Name: isolation of murine retinal endothelial cells for next-generation sequencing
Uploaded: 2021-10-11T13:00:00
Description: Watch this Scientific Journal Video about Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing at JoVE.com

Yale Flow Cytometry Facility, University of Virginia Flow Cytometry Core Facility, Yale Center for Genomic Analysis 및 University of Virginia Genome Analysis and Technology Core에 감사드립니다. 이 연구는 NUC (T32 HL007224, T32 HL007284), SC (T32 HL007284), KW (R01 HL142650) 및 K.K.H. (R01 HL146056, R01 DK118728, UH3 EB025765)에 대한 NIH 보조금으로 자금을 지원받았습니다.

예일 대학교와 버지니아 대학교의 기관 동물 관리 및 사용위원회는이 프로토콜에 나열된 모든 동물 실험을 승인했습니다.
1. 망막 분리를 위한 마우스 눈 획득
<ol><li>1x 얼음처럼 차가운 PBS를 준비하고 48웰 플레이트의 각 웰에 500μL를 추가합니다.</li>
	<li>승인된 기관 지침에 따라 출생 후 6일(P6)에 신생아 마우스를 안락사시킵니다. 이 실험을 위해, 약 4-8 신생아 ?...

<ol>
	<li>Slatko, B. E., Gardner, A. F., Ausubel, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview+of+next-generation+sequencing+technologies.">Overview of next-generation sequencing technologies.</a> Current Protocols in Molecular Biology. 122 (1), 59 (2018).</li><li>Chavkin, N. W., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+cell+analysis+in+vascular+biology.">Single cell analysis in vascular biology.</a> Frontiers in Cardiovascular Medicine. 7, 42 (2020).</li><li>Ma, F., Hernandez, G. E., Romay, M., Iruela-Arispe, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+RNA+sequencing+to+study+vascular+diversity+and+function.">Single-cell RNA sequencing to study vascular diversity and function.</a> Current Opinion in Hematology. 28 (3), 221-229 (2021).</li><li>Potter, A. S., Potter, S. S., S, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissociation+of+tissues+for+single-cell+analysis.">Dissociation of tissues for single-cell analysis.</a> Methods in Molecular Biology. 1926, 55-62 (2019).</li><li>Braga, F. A. V., Miragaia, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+handling+and+dissociation+for+single-cell+RNA-seq.">Tissue handling and dissociation for single-cell RNA-seq.</a> Single Cell Methods: Methods in Molecular Biology. 1979, 9-21 (2019).</li><li>Brink, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+sequencing+reveals+dissociatin-induced+gene+expression+in+tissue+subpopulations.">Single-cell sequencing reveals dissociatin-induced gene expression in tissue subpopulations.</a> Nature Methods. 14 (10), 935-936 (2017).</li><li>Skulska, K., Wegrzyn, A. S., Chelmonska-Soyta, A., Chodaczek, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+tissue+enzymatic+digestion+on+analysis+of+immune+cells+in+mouse+reproductive+mucosa+with+a+focus+on+gammadelta+T+cells.">Impact of tissue enzymatic digestion on analysis of immune cells in mouse reproductive mucosa with a focus on gammadelta T cells.</a> Journal of Immunological Methods. 474, 112665 (2019).</li><li>Connolly, S., Hores, T., Smith, L., D'Amore, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+vascular+development+in+the+mouse+retina.">Characterization of vascular development in the mouse retina.</a> Microvascular Research. 36 (3), 275-290 (1988).</li><li>Crist, A., Young, C., Meadows, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+arteriovenous+identity+in+the+developing+neonate+mouse+retina.">Characterization of arteriovenous identity in the developing neonate mouse retina.</a> Gene Expression Patterns: GEP. 23-24, 22-31 (2017).</li><li>dela Paz, N. G., D'Amore, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterial+versus+venous+endothelial+cells.">Arterial versus venous endothelial cells.</a> Cell and Tissue Research. 335 (1), 5-16 (2009).</li><li>Fang, J. S., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+regulation+of+arteriovenous+endothelial+cell+specification.">Molecular regulation of arteriovenous endothelial cell specification.</a> F1000Res. 8, (2019).</li><li>Smith, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxygen-induced+retinopathy+in+the+mouse.">Oxygen-induced retinopathy in the mouse.</a> Investigative Ophthalmology and Visual Science. 35 (1), 101-111 (1994).</li><li>Pitulescu, M. E., Schmidt, I., Benedito, R., Adams, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+gene+targeting+in+the+neonatal+vasculature+and+analysis+of+retinal+angiogenesis+in+mice.">Inducible gene targeting in the neonatal vasculature and analysis of retinal angiogenesis in mice.</a> Nature Protocols. 5 (9), 1518-1534 (2010).</li><li>Ruiz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+of+hereditary+hemorrhagic+telangiectasia+generated+by+transmammary-delivered+immunoblocking+of+BMP9+and+BMP10.">A mouse model of hereditary hemorrhagic telangiectasia generated by transmammary-delivered immunoblocking of BMP9 and BMP10.</a> Scientific Reports. 6, 37366 (2016).</li><li>Fang, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shear-induced+Notch-Cx37-p27+axis+arrests+endothelial+cell+cycle+to+enable+arterial+specification.">Shear-induced Notch-Cx37-p27 axis arrests endothelial cell cycle to enable arterial specification.</a> Nature Communication. 8 (1), 2149 (2017).</li><li>Ola, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMAD4+prevents+flow+induced+arterial-venous+malformations+by+inhibiting+Casein+Kinase+2.">SMAD4 prevents flow induced arterial-venous malformations by inhibiting Casein Kinase 2.</a> Circulation. 138 (21), 2379-2394 (2018).</li><li>Chavkin, N. W., Walsh, K., Hirschi, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+highly+purified+and+viable+retinal+endothelial+cells.">Isolation of highly purified and viable retinal endothelial cells.</a> Journal of Vascular Research. 58 (1), 49-57 (2020).</li><li>Hulspas, R., O'Gorman, M. R. G., Wood, B. L., Gratama, J. W., Sutherland, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Considerations+for+the+control+of+background+fluorescence+in+clinical+flow+cytometry.">Considerations for the control of background fluorescence in clinical flow cytometry.</a> Cytometry PartB: Clinical Cytometry. 76 (6), 355-364 (2009).</li><li>Bachman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse-transcription+PCR+(RT-PCR).">Reverse-transcription PCR (RT-PCR).</a> Methods in Enzymology. 530, 67-74 (2013).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+RNA+by+real-time+Reverse+Transcription-Polymerase+Chain+Reaction+(RT-PCR).">Quantification of RNA by real-time Reverse Transcription-Polymerase Chain Reaction (RT-PCR).</a> Cold Spring Harbour Protocols. 2018 (10), (2018).</li><li>Liu, L., Shi, G. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD31:+beyond+a+marker+for+endothelial+cells.">CD31: beyond a marker for endothelial cells.</a> Cardiovascular Research. 94 (1), 3-5 (2012).</li><li>Zarkada, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specialized+endothelial+tip+cells+guide+neuroretina+vascularization+and+blood-retina-barrier+formation.">Specialized endothelial tip cells guide neuroretina vascularization and blood-retina-barrier formation.</a> Developmental Cell. 56 (15), 2237-2251 (2021).</li><li>Su, X., Sorenson, C. M., Sheibani, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+murine+retinal+endothelial+cells.">Isolation and characterization of murine retinal endothelial cells.</a> Molecular Vision. 9, 171-178 (2003).</li><li>Benedito, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+notch+ligands+Dll4+and+Jagged1+have+opposing+effects+on+angiogenesis.">The notch ligands Dll4 and Jagged1 have opposing effects on angiogenesis.</a> Cell. 137 (6), 1124-1135 (2009).</li><li>Daneman, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt/beta-catenin+signaling+is+required+for+CNS,+but+not+non-CNS,+angiogenesis.">Wnt/beta-catenin signaling is required for CNS, but not non-CNS, angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (2), 641-646 (2009).</li><li>Okabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurons+limit+angiogenesis+by+titrating+VEGF+in+retina.">Neurons limit angiogenesis by titrating VEGF in retina.</a> Cell. 159 (3), 584-596 (2014).</li><li>Crist, A. M., Lee, A. R., Patel, N. R., Westhoff, D. E., Meadows, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vascular+deficiency+of+Smad4+causes+arteriovenous+malformations:+a+mouse+model+of+Hereditary+Hemorrhagic+Telangiectasia.">Vascular deficiency of Smad4 causes arteriovenous malformations: a mouse model of Hereditary Hemorrhagic Telangiectasia.</a> Angiogenesis. 21 (2), 363-380 (2018).</li><li>Kim, Y. H., Choe, S. W., Chae, M. Y., Hong, S., Oh, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SMAD4+deficiency+leads+to+development+of+arteriovenous+malformations+in+neonatal+and+adult+mice.">SMAD4 deficiency leads to development of arteriovenous malformations in neonatal and adult mice.</a> Journal of the American Heart Association. 7 (21), 009514 (2018).</li><li>Ma, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absence+of+TGFbeta+signaling+in+retinal+microglia+induces+retinal+degeneration+and+exacerbates+choroidal+neovascularization.">Absence of TGFbeta signaling in retinal microglia induces retinal degeneration and exacerbates choroidal neovascularization.</a> eLife. 8, 42049 (2019).</li><li>Luo, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterialization+requires+the+timely+suppression+of+cell+growth.">Arterialization requires the timely suppression of cell growth.</a> Nature. 589 (7842), 437-441 (2021).</li><li>Lawson, N. D., Vogel, A. M., Weinstein, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=sonic+hedgehog+and+vascular+endothelial+growth+factor+act+upstream+of+the+Notch+pathway+during+arterial+endothelial+differentiation.">sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation.</a> Developmental Cell. 3 (1), 127-136 (2002).</li><li>Larrivee, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ALK1+signaling+inhibits+angiogenesis+by+cooperating+with+the+Notch+pathway.">ALK1 signaling inhibits angiogenesis by cooperating with the Notch pathway.</a> Developmental Cell. 22 (3), 489-500 (2012).</li><li>Wythe, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ETS+factors+regulate+Vegf-dependent+arterial+specification.">ETS factors regulate Vegf-dependent arterial specification.</a> Developmental Cell. 26 (1), 45-58 (2013).</li><li>Davis, D. M., Purvis, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+analysis+of+signaling+patterns+in+single+cells.">Computational analysis of signaling patterns in single cells.</a> Seminars in Cell and Developmental Biology. , 35-43 (2015).</li><li>Gaudet, S., Miller-Jensen, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redefining+signaling+pathways+with+an+expanding+single-cell+toolbox.">Redefining signaling pathways with an expanding single-cell toolbox.</a> Trends in Biotechnology. 34 (6), 458-469 (2016).</li><li>Aibar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SCENIC:+single-cell+regulatory+network+inference+and+clustering.">SCENIC: single-cell regulatory network inference and clustering.</a> Nature Methods. 14 (11), 1083-1086 (2017).</li><li>Trapnell, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dynamics+and+regulators+of+cell+fate+decisions+are+revealed+by+pseudotemporal+ordering+of+single+cells.">The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells.</a> Nature Biotechnology. 32 (4), 381-386 (2014).</li></ol>

이 프로토콜은 높은 세포 수, 순도 및 생존력에 최적화된 출생 후 뮤린 망막 조직으로부터 내피 세포를 분리하는 방법을 설명합니다. 세포 순도는 CD31+/CD45-면역염색에 의해 소화된 단일-세포 현탁액으로부터 내피 세포 집단의 FACS 단리에 의해 수득된다. 분리 품질은 트리판 블루 염색에 의한 생존력 분석 및 CD31, CD45 및 VE-카데린에 대한 qPCR에 의한 유전자 발현에 대한 분석에서 정량화됩니다(VE-카?...

차세대 염기서열분석 접근법을 통한 핵산 염기서열분석의 높은 처리량은 분자 및 세포 생물학에 대한 연구자들의 지식을 크게 발전시켰습니다. 이러한 고급 기술에는 전체 전사체 RNA 시퀀싱, 단일 염기 다형성(SNP)을 식별하기 위한 표적 영역의 DNA 시퀀싱, 염색질 면역침전(ChIP) 시퀀싱에서 결합된 전사 인자의 DNA 시퀀싱 또는 트랜스포아제 접근 가능 염색질(ATAC) 시퀀싱을 위한 분석에서 열린 염색질 영역 및 단일 세포 RNA 시퀀싱1이 포함됩니다. . 혈관 생물학에서 이러한 발전으로 연구자들은 다양한 표현형 2,3의 연속체를 따라 유전자 발현 패턴을 구별하는 것과 함께 복잡한 발달 및 질병 메커니즘을 밝힐 수있었습니다. 향후 실험에서는 차세대 염기서열분석과 평가된 혈관 발달 모델을 결합하여 복잡한 메커니즘을 추가로 정의할 수 있지만, 시료 전처리 방법은 고급 염기서열분석 기법과 호환되어야 합니다.
차세대 염기서열분석 접근법의 품질, 정확성 및 재현성은 시료 전처리 방법에 따라 달라집니다. 세포의 하위 집합을 분리하거나 조직에서 단일 세포 현탁액을 생성할 때세포 집단의 세포 수, 생존력 및 순도를 최대화하기 위해서는 최적의 분해 및 정제 방법이 필수적입니다4,5. 이것은 소화 방법의 균형을 필요로합니다 : 조직에서 세포를 방출하고 다운 스트림 접근을위한 충분한 세포를 얻으려면 강한 소화가 필요하지만 소화가 너무 강하면 세포 생존율에 부정적인 영향을 미칩니다 6,7. 또한 FACS를 통해 달성할 수 있는 강력한 결과와 정확한 데이터 분석을 위해서는 세포 집단의 순도가 필요합니다. 이는 확립된 혈관 발달 모델에 차세대 염기서열분석을 적용하기 위해 세포 분리 방법을 최적화하는 것의 중요성을 강조합니다.
혈관 발달을 조사하기위한 잘 특성화 된 모델은 쥐 망막 혈관 발달 모델입니다. 뮤린 망막 혈관 구조는 출생 후 2 차원 표면 신경총에서 발생하며, 출생 후 일 (P) 3에 보이는 시신경에서 초기 혈관 신생 싹이 트고, 줄기 및 팁 세포가있는 혈관 신생 전선과 P6에서 볼 수있는 초기 혈관 성숙, P9 8,9 이후에 볼 수있는 혈관 신경총의 성숙. 초기 혈관 신경총의 리모델링 동안, 내피 세포는 순환 네트워크(10,11)를 생성하기 위해 상이한 혈관에서 동맥, 모세 혈관 및 정맥 표현형에 대한 사양을 거친다. 따라서, 이 방법을 통해연구자들은 발달 중 다양한 시점에서 혈관신생 혈관 신경총 형성 및 내피 동맥-정맥 사양 및 성숙을 시각화할 수 있습니다9. 또한, 이 모델은 혈관 발달, 동맥-정맥 기형 및 산소 유도 신생혈관의 조사에 적용된 혈관신생 및 혈관 신경총 발달에 대한 형질전환 조작의 효과를 조사하는 방법을 제공합니다 12,13,14,15,16 . 차세대 염기서열분석 접근법과 쥐 망막 혈관 개발 모델을 결합하려면 망막 조직에서 내피 세포를 분리하기 위한 최적화된 프로토콜이 필요합니다.
이 프로토콜은 P6에서 마우스의 망막 조직을 소화하여 세포 수율, 순도 및 생존력을 극대화하는 최적화된 방법을 설명합니다. 망막 조직을 P6 마우스로부터 분리하고, 20분 동안 소화시키고, CD31 및 CD45에 대해 면역염색하고, FACS를 통해 정제하여 약 2.5시간 내에 내피 세포의 단일 세포 현탁액을 분리한다(도 1A). 이러한 내피 세포는 분리 후 60분 동안 높은 생존력을 유지하는 것으로 밝혀졌으며17, 차세대 시퀀싱 방법을 위한 라이브러리 준비를 가능하게 합니다. 또한 FACS 게이팅 및 품질 관리 결과에 대한 대표 결과가 이 분리 프로토콜을 사용하는 두 가지 개별 차세대 시퀀싱 방법인 전체 전사체 RNA 시퀀싱 및 단일 세포 RNA 시퀀싱에서 제공됩니다. 이 방법을 사용하면 망막 혈관 형성 모델과 함께 차세대 시퀀싱 접근법을 사용하여 혈관 발달의 새로운 메커니즘을 밝힐 수 있습니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2 mL Eppendorf&#160;safe-lock tubes</td>
			<td>USA Scientific</td>
			<td>4036-3352</td>
			<td></td>
		</tr>
		<tr>
			<td>5 ml Falcon Test Tubes with Cell Strainer Snap Cap</td>
			<td>Corning</td>
			<td>352235</td>
			<td></td>
		</tr>
		<tr>
			<td>60 mm Non TC-treated Culture Dish</td>
			<td>Corning</td>
			<td>430589</td>
			<td></td>
		</tr>
		<tr>
			<td>APC Rat Anti-Mouse CD31</td>
			<td>BD Biosciences</td>
			<td>551262</td>
			<td></td>
		</tr>
		<tr>
			<td>APC Rat IgG2a &#954; Isotype Control</td>
			<td>BD Biosciences</td>
			<td>553932</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSChorus Software</td>
			<td>BD Biosciences</td>
			<td>FACSCHORUS</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSMelody Cell Sorter</td>
			<td>BD Biosciences</td>
			<td>FACSMELODY</td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase Type II</td>
			<td>Sigma-Aldrich</td>
			<td>234115</td>
			<td></td>
		</tr>
		<tr>
			<td>Costar 48-well Clear TC-treated Multiple Well Plates, Individually Wrapped, Sterile</td>
			<td>Corning</td>
			<td>3548</td>
			<td></td>
		</tr>
		<tr>
			<td>D-Glucose</td>
			<td>Gibco</td>
			<td>A2494001</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Graduated Transfer Pipettes</td>
			<td>Fisher Scientific</td>
			<td>12-711-9AM</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissecting Pan Wax</td>
			<td>Carolina</td>
			<td>629100</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection scissors</td>
			<td>Fine Science Tools</td>
			<td>14085-08</td>
			<td></td>
		</tr>
		<tr>
			<td>Dissection Stereo Microscope M165 FC</td>
			<td>Leica</td>
			<td>M165FC</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Gibco</td>
			<td>11965-052</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Phosphate Buffered Saline (PBS)</td>
			<td>Gibco</td>
			<td>14190144</td>
			<td></td>
		</tr>
		<tr>
			<td>Eppendorf&#160;Flex-Tubes Microcentrifuge Tubes 1.5 mL</td>
			<td>Sigma-Aldrich</td>
			<td>22364120</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Gemini Bio</td>
			<td>100-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Fine dissection forceps</td>
			<td>Fine Science Tools</td>
			<td>11250-00</td>
			<td></td>
		</tr>
		<tr>
			<td>Hank&#39;s Buffered Salt Solution (HBSS)</td>
			<td>Gibco</td>
			<td>14175095</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES (1M)</td>
			<td>Gibco</td>
			<td>15630130</td>
			<td></td>
		</tr>
		<tr>
			<td>iScript cDNA Synthesis Kit</td>
			<td>Bio-Rad</td>
			<td>1708890</td>
			<td></td>
		</tr>
		<tr>
			<td>Isoflurane, USP</td>
			<td>Covetrus</td>
			<td>11695067772</td>
			<td></td>
		</tr>
		<tr>
			<td>Isotemp General Purpose Deluxe Water Bath</td>
			<td>Fisher Scientific</td>
			<td>FSGPD20</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: ActB_Forward: 5&#8217;- agagggaaatcgtgcgtgac -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: ActB_Reverse: 5&#8217;- caatagtgatgacctggccgt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD31_Forward: 5&#8217;- gagcccaatcacgtttcagttt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD31_Reverse: 5&#8217;- tccttcctgcttcttgctagct -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD45_Forward: 5&#8217;- gggttgttctgtgccttgtt -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: CD45_Reverse: 5&#8217;- ctggacggacacagttagca -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: VE-Cadherin_Forward: 5&#8217;- tcctctgcatcctcactatcaca -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: VE-Cadherin_Reverse: 5&#8217;- gtaagtgaccaactgctcgtgaat -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium iodide</td>
			<td>Sigma-Aldrich</td>
			<td>P4864</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Plus Mini Kit</td>
			<td>Qiagen</td>
			<td>74134</td>
			<td></td>
		</tr>
		<tr>
			<td>Sorvall Legend Micro 21R Centrifuge, Refrigerated</td>
			<td>ThermoFisher</td>
			<td>75002477</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR-Green iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>172-5120</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution</td>
			<td>ThermoFisher</td>
			<td>15250061</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Rat Anti-Mouse CD45</td>
			<td>BD Biosciences</td>
			<td>560501</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Rat IgG2b, &#954; Isotype Control</td>
			<td>BD Biosciences</td>
			<td>560457</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of murine retinal endothelial cells for next-generation sequencing

차세대 시퀀싱의 최근 개선은 분자 및 세포 생물학에 대한 연구자의 지식을 향상 시켰으며 여러 연구에서 혈관 생물학의 새로운 패러다임을 밝혀 냈습니다. 이러한 방법을 혈관 발달 모델에 적용하려면 배아 및 출생 후 조직에서 세포 분리 기술을 최적화해야합니다. 세포 수율, 생존력 및 순도는 모두 차세대 염기서열분석 접근법에서 정확하고 재현 가능한 결과를 얻기 위해 최대여야 합니다. 신생아 마우스 망막 혈관 형성 모델은 연구자들이 혈관 발달 메커니즘을 연구하는 데 사용됩니다. 연구원들은 이 모델을 사용하여 혈관 형성 및 성숙 동안 혈관신생 및 동맥-정맥 운명 사양의 메커니즘을 조사했습니다. 망막 혈관 개발 모델을 연구하기 위해 차세대 시퀀싱 기술을 적용하려면 세포 수율, 생존력 및 순도를 극대화하는 망막 내피 세포의 분리 방법을 최적화해야 합니다. 이 프로토콜은 형광 활성화 세포 분류 (FACS)를 사용하여 쥐 망막 조직 분리, 소화 및 정제하는 방법을 설명합니다. 상기 결과는 FACS-정제된 CD31+/CD45-내피 세포 집단이 내피 세포 유전자 발현에 대해 고도로 농축되고, FACS 후 60분 동안 생존력의 변화를 나타내지 않음을 나타낸다. 여기에는 벌크 RNA 시퀀싱 및 단일 세포 RNA 시퀀싱을 포함하여 이 방법을 사용하여 분리된 내피 세포에 대한 차세대 시퀀싱 접근법의 대표적인 결과가 포함되어 망막 내피 세포 분리를 위한 이 방법이 차세대 시퀀싱 애플리케이션과 호환됨을 보여줍니다. 이 망막 내피 세포 분리 방법은 혈관 발달의 새로운 메커니즘을 밝히는 고급 시퀀싱 기술을 허용합니다.

망막 조직의 소화 및 CD31 및 CD45에 대한 면역염색은 세포, 단일 세포 및 생존력에 대한 게이팅 후 CD31+/CD45-내피 세포의 식별 가능한 집단을 초래합니다(그림 2A). CD45 면역염색은 혈소판 및 일부 백혈구를 포함하는 CD31+/CD45+ 세포를 제거하는 데 필요합니다21. 항체 특이성을 보여주고 게이팅 전략을 안내하기 위해 각 실험에 대해 대조군을 수행해야 합니다(<stro...

Watch this Scientific Journal Video about Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing at JoVE.com

Isolation of Murine Retinal Endothelial Cells for Next-Generation Sequencing

이 프로토콜은 세포 수율, 순도 및 생존성에 최적화된 뮤린 출생후 망막 내피 세포의 단리를 위한 방법을 설명한다. 이 세포는 차세대 시퀀싱 접근법에 적합합니다.

차세대 염기서열분석을 위한 뮤린 망막 내피 세포의 분리

Recent improvements in next-generation sequencing have advanced researchers&#39; knowledge of molecular and cellular biology, with several studies ...

이 망막 내피 세포 분리 방법은 혈관 발달의 새로운 메커니즘을 밝히는 고급 시퀀싱 기술을 허용합니다. 설명된 프로토콜은 차세대 시퀀싱 애플리케이션에 필수적인 높은 수준의 생존력과 순도에 최적화되어 있습니다. 이 절차를 시연하는 것은 허쉬 연구소의 대학원생 인 셸비 케인 (Shelby Cain)이 될 것입니다.해부 가위를 사용하여 눈꺼풀에 수직으로 절개하여 눈 위의 피부와 막을 절단하여 안락사 된 신생아 마우스에서 눈을 제거하기 시작합니다. 그런 다음 집게를 사용하여 눈 위와 아래를 눌러 눈이 소켓에서 나오도록합니다. 집게로 눈 아래를 조심스럽게 꼬집고 눈을 붙인 시신경을 자릅니다.그런 다음 수확이 끝날 때까지 새로 준비된 얼음처럼 차가운 PBS의 48 웰 플레이트의 웰에 마우스의 두 눈을 놓습니다. 마우스 망막 조직을 분리하려면 넓은 팁이 있는 전사 파이프 패드를 사용하여 500마이크로리터의 얼음처럼 차가운 PBS로 채워진 페트리 접시에 해부 패드에 눈을 매달아 놓습니다. 해부 현미경으로 작업하면서 하나의 미세한 집게로 시신경을 잡고 두 번째 집게를 사용하여 각막과 공막이 연결되는 눈의 전방을 통해 구멍을 뚫습니다.그런 다음 각막 주위의 약 75 %를 원으로 구멍을 뚫습니다. 하나의 집게로 시신경을 잡고 두 번째 집게를 사용하여 망막 조직에서 공막과 유리체를 부드럽게 찢습니다. 수정체와 히알로이드 신경총 혈관을 제거하려면 거의 닿을 때까지 열린 집게로 망막에 도달 한 다음 집게를 닫아 렌즈와 히알로이드 신경총 혈관을 망막에서 잡아 당깁니다.모든 혈관이 제거되면 망막을 500 마이크로 리터의 얼음처럼 차가운 PBS 1 개로 채워진 2 밀리리터 마이크로 원심 분리 튜브에 넣습니다. 피펫으로 2 밀리리터 마이크로 원심 분리 튜브에서 과도한 PBS를 제거하여 튜브에 약 100 마이크로 리터의 PBS를 남겨 망막 조직을 완전히 덮습니다. 그런 다음 500 마이크로 리터의 새로 준비된 소화 용액을 튜브에 첨가하십시오.P1000 피펫타와 피펫 팁을 사용하여 분해 용액의 망막 조직을 위아래로 5회 피펫팅합니다. 완료되면 소화 혼합물을 섭씨 37도의 수조에서 20분 동안 배양하고 앞서 설명한 대로 소화 혼합물을 5분마다 위아래로 피펫팅합니다. 배양 후 망막 조직은 단일 세포 현탁액으로 용해되어 소화 혼합물을 흐리게 만듭니다.다음에, 세포를 섭씨 4도에서 5분 동안 375g에서 원심분리하여 펠렛화한다. 원심분리 후, 세척된 세포 펠렛으로부터 PBS를 피펫팅으로 제거한 다음, 펠렛을 100 마이크로리터의 항체 염색 용액에 재현탁시켜 세포를 면역염색한 후 6번째 세포에 10회 당한다. 단일 세포 현탁액을 항체 염색 용액과 함께 10분마다 튜브를 두드리면서 어두운 얼음 위에서 30분 동안 배양하여 세포를 부드럽게 혼합합니다.형광 활성화 세포 분류를 위해, 섭씨 4도에서 5분 동안 375g에서 원심분리하여 세포를 펠릿화한다. 상청액을 제거한 후, 세포를 이전에 기재된 바와 같이 500 마이크로리터의 PBS로 세척하고 펠렛화한다. 이어서 세포를 300 마이크로리터의 형광-활성화 세포 분류 또는 FACS 완충액에 재현탁시킨 후 피펫타와 부드럽게 혼합한다.다음으로, FACS 버퍼가 포함 된 샘플 튜브에 생존력 마커로 요오드화 프로피듐 또는 PI를 추가하여 밀리리터 당 0.5 마이크로 그램의 최종 농도를 얻습니다. 피펫을 사용하여 35미크론 필터가 포함된 세포 여과기 스냅 캡을 통해 세포 현탁액을 5밀리리터 시험관으로 옮깁니다. 여과 후 FACS 튜브를 어두운 곳의 얼음 위에 보관한 다음 튜브를 세포 분류기로 옮깁니다.FACS 기기와 컴퓨터를 켜고 FACS 소프트웨어를 열어 FACS 기기를 실행하고 작동합니다. 일상적인 품질 관리 테스트를 수행합니다. 제어 얼룩 샘플을 FACS 기기에 로드하여 축을 조정합니다.IgG 항체 전용 세포로 시작하여 전방 산란 및 측면 산란을 생성하고 조정합니다. 이어서 CD31 항체만 생성하고 CD31을 조정한다. 이어서 CD45 항체만을 생성하고 CD45를 조정한다.대조 샘플의 데이터를 기록합니다. 다음으로, 염색된 샘플 셀을 FACS 기기에 로드하고 샘플을 실행합니다. 전방 산란 또는 FSC 및 측면 산란 또는 SSC 매개 변수를 기반으로 세포를 보행시킵니다.FSCA 및 FSCH에 의한 보행 세포는 세포 이중선을 식별하고 단일 세포만 수집합니다. 생존 가능한 세포를 확인하기 위해 PI 및 SSCA에 의한 보행 세포. 대조군으로 CD31+CD45 보행 만들기 대조군으로 CD31+CD45-보행을 만들고 CD31 및 CD45로 세포를 보행시킵니다.기기에 250마이크로리터의 FACS 버퍼가 있는 수집 튜브를 삽입합니다. 다음으로, 설치된 수집 튜브에 CD31+CD45인 세포 분류를 시작합니다. 추가 분석을 위해 수집 튜브를 얼음 위에 보관하십시오.샘플은 차세대 염기서열분석 어플리케이션을 위해 처리될 수 있습니다. 이 연구에서 소화 시간을 변화시키는 것은 세포 수율과 생존율에 영향을 미쳤습니다. 20분의 소화 시간은 생존할 수 없는 내피 세포의 낮은 비율로 최적의 수율을 가져왔습니다.후속 프로피듐 요오드화물 염색은 단리된 내피 세포가 단리 후 60분 동안 생존 가능한 상태를 유지했음을 입증했습니다. 세포 집단 순도는 CD31+CD45-집단에서 내피 세포 유전자에 대해 강한 농축을 나타내는 내피 세포 유전자의 발현에 대한 정량적 PCR 또는 qPCRR 분석에 의해 평가되었습니다. 라이브러리 준비 및 시퀀싱을 통해 cDNA를 변환 및 증폭하는 분리된 내피 세포로부터 RNA 정제 cDNA 라이브러리는 9개의 독립적인 샘플에서 16, 000개 이상의 유전자를 확인하였다.백만 읽기 또는 TPM당 전사체의 감소가 이 임계값 미만의 유전자에서 관찰되었습니다. 10x Genomics 파이프 라인을 통해 분리 된 망막 내피 세포의 단일 세포 RNA 시퀀싱은 세포 당 1, 171 개의 유전자, 15, 247 개의 총 유전자가 검출되고 917 개의 세포에서 세포 당 2, 255 개의 고유 분자 식별자 또는 UMI 수의 중앙값을 산출했습니다. 이 프로토콜의 중요한 단계는 망막 조직 분리 및 조직 소화이며, 세포 수율과 생존력을 최적화하기 위해 설명된 대로 정확하게 수행되어야 합니다.분리된 내피 세포는 전체 전사체 RNA 시퀀싱, 단일 세포 RNA 시퀀싱, 염색질 면역침전 시퀀싱 및 트랜스포아제 접근 가능한 염색질 시퀀싱을 위한 분석과 같은 고급 시퀀싱 기술에 사용할 수 있습니다. 이 최적화된 분석법을 차세대 염기서열분석 방법 및 전산적 접근법과 함께 사용하면 혈관 발달을 조절하는 상호 연결된 신호 경로의 메커니즘을 더욱 해명할 수 있습니다.

Research

JoVE Journal

Developmental Biology

Efficient Derivation of Retinal Pigment Epithelium Cells from Stem Cells

줄기 세포에서 망막 색소 상피 세포의 효율적인 유도

No cure has been discovered for age-related macular degeneration  (AMD), the leading cause of vision loss in people over the age of 55. AMD is complex ...

연구

발생학

Murine Dermal Fibroblast Isolation by FACS

FACS에 의해 쥐 피부 섬유 아세포 격리

Fibroblasts are the principle cell type responsible for secreting extracellular matrix and are a critical component of many organs and tissues. Fibroblast ...

Isolation of Murine Embryonic Hemogenic Endothelial Cells

쥐 배아 Hemogenic 내피 세포의 분리

The specification of hemogenic endothelial cells from embryonic vascular endothelium occurs during brief developmental periods within distinct tissues, ...

Isolation of Endothelial Progenitor Cells from Human Umbilical Cord Blood

인간 탯 줄 혈액에서 내 피 조상 세포의 고립

The existence of endothelial progenitor cells (EPCs) in peripheral blood and its involvement in vasculogenesis was first reported by Ashara and ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

인간의 배아 또는 유도 만능 줄기 세포에서 망막 안료 상피 세포의 급속 한, 감독 차별화

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

인간 유도에서 Somite 파생 상품의 체 외 발생에서 만능 줄기 세포

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Multiplexed Single Cell mRNA Sequencing Analysis of Mouse Embryonic Cells

마우스 배아 세포의 다중화 단세포 mRNA 염기서열 분석

Single cell mRNA sequencing has made significant progress in the last several years and has become an important tool in the field of developmental ...

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

초기 마우스 배아에서 시퀀싱을 위한 작은 RNA 라이브러리 의 준비

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...

Isolation of Endocardial and Coronary Endothelial Cells from the Ventricular Free Wall of the Rat Heart

쥐 심장의 심실 무료 벽에서 내심 내피 및 관상 내피 세포의 격리

It has been shown that endocardial endothelial cells (EECs) and coronary endothelial cells (CECs) differ in origin, development, markers, and functions. ...

Isolation of Murine Spermatogenic Cells using a Violet-Excited Cell-Permeable DNA Binding Dye

보라색 흥분 세포 투과성 DNA 결합 염료를 사용하여 뮤린 정자 세포의 격리

Isolation of meiotic spermatocytes is essential to investigate molecular mechanisms underlying meiosis and spermatogenesis. Although there are established ...