</td>
			<td>BD Biosciences</td>
			<td>560457</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of murine retinal endothelial cells for next-generation sequencing

Recente verbeteringen in de sequencing van de volgende generatie hebben de kennis van onderzoekers over moleculaire en cellulaire biologie verbeterd, met verschillende studies die nieuwe paradigma's in de vasculaire biologie onthullen. Het toepassen van deze methoden op modellen van vasculaire ontwikkeling vereist de optimalisatie van celisolatietechnieken uit embryonale en postnatale weefsels. Celopbrengst, levensvatbaarheid en zuiverheid moeten allemaal maximaal zijn om nauwkeurige en reproduceerbare resultaten te verkrijgen van de volgende generatie sequencingbenaderingen. Het neonatale retinale vascularisatiemodel van de muis wordt door onderzoekers gebruikt om mechanismen van vasculaire ontwikkeling te bestuderen. Onderzoekers hebben dit model gebruikt om mechanismen van angiogenese en arteriaal-veneuze lotspecificatie tijdens bloedvatvorming en rijping te onderzoeken. Het toepassen van sequencingtechnieken van de volgende generatie om het retinale vasculaire ontwikkelingsmodel te bestuderen, vereist optimalisatie van een methode voor de isolatie van retinale endotheelcellen die de celopbrengst, levensvatbaarheid en zuiverheid maximaliseert. Dit protocol beschrijft een methode voor murine retinale weefselisolatie, spijsvertering en zuivering met behulp van fluorescentie-geactiveerde celsortering (FACS). De resultaten geven aan dat de FACS-gezuiverde CD31+/CD45-endotheelcelpopulatie sterk verrijkt is voor endotheelcelgenexpressie en gedurende 60 minuten na FACS geen verandering in levensvatbaarheid vertoont. Inbegrepen zijn representatieve resultaten van next-generation sequencing benaderingen op endotheelcellen geïsoleerd met behulp van deze methode, inclusief bulk RNA sequencing en single-cell RNA sequencing, wat aantoont dat deze methode voor retinale endotheelcelisolatie compatibel is met next-generation sequencing toepassingen. Deze methode van retinale endotheelcelisolatie zal geavanceerde sequencingtechnieken mogelijk maken om nieuwe mechanismen van vasculaire ontwikkeling te onthullen.

Vertering van netvliesweefsel en immunostaining voor CD31 en CD45 resulteert in een identificeerbare populatie van CD31+/CD45-endotheelcellen na gating voor cellen, enkele cellen en levensvatbaarheid (figuur 2A). CD45 immunostaining is nodig om CD31+/CD45+ cellen te elimineren, waaronder bloedplaatjes en sommige leukocyten21. Voor elk experiment moeten controles worden uitgevoerd om de specificiteit van antilichamen aan te tonen en de gatingstrategie te sturen (<stron...

Watch this Scientific Journal Video about Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing at JoVE.com

Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing

Dit protocol beschrijft een methode voor de isolatie van muriene postnatale retinale endotheelcellen die zijn geoptimaliseerd voor celopbrengst, zuiverheid en levensvatbaarheid. Deze cellen zijn geschikt voor next-generation sequencing benaderingen.

Isolatie van murine retinale endotheelcellen voor next-generation sequencing

Recent improvements in next-generation sequencing have advanced researchers&#39; knowledge of molecular and cellular biology, with several studies ...

Deze methode van retinale endotheelcelisolatie zal geavanceerde sequencingtechnieken mogelijk maken om nieuwe mechanismen van vasculaire ontwikkeling te onthullen. Het beschreven protocol is geoptimaliseerd voor hoge mate van levensvatbaarheid en zuiverheid, die essentieel zijn voor sequencingtoepassingen van de volgende generatie. De procedure wordt gedemonstreerd door Shelby Cain, een afgestudeerde student van het Hershey Laboratory.Begin met het verwijderen van ogen van de geëuthanaseerde neonatale muis door de huid en het membraan over het oog weg te snijden met een loodrechte incisie van het ooglid met behulp van een dissectieschaar. Gebruik vervolgens de tang om boven en onder het oog naar beneden te drukken, zodat het oog uit de oogkas beweegt. Knijp voorzichtig onder het oog met de tang en snijd de oogzenuw door die het oog vasthoudt.Plaats vervolgens beide ogen van de muis in een putje van de 48-well plaat in de vers bereide ijskoude PBS totdat de oogst is voltooid. Om het retinale weefsel van de muis te isoleren, hangt u de ogen in het dissectiekussen in een petrischaal gevuld met 500 microliter ijskoude PBS met behulp van een transferpijppad met een brede punt. Werk onder de dissectiemicroscoop, houd de oogzenuw vast met één fijne tang en gebruik de tweede tang om het gat door de voorste kamer van het oog te prikken waar het hoornvlies en de sclera verbinding maken.Scheur vervolgens het gat in een cirkel ongeveer 75% van de weg rond het hoornvlies. Terwijl u de oogzenuw met één tang vasthoudt, gebruikt u de tweede tang om de sclera en het glasvochtlichaam voorzichtig van het netvliesweefsel te scheuren. Om lens- en hyaluzolvaten te verwijderen, reikt u met een open tang naar het netvlies totdat u deze bijna aanraakt en sluit u vervolgens de tang om de lens- en hyaluzolvaten uit het netvlies te grijpen en te trekken.Wanneer alle vaten zijn verwijderd, plaatst u de netvliezen in de twee milliliter microcentrifugebuizen gevuld met 500 microliter van één x ijskoude PBS. Verwijder overtollige PBS uit de twee milliliter microcentrifugebuis met een pipet die ongeveer 100 microliter PBS in de buis achterlaat om het retinale weefsel volledig te bedekken. Voeg vervolgens 500 microliter van de vers bereide verteringsoplossing toe aan de buis.Gebruik een P1000 pipetta en pipetpunt om vijf keer op en neer te pipetteren in het netvliesweefsel in de spijsverteringsoplossing. Als u klaar bent, incubeer het spijsverteringsmengsel gedurende 20 minuten in een waterbad van 37 graden Celsius met het pipetteren van het spijsverteringsmengsel elke vijf minuten op en neer, zoals eerder uitgelegd. Na incubatie lost het netvliesweefsel op in een eencellige suspensie waardoor het spijsverteringsmengsel troebel wordt.Pelleteer vervolgens de cellen door centrifugeren op 375 g gedurende vijf minuten bij vier graden Celsius. Verwijder na centrifugatie de PBS uit de gewassen celpellet door pipetteer en vervolgens de cellen te immunosuppelen door de pellet in 100 microliter antilichaamkleuringsoplossing per 0,5 maal 10 naar de zesde cellen te resuspenderen. Incubeer de eencellige suspensie met de antilichaamkleuringsoplossing gedurende 30 minuten op ijs in het donker door elke 10 minuten op de buis te tikken om de cellen voorzichtig te mengen.Voor fluorescentie-geactiveerde celsortering pelleteert u de cellen door centrifugering op 375 g gedurende vijf minuten bij vier graden Celsius. Na het verwijderen van het supernatant, was en pelleteer de cellen in 500 microliter PBS zoals eerder beschreven. En resuspenseer vervolgens de cellen in 300 microliter fluorescentie-geactiveerde celsortering of FACS-buffer door voorzichtig te mengen met de pipetta.Voeg vervolgens propidiumjodide of PI toe als levensvatbaarheidsmarker aan de monsterbuizen die de FACS-buffer bevatten om een uiteindelijke concentratie van 0,5 microgram per milliliter te krijgen. Gebruik een pipet om de celsuspensies door een klikdop voor celzeef met een filter van 35 micron over te brengen in een reageerbuis van vijf milliliter. Houd na filtratie de FACS-buis op ijs in het donker en breng de buis vervolgens over naar de celsorteerder.Schakel het FACS-instrument en de computer in en open de FACS-software om het FACS-instrument uit te voeren en te bedienen. Voer routinematige kwaliteitscontroletests uit. Laad de controlevlekmonsters in het FACS-instrument om de assen aan te passen.Begin met IgG-antilichaam alleen cellen om voorwaartse verstrooiing en zijverstrooiing te genereren en aan te passen. Dan CD31 antilichaam alleen om CD31 te genereren en aan te passen. En dan CD45-antilichaam alleen om CD45 te genereren en aan te passen.Noteer de gegevens van de controlemonsters. Laad vervolgens de gekleurde monstercellen in het FACS-instrument en voer het monster uit. Loop de cellen op basis van forward scatter of FSC en side scatter of SSC parameters.Loopcellen van FSCA en FSCH om celdubbelen te identificeren en alleen enkele cellen te verzamelen. Loopcellen door PI en SSCA om levensvatbare cellen te identificeren. Maak een CD31+CD45-gang met bedieningselementen Maak een CD31+CD45-gang met bedieningselementen en loop de cellen van CD31 en CD45.Steek een opvangbuis met 250 microliter FACS-buffer in het instrument. Begin vervolgens met het sorteren van cellen die CD31 + CD45-zijn in de geïnstalleerde verzamelbuis. Bewaar de verzamelbuizen op ijs voor verdere analyse.De monsters kunnen worden verwerkt voor sequencingtoepassingen van de volgende generatie. In de studie beïnvloedde het variëren van de verteringstijd de celopbrengst en het levensvatbaarheidspercentage. De verteringstijd van 20 minuten resulteerde in een optimale opbrengst met een laag percentage niet-levensvatbare endotheelcellen.Latere propidiumjodidekleuring toonde aan dat de geïsoleerde endotheelcellen levensvatbaar bleven gedurende 60 minuten na isolatie. De zuiverheid van de celpopulatie werd beoordeeld door kwantitatieve PCR- of qPCRR-analyse van de expressie van endotheelcelgenen die een sterke verrijking voor endotheelcelgenen in de CD31+CD45-populatie vertonen. RNA zuiveren uit de geïsoleerde endotheelcellen die cDNA omzetten en versterken door bibliotheekvoorbereiding en sequencing De cDNA-bibliotheek resulteerde in meer dan 16.000 genen geïdentificeerd in negen onafhankelijke monsters.Een daling van transcripten per miljoen reads of TPM werd waargenomen in genen onder deze drempel. De single cell RNA sequencing van de geïsoleerde retinale endotheelcellen door de 10x Genomics pijplijn resulteerde in een mediaan van 1.171 genen per cel, 15.247 totale gedetecteerde genen en een mediaan van 2.255 unieke moleculaire identifier of UMI-tellingen per cel in 917 cellen. De kritieke stappen in dit protocol zijn retinale weefselisolatie en weefselvertering, die nauwkeurig moeten worden uitgevoerd zoals beschreven om de celopbrengst en levensvatbaarheid te optimaliseren.De geïsoleerde endotheelcellen kunnen worden gebruikt in geavanceerde sequencingtechnieken zoals whole-transcriptome RNA sequencing, single cell RNA sequencing, chromatine immunoprecipitation sequencing en assay voor transposase-accessible chromatine sequencing. Het gebruik van deze geoptimaliseerde methode in combinatie met next-generation sequencingmethoden en computationele benaderingen kan de mechanismen van onderling verbonden signaalroutes die vasculaire ontwikkelingen reguleren verder ophelderen.

Research

JoVE Journal

Developmental Biology

Efficient Derivation of Retinal Pigment Epithelium Cells from Stem Cells

Efficiënte Afleiding van retinale pigment epitheel cellen uit stamcellen

No cure has been discovered for age-related macular degeneration  (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex ...

Murine Dermal Fibroblast Isolation by FACS

Muizen Dermaal Fibroblast Isolation door FACS

Fibroblasts are the principle cell type responsible for secreting extracellular matrix and are a critical component of many organs and tissues. Fibroblast ...

Isolation of Murine Embryonic Hemogenic Endothelial Cells

Isolatie van muizen embryonale Hemogenic endotheelcellen

The specification of hemogenic endothelial cells from embryonic vascular endothelium occurs during brief developmental periods within distinct tissues, ...

Isolation of Endothelial Progenitor Cells from Human Umbilical Cord Blood

Isolatie van endotheliale voorlopercellen van menselijke navelstrengbloed

The existence of endothelial progenitor cells (EPCs) in peripheral blood and its involvement in vasculogenesis was first reported by Ashara and ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

Snelle, gerichte differentiatie van de epitheliale cellen van de retinale Pigment van menselijke embryonale of geïnduceerde pluripotente stamcellen

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In Vitro generatie van Somiet derivaten uit menselijk geïnduceerde pluripotente stamcellen-cellen

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Multiplexed Single Cell mRNA Sequencing Analysis of Mouse Embryonic Cells

Multiplexed single cell mRNA sequentieanalyse van embryonale cellen van de muis

Single cell mRNA sequencing has made significant progress in the last several years and has become an important tool in the field of developmental ...

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

Voorbereiding van kleine RNA-bibliotheken voor sequencing van vroege muisembryo's

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...

Isolation of Endocardial and Coronary Endothelial Cells from the Ventricular Free Wall of the Rat Heart

Isolatie van endocardiale en coronaire endotheelcellen van de Ventriculaire Vrije Muur van het Hart van de Rat

It has been shown that endocardial endothelial cells (EECs) and coronary endothelial cells (CECs) differ in origin, development, markers, and functions. ...

Isolation of Murine Spermatogenic Cells using a Violet-Excited Cell-Permeable DNA Binding Dye

Isolatie van Murine Spermatogenic Cellen met behulp van een Violet-Excited Cell-Permeable DNA Binding Dye

Isolation of meiotic spermatocytes is essential to investigate molecular mechanisms underlying meiosis and spermatogenesis. Although there are established ...