Name: a reporter assay to analyze intronic microrna maturation in mammalian cells
Uploaded: 2022-06-16T12:50:00
Description: Watch this Scientific Journal Video about A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells at JoVE.com

저자들은 HeLa-Cre 세포와 pRD-RIPE 및 pCAGGS-Cre 플라스미드에 대한 E. Makeyev (싱가포르 난양 기술 대학)에게 감사하고 있습니다. Edna Kimura, Carolina Purcell Goes, Gisela Ramos, Lucia Rossetti Lopes 및 Anselmo Moriscot의 지원에 감사드립니다.

여기에 설명된 프로토콜의 개요는 그림 1에 설명되어 있습니다.
1. 플라스미드 구성
<ol><li>pCAGGS-Cre: 이 플라스미드는 E. Makeyev박사 21에 의해 제공되었다.</li>
	<li>pRD-miR-17-92:<ol><li>0.5 μM의 각 특정 프라이머 (표 물질), 150 ng의 cDNA, 1 mM dNTPs, 1x Taq PCR 버퍼 및 5 U의 고충실도 Taq DNA 중합효소를 사용하여 PCR에 의해 pre-m...

<ol>
	<li>Wilkinson, M. E., Charenton, C., Nagai, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+splicing+by+the+spliceosome.">RNA splicing by the spliceosome.</a> Annual Review of Biochemistry. 89, 359-388 (2020).</li><li>Will, C. L., Luhrmann, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spliceosome+structure+and+function.">Spliceosome structure and function.</a> Cold Spring Harbor Perspectives in Biology. 3 (7), 003707 (2011).</li><li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+structure+of+the+human+spliceosome.">An atomic structure of the human spliceosome.</a> Cell. 169 (5), 918-929 (2017).</li><li>Staley, J. P., Guthrie, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+devices+of+the+spliceosome:+Motors,+clocks,+springs,+and+things.">Mechanical devices of the spliceosome: Motors, clocks, springs, and things.</a> Cell. 92 (3), 315-326 (1998).</li><li>Kornblihtt, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+splicing:+a+pivotal+step+between+eukaryotic+transcription+and+translation.">Alternative splicing: a pivotal step between eukaryotic transcription and translation.</a> Nature Reviews Molecular Cell Biology. 14 (3), 153-165 (2013).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complex+network+of+factors+with+overlapping+affinities+represses+splicing+through+intronic+elements.">A complex network of factors with overlapping affinities represses splicing through intronic elements.</a> Nature Structural &amp; Molecular Biology. 20 (1), 36-45 (2013).</li><li>Mukherjee, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+regulatory+mapping+indicates+that+the+RNA-binding+protein+HuR+couples+pre-mRNA+processing+and+mRNA+stability.">Integrative regulatory mapping indicates that the RNA-binding protein HuR couples pre-mRNA processing and mRNA stability.</a> Molecular Cell. 43 (3), 327-339 (2011).</li><li>Pandit, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+reveals+SR+protein+cooperation+and+competition+in+regulated+splicing.">Genome-wide analysis reveals SR protein cooperation and competition in regulated splicing.</a> Molecular Cell. 50 (2), 223-235 (2013).</li><li>Gatti da Silva, G. H., Dos Santos, M. G. P., Nagasse, H. Y., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+antigen+R+(HuR)+facilitates+miR-19+synthesis+and+affects+cellular+kinetics+in+papillary+thyroid+cancer.">Human antigen R (HuR) facilitates miR-19 synthesis and affects cellular kinetics in papillary thyroid cancer.</a> Cellular Physiology and Biochemistry. 56, 105-119 (2022).</li><li>Westholm, J. O., Lai, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mirtrons:+MicroRNA+biogenesis+via+splicing.">Mirtrons: MicroRNA biogenesis via splicing.</a> Biochimie. 93 (11), 1897-1904 (2011).</li><li>Michlewski, G., C&#225;ceres, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-transcriptional+control+of+miRNA+biogenesis.">Post-transcriptional control of miRNA biogenesis.</a> RNA. 25 (1), 1-16 (2019).</li><li>Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs:+Target+recognition+and+regulatory+functions.">MicroRNAs: Target recognition and regulatory functions.</a> Cell. 136 (2), 215-233 (2009).</li><li>Esquela-Kerscher, A., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncomirs+-+MicroRNAs+with+a+role+in+cancer.">Oncomirs - MicroRNAs with a role in cancer.</a> Nature Reviews Cancer. 6 (4), 259-269 (2006).</li><li>Lin, S., Gregory, R. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+biogenesis+pathways+in+cancer.">MicroRNA biogenesis pathways in cancer.</a> Nature Reviews Cancer. 15 (6), 321-333 (2015).</li><li>Curtis, H. J., Sibley, C. R., Wood, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mirtrons,+an+emerging+class+of+atypical+miRNA.">Mirtrons, an emerging class of atypical miRNA.</a> Wiley Interdisciplinary Reviews. RNA. 3 (5), 617-632 (2012).</li><li>Alarcon, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HNRNPA2B1+is+a+mediator+of+m(6)A-dependent+nuclear+RNA+processing+events.">HNRNPA2B1 is a mediator of m(6)A-dependent nuclear RNA processing events.</a> Cell. 162 (6), 1299-1308 (2015).</li><li>Paiva, M. M., Kimura, E. T., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miR18a+and+miR19a+recruit+specific+proteins+for+splicing+in+thyroid+cancer+cells.">miR18a and miR19a recruit specific proteins for splicing in thyroid cancer cells.</a> Cancer Genomics and Proteomics. 14 (5), 373-381 (2017).</li><li>He, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microRNA+polycistron+as+a+potential+human+oncogene.">A microRNA polycistron as a potential human oncogene.</a> Nature. 435 (7043), 828-833 (2005).</li><li>Olive, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miR-19+is+a+key+oncogenic+component+of+mir-17-92.">miR-19 is a key oncogenic component of mir-17-92.</a> Genes &amp; Development. 23 (24), 2839-2849 (2009).</li><li>Livak, K. J., Schmittgen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Khandelia, P., Yap, K., Makeyev, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streamlined+platform+for+short+hairpin+RNA+interference+and+transgenesis+in+cultured+mammalian+cells.">Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (31), 12799-12804 (2011).</li><li>Huelga, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genome-wide+analysis+reveals+cooperative+regulation+of+alternative+splicing+by+hnRNP+proteins.">Integrative genome-wide analysis reveals cooperative regulation of alternative splicing by hnRNP proteins.</a> Cell Reports. 1 (2), 167-178 (2012).</li><li>Karni, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gene+encoding+the+splicing+factor+SF2/ASF+is+a+proto-oncogene.">The gene encoding the splicing factor SF2/ASF is a proto-oncogene.</a> Nature Structural &amp; Molecular Biology. 14 (3), 185-193 (2007).</li><li>Franca, G. S., Vibranovski, M. D., Galante, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+gene+constraints+and+genomic+context+impact+the+expression+and+evolution+of+human+microRNAs.">Host gene constraints and genomic context impact the expression and evolution of human microRNAs.</a> Nature Communications. 7, 11438 (2016).</li><li>Havens, M. A., Reich, A. A., Hastings, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosha+promotes+splicing+of+a+pre-microRNA-like+alternative+exon.">Drosha promotes splicing of a pre-microRNA-like alternative exon.</a> PLoS Genetics. 10 (5), 1004312 (2014).</li><li>Grammatikakis, I., Abdelmohsen, K., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+HuR+function.">Posttranslational control of HuR function.</a> Wiley Interdisciplinary Reviews. RNA. 8 (1), (2017).</li><li>Chang, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ELAVL1+regulates+alternative+splicing+of+eIF4E+transporter+to+promote+postnatal+angiogenesis.">ELAVL1 regulates alternative splicing of eIF4E transporter to promote postnatal angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (51), 18309-18314 (2014).</li><li>Huang, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+therapeutics+targeting+the+mRNA-binding+protein+HuR+using+3DNA+nanocarriers+suppresses+ovarian+tumor+growth.">Delivery of therapeutics targeting the mRNA-binding protein HuR using 3DNA nanocarriers suppresses ovarian tumor growth.</a> Cancer Research. 76 (6), 1549-1559 (2016).</li><li>Wang, W., Caldwell, M. C., Lin, S., Furneaux, H., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HuR+regulates+cyclin+A+and+cyclin+B1+mRNA+stability+during+cell+proliferation.">HuR regulates cyclin A and cyclin B1 mRNA stability during cell proliferation.</a> The EMBO Journal. 19 (10), 2340-2350 (2000).</li><li>Guo, X., Connick, M. C., Vanderhoof, J., Ishak, M. A., Hartley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA-16+modulates+HuR+regulation+of+cyclin+E1+in+breast+cancer+cells.">MicroRNA-16 modulates HuR regulation of cyclin E1 in breast cancer cells.</a> International Journal of Molecular Sciences. 16 (4), 7112-7132 (2015).</li></ol>

Pre-mRNA 스플라이싱은 유전자 발현 조절을 위한 중요한 과정이며, 그의 조절은 세포 표현형 변형(22,23)에 강한 효과를 촉발시킬 수 있다. miRNA의 70 % 이상이 인간의 인트론에서 전사되며, 우리는 조절 단백질24,25를 접합함으로써 처리 및 성숙이 촉진 될 수 있다고 가정했습니다. 우리는 배양된 세포에서 인트로닉...

전구체 mRNA 스플라이싱은 진핵생물1에서 유전자 발현 조절을 위한 중요한 과정이다. 성숙한 RNA에서 인트론의 제거와 엑손의 연합은 100개 이상의 단백질 2,3과 함께 5개의 snRNA(U1, U2, U4, U5 및 U6)로 구성된 2메가달톤 리보뉴클레오단백질 복합체인 스플라이시오좀에 의해 촉매된다. 스플라이싱 반응은 공동-전사적으로 발생하고, 스플라이세오좀은 엑손-인트론 경계 및 인트론4 내에서 보존된 스플라이스 부위의 인식에 의해 유도되는 각각의 새로운 인트론에서 조립된다. 다른 인트론은 스플라이 케오솜 복합체와 그 구성 요소의 놀라운 보존에도 불구하고 다른 접합 속도를 가질 수 있습니다. 스플라이스 부위 보존의 차이 외에도, 인트론 및 엑손에 분포된 조절 서열은 RNA 결합 단백질(RBP)을 안내하고 스플라이싱 5,6을 자극하거나 억제할 수 있다. HuR은 유비쿼터스하게 발현된 RBP이며, mRNA 안정성을 조절하는데 중요한 인자이다7. 우리 그룹의 이전 결과는 HuR이 miRNA를 포함하는 인트론에 결합 할 수 있음을 보여 주었고,이 단백질이 miRNA 처리 및 성숙을 촉진하는 중요한 요소가 될 수 있음을 나타내며 대체 접합 이소폼 6,8,9의 생성으로 이어졌습니다.
많은 마이크로RNA(miRNAs)는 인트로닉 서열로부터 코딩된다. 일부는 인트론의 일부인 반면, 다른 일부는 "미르트론"으로 알려져 있으며 전체 인트론10,11에 의해 형성됩니다. miRNAs는 길이 12에서 18 내지 24 뉴클레오티드 범위의 짧은 비코딩 RNA이다. 이들의 성숙 서열은 mRNAs에서 표적 서열과 부분적 또는 전체 상보성을 보여주며, 따라서 번역 및/또는 mRNA 붕괴율에 영향을 미친다. miRNA와 표적의 조합은 세포를 다른 결과로 이끈다. 몇몇 miRNA는 세포를 프로- 또는 항-종양 표현형(13)으로 구동시킬 수 있다. 종양원성 miRNA는 일반적으로 억제 특성을 유발하는 mRNA를 표적으로 하여, 증가된 세포 증식, 이동 및 침윤(14)을 유도한다. 한편, 종양-억제 miRNA는 증가된 세포 증식과 관련된 종양원성 mRNA 또는 mRNA를 표적으로 할 수 있다.
miRNA의 처리 및 성숙은 또한 그들의 기원에 의존한다. 대부분의 인트로닉 miRNA는 마이크로프로세서의 참여로 처리되며, 리보뉴클레아제 드로샤 및 단백질 보조인자(12)에 의해 형성된다. Mirtrons는 Drosha15와 독립적으로 스플라이 커오좀의 활성으로 처리됩니다. 인트론 내에서 발견되는 miRNA의 높은 빈도를 고려할 때, 우리는 스플라이싱과 관련된 RNA 결합 단백질이 또한 이러한 miRNA의 처리 및 성숙을 촉진 할 수 있다고 가정했습니다. 특히, RBP hnRNP A2/B1은 이미 마이크로프로세서 및 miRNA 생물발생(16)과 연관되었다. 
우리는 이전에 hnRNP 및 HuR과 같은 여러 RNA 결합 단백질이 질량 분광법17에 의해 인트로닉 miRNA와 관련이 있다고보고했습니다. miR-17-92 인트로닉 클러스터로부터의 miRNAs와의 HuR's (ELAVL1) 연관성은 면역침전 및 실리코 분석9를 사용하여 확인하였다. miR-17-92는 상이한 암18,19에서 증가된 발현을 갖는 6개의 miRNA로 구성된 인트로닉 miRNA 클러스터이다. 이 클러스터는 또한 "oncomiR-1"로 알려져 있으며, miR-17, miR-18 a, miR-19 a, miR-20, miR-19 b 및 miR-92a로 구성된다. HuR의 증가된 발현은 miR-19a 및 miR-19b 합성 9를 자극한다. 이 클러스터를 둘러싸고 있는 인트로닉 영역이 HuR과 연관되어 있기 때문에, 우리는 이 단백질이 miR-19a 및 miR-19b 발현 및 성숙을 조절할 수 있는지 조사하는 방법을 개발했다. 우리의 가설에 대한 한 가지 중요한 예측은 조절 단백질로서 HuR이 miRNA 생물발생을 촉진하여 표현형 변화를 일으킬 수 있다는 것입니다. 한 가지 가능성은 miRNA가 HuR의 자극에 의해 처리되었지만 성숙하고 기능적이지 않으므로 단백질의 효과가 표현형에 직접적인 영향을 미치지 않는다는 것입니다. 따라서 우리는 HuR과 같은 RBP가 인트로닉 miRNA의 생물 발생 및 성숙에 영향을 줄 수 있는지 여부를 조사하기 위해 접합 리포터 분석을 개발했습니다. miRNA 처리 및 성숙을 확인함으로써, 우리의 분석은 표적 서열과의 상호작용 및 성숙하고 기능적인 miRNA의 생성을 보여준다. 우리의 분석에서, 우리는 배양 된 세포에서 miRNA 표적 결합을 확인하기 위해 인트로닉 miRNA 클러스터의 발현을 루시퍼라제 플라스미드와 결합시킵니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Recombinant DNA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pCAGGS-Cre (Cre- encoding plasmid)</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>pFLAG-HuR</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pmiRGLO-RAP-IB</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pmiRGLO-scrambled</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pRD-miR-17-92</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pRD-RIPE-donor</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>pTK-Renilla</td>
			<td>Promega</td>
			<td>E2241</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>anti-B-actin</td>
			<td>Sigma Aldrich</td>
			<td>A5316</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-HuR</td>
			<td>Cell Signaling</td>
			<td>mAb&#160;12582</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 680CW Goat anti-mouse IgG</td>
			<td>Li-Cor Biosciences</td>
			<td>926-68070</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 800CW Goat anti-rabbit IgG</td>
			<td>Li-Cor Biosciences</td>
			<td>929-70020</td>
			<td></td>
		</tr>
		<tr>
			<td>Experimental Models: Cell Lines</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HeLa-Cre</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-HuR</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-HuR-luc</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-luc</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-scrambled</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>Chemicals and Peptides</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/high-glucose</td>
			<td>Thermo Fisher Scientific</td>
			<td>12800-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Doxycycline</td>
			<td>BioBasic</td>
			<td>MB719150</td>
			<td></td>
		</tr>
		<tr>
			<td>Dual-Glo Luciferase Assay System</td>
			<td>Promega</td>
			<td>E2940</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRI</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0271</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRV</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0301</td>
			<td></td>
		</tr>
		<tr>
			<td>Geneticin</td>
			<td>Thermo Fisher Scientific</td>
			<td>E859-EG</td>
			<td></td>
		</tr>
		<tr>
			<td>L-glutamine</td>
			<td>Life Technologies</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM I</td>
			<td>Life Technologies</td>
			<td>31985-070</td>
			<td></td>
		</tr>
		<tr>
			<td>pFLAG-CMV&#8482;-3 Expression Vector</td>
			<td>Sigma Aldrich</td>
			<td>E6783</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-T</td>
			<td>Promega</td>
			<td>A3600</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA polymerase</td>
			<td>Thermo Fisher Scientific</td>
			<td>10966-030</td>
			<td></td>
		</tr>
		<tr>
			<td>pmiR-GLO</td>
			<td>Promega</td>
			<td>E1330</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Sigma Aldrich</td>
			<td>P8833</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse OUT</td>
			<td>Thermo Fisher Scientific</td>
			<td>752899</td>
			<td></td>
		</tr>
		<tr>
			<td>SuperScript IV kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>18091050</td>
			<td></td>
		</tr>
		<tr>
			<td>Trizol-LS reagent</td>
			<td>Thermo Fisher</td>
			<td>10296-028</td>
			<td></td>
		</tr>
		<tr>
			<td>trypsin/EDTA 10X</td>
			<td>Life Technologies</td>
			<td>15400-054</td>
			<td></td>
		</tr>
		<tr>
			<td>XbaI</td>
			<td>Thermo Fisher Scientific</td>
			<td>10131035</td>
			<td></td>
		</tr>
		<tr>
			<td>XhoI</td>
			<td>Promega</td>
			<td>R616A</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotides</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>forward RAP-1B pmiRGLO</td>
			<td>Exxtend</td>
			<td>TCGAGTAGCGGCCGCTAGTAAG 
			CTACTATATCAGTTTGCACAT</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse RAP-1B pmiRGLO</td>
			<td>Exxtend</td>
			<td>CTAGATGTGCAAACTGATATAGT 
			AGCTTACTAGCGGCCGCTAC</td>
			<td></td>
		</tr>
		<tr>
			<td>forward scrambled pmiRGLO</td>
			<td>Exxtend</td>
			<td>TCGAGTAGCGGCCGCTAGTAA 
			GCTACTATATCAGGGGTAAAAT</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse scrambled pmiRGLO</td>
			<td>Exxtend</td>
			<td>CTAGATTTTACCCCTGATATAGT 
			AGCTTACTAGCGGCCGCTAC</td>
			<td></td>
		</tr>
		<tr>
			<td>forward HuR pFLAG</td>
			<td>Exxtend</td>
			<td>GCCGCGAATTCAATGTCTAAT 
			GGTTATGAAGAC</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse HuR pFLAG</td>
			<td>Exxtend</td>
			<td>GCGCTGATATCGTTATTTGTG 
			GGACTTGTTGG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward pre-miR-1792 pRD-RIPE</td>
			<td>Exxtend</td>
			<td>ATCCTCGAGAATTCCCATTAG 
			GGATTATGCTGAG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse pre-miR-1792 pRD-RIPE</td>
			<td>Exxtend</td>
			<td>ACTAAGCTTGATATCATCTTG 
			TACATTTAACAGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward snRNA U6 (RNU6B)</td>
			<td>Exxtend</td>
			<td>CTCGCTTCGGCAGCACATATAC</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse snRNA U6 (RNU6B)</td>
			<td>Exxtend</td>
			<td>GGAACGCTTCACGAATTTGCGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward B-Actin qPCR</td>
			<td>Exxtend</td>
			<td>ACCTTCTACAATGAGCTGCG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse B-Actin qPCR</td>
			<td>Exxtend</td>
			<td>CCTGGATAGCAACGTACATGG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward HuR qPCR</td>
			<td>Exxtend</td>
			<td>ATCCTCTGGCAGATGTTTGG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse HuR qPCR</td>
			<td>Exxtend</td>
			<td>CATCGCGGCTTCTTCATAGT</td>
			<td></td>
		</tr>
		<tr>
			<td>forward pre-miR-1792 qPCR</td>
			<td>Exxtend</td>
			<td>GTGCTCGAGACGAATTCGTCA 
			GAATAATGTCAAAGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse pre-miR-1792 qPCR</td>
			<td>Exxtend</td>
			<td>TCCAAGCTTAAGATATCCCAAAC 
			TCAACAGGCCG</td>
			<td></td>
		</tr>
		<tr>
			<td>Software and Algorithms</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Prism 8 for Mac OS X</td>
			<td>Graphpad</td>
			<td>https://www.graphpad.com</td>
			<td></td>
		</tr>
		<tr>
			<td>ImageJ</td>
			<td>National Institutes of Health</td>
			<td>http://imagej.nih.gov/ij</td>
			<td></td>
		</tr>
	</tbody>
</table>

a reporter assay to analyze intronic microrna maturation in mammalian cells

마이크로RNA(miRNAs)는 진핵생물에 널리 퍼져 있는 짧은 RNA 분자이다. 대부분의 miRNA는 인트론으로부터 전사되며, 이들의 성숙은 핵에서 상이한 RNA 결합 단백질을 포함한다. 성숙한 miRNA는 종종 유전자 침묵을 매개하며, 이것은 전사 후 사건을 이해하는 데 중요한 도구가되었습니다. 그 외에도, 그것은 유전자 치료를위한 유망한 방법론으로 탐구 될 수 있습니다. 그러나, 현재 포유동물 세포 배양물에서 miRNA 발현을 평가하기 위한 직접적인 방법이 부족하다. 여기에서는 표적 서열과의 상호작용의 확인을 통해 miRNA 생물발생 및 성숙을 결정하는 데 도움이 되는 효율적이고 간단한 방법을 설명한다. 또한, 이 시스템은 일차 miRNA(pri-miRNA) 전사를 고효율 및 저비용으로 제어할 수 있는 독시사이클린-유도성 프로모터를 사용하여 그의 내인성 활성으로부터 외인성 miRNA의 성숙을 분리할 수 있게 한다. 이 도구는 또한 별도의 플라스미드에서 RNA 결합 단백질로 조절을 허용한다. 다양한 상이한 miRNAs 및 이들의 각각의 표적과의 그의 용도 이외에도, 이들은 형질감염에 적합할 수 있는 한, 상이한 세포주에 적응될 수 있다.

우리의 초기 가설은 HuR이 그것의 pre-miRNA 서열에 결합함으로써 인트로닉 miRNA 생물발생을 촉진할 수 있다는 것이었다. 따라서, HuR 발현 및 miR-17-92 클러스터 생물발생의 연결은 이들 miRNAs의 성숙을 지배하는 새로운 메카니즘을 가리킬 수 있다. pFLAG-HuR의 형질감염시 HuR의 과발현은 세 개의 상이한 세포주, 즉 HeLa, BCPAP, 및 HEK-293T에서 확인되었다(도 2). 대조군으로서, 형질?...

Watch this Scientific Journal Video about A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells at JoVE.com

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

우리는 네 개의 플라스미드를 가진 시험관 내에서 세포에서 사용되는 인트로닉 마이크로RNA 생물발생 리포터 어세이를 개발하였다: 하나는 인트로닉 miRNA를 가지고 있고, 하나는 표적을 가지고 있고, 다른 하나는 조절 단백질을 과발현하기 위해, 다른 하나는 레닐라 루시페라제이다. miRNA를 처리하고, 표적 서열에 결합함으로써 루시퍼라제 발현을 조절할 수 있었다.

포유류 세포에서 인트로닉 마이크로RNA 성숙을 분석하기 위한 리포터 분석

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

당사의 프로토콜은 세포 배양에서 직접 microRNA 생물 발생 및 성숙에 대한 조절 RNA 결합 단백질의 영향을 다룹니다. 우리가 설명하는 방법은 일반적인 세포 배양 시약으로 수행 할 수 있으며 비교적 빠릅니다. 이 방법은 다양한 유형의 진핵 세포에서 microRNA와 그 표적의 표현형 효과를 연구하는 데 중요 할 수 있습니다.정상 또는 질병-유사 세포가 사용될 수 있다. 루시퍼라제 활성을 통한 표적 친화도의 변화를 관찰하기 위해 형질감염에 적합한 세포주를 선택하고, 적절한 형질감염 및 유도 조절을 수행하는 것이 중요하다. 시작하려면 DMEM, 100mm 페트리 접시에 고혈당 보충제로 세포를 유지하고 5%이산화탄소가 있는 가습되고 제어된 분위기 인큐베이터에서 섭씨 37도의 세포를 배양합니다.부착 세포를 분리하려면 트립신 -EDTA 용액과 함께 섭씨 37도에서 3-5 분 동안 배양하십시오. 형질주입을 수행하려면 100 마이크로리터의 배양 배지에 200 나노그램의 DNA와 1.25 마이크로리터의 형질주입 시약을 혼합하고 형질주입 혼합물을 세포에 첨가합니다. 이어서, 세포를 형질주입 혼합물과 함께 섭씨 37도에서 4시간 동안 인큐베이션한다.그런 다음 배지를 10%FBS를 포함하는 배지로 교체하고 선택을 위해 항생제를 추가하기 전에 24시간 더 배양합니다. pFLAG-HuR 및 MT-pFLAG를 HeLa로 형질감염시키려면 Geneticin의 농도를 밀리리터당 100마이크로그램에서 밀리리터당 1000마이크로그램으로 증가시켜 세포를 선택하여 안정적인 세포주를 생성합니다. 그 후, HuR mRNA에 특이적인 프라이머를 이용한 정량적 PCR로 과발현을 확인하였다.HeLa-Cre 세포의 플라스미드를 40 나노그램 pTK-Renilla로 형질감염시킨 다음 pRD miR 17-92로 형질감염시켜 HeLa-Cre miR 17-92를 생성하고 1밀리리터당 1마이크로그램 퓨로마이신으로 선택합니다. 이어서, HeLa-Cre miR 17-92를 pTK-Renilla 및 pmirGLO RAB1B 3'UTR 또는 pmirGLO를 별도로 스크램블링하여 1B 3'UTR로 형질감염시킨다. 다음으로, 페니실린 및 스트렙토마이신을 사용하여 선택하여, luc RAB1B 및 luc 스크램블의 생성을 초래한다.다음으로, 이전에 시연된 대로 pFLAG-HuR 또는 MT-PFLAG로 세포를 형질감염시킵니다. 약 80%의 컨플루언시에 도달할 때까지 HeLa-Cre miR 17-92 luc, HeLa-Cre miR 17-92 스크램블, HeLa-Cre miR 17-92 HuR 및 HeLa-Cre miR 1792 HuR 잠금을 사용하여 세포 배양을 진행합니다. 이어서, 섭씨 37도에서 30분 동안 1 마이크로리터의 독시사이클린을 유도하고, 또한 독시사이클린이 없는 모든 세포를 대조군으로 동일한 기간 동안 유지한다.다양한 발광 강도를 정량화하고 비교하려면 이중 루시퍼라아제 리포터 분석 키트를 사용하십시오. 분석을 시작하기 전에 루시페라아제 분석 용액을 해동하고 실온에 두십시오. 다음에, 10 밀리리터의 루시퍼라아제 분석 완충액 2에 200 마이크로리터의 기질을 혼합함으로써 Stop 및 Glo 믹스를 준비한다.그런 다음 10 밀리리터의 루시퍼라아제 분석 완충액 2를 루시퍼라아제 분석 기질 2의 호박색에 넣고 혼합하고, LAR II를 혼합하고, 잘 흔들어 준다. 그런 다음 용액을 이전에 식별되고 빛으로부터 보호되는 15 밀리리터 원심 분리기 튜브로 옮깁니다. 다음으로, Synergy와 같은 장비를 사용하여 발광 판독을 수행하고 표현된 루시페라아제를 상대 조명 단위로 측정한 다음 추가 통계 분석을 위해 결과를 스프레드시트로 내보냅니다.대조군 Renilla에 의해 반딧불이 루시퍼라아제 활성의 정규화를 수행하고 독시사이클린 유도가 있거나 없는 그룹에 대해 반복하면서 그래픽에 상대적 조명 단위로 플롯합니다. HeLa, BCPAP 및 HEK293T 세포주에서 pFLAG-HuR의 형질감염시 HuR의 과발현이 확인되었으며, 이들 세포에서 HuR 과발현이 miR19A의 발현을 자극하는 것으로 관찰되었다. HeLa-Cre 세포와 비교하여 pRD miR 17-92로부터의 miR19A 및 miR19B 발현 증가시 RAB1B 3'UTR에서 루시퍼라아제 활성의 강한 감소가 관찰되었다.HeLa 세포에서 pFLAG-HuR의 형질감염은 루시퍼라아제 활성을 변화시키지 않았다. 그러나, HuR의 과발현은 독시사이클린 보충과 함께 miR 17-92 클러스터의 발현을 자극하여 루시퍼라아제 활성을 더욱 감소시켰다. microRNA 성숙에서 RNA 결합 단백질의 역할을 확인한 후 세포 역학 및 세포주기 분석은 microRNA에서 단백질에 의해 촉진되는 주요 변화를 이해하는 데 중요합니다.

Research

JoVE Journal

Cancer Research

Application of Laser Micro-irradiation for Examination of Single and Double Strand Break Repair in Mammalian Cells

단일의 검사 및 포유류 세포에서 이중 가닥 브레이크 수리에 대 한 레이저 마이크로-방사선의 응용

Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular ...

연구

암 연구학

Using the Dot Assay to Analyze Migration of Cell Sheets

셀 시트의 마이그레이션 분석 하 점 분석 결과 사용 하 여

Although complex organisms appear static, their tissues are under a continuous turnover. As cells age, die, and are replaced by new cells, cells move ...

Radionuclide-fluorescence Reporter Gene Imaging to Track Tumor Progression in Rodent Tumor Models

방사성 핵 종 형광 취재 원 유전자 설치류 종양 모델에서 종양의 진행을 추적 하기 위해 이미징

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis ...

Detection of a Circulating MicroRNA Custom Panel in Patients with Metastatic Colorectal Cancer

전이성 대 장 암 환자에서 순환 예측에 관한 사용자 정의 패널의 검출

There is increasing interest in liquid biopsy for cancer diagnosis, prognosis and therapeutic monitoring, creating the need for reliable and useful ...

A Spheroid Killing Assay by CAR T Cells

자동차 T 세포에 의해 회전 타원 체 살인 분석 결과

Immunotherapy has become a field of growing interest in the fight against cancer otherwise untreatable. Among all immunotherapeutic methods, chimeric ...

Real Time Detection of In Vitro Tumor Cell Apoptosis Induced by CD8+ T Cells to Study Immune Suppressive Functions of Tumor-infiltrating Myeloid Cells

Real Time Detection of In Vitro Tumor Cell Apoptosis Induced by CD8+ T Cells to Study Immune Suppressive Functions of Tumor-infiltrating Myeloid Cells

실시간 탐지의 체 외 종양 세포 Apoptosis에 CD8에 의해 유도 된+ T 세포 종양 침투 골수성 세포의 면역 진압 기능 연구

Potentiation of the tumor-killing ability of CD8+ T cells in tumors, along with their efficient tumor infiltration, is a key element of successful ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

쥐에서 종양 성장을 감소 하는 MicroRNA의 생체 내 억제

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

In Vitro Assay to Study Tumor-macrophage Interaction

종양 대식 세포 상호 작용을 연구 하는 시험관 내 분석

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a ...

Quantifying Telomere Length Using Non-Radioactive Chemiluminescence Detection

Optimization of Performance Parameters of the TAGGG Telomere Length Assay

Author Spotlight: Optimization of Performance Parameters of the TAGGG Telomere Length Assay  

TAGGG 텔로미어 길이 분석의 성능 매개변수 최적화

Telomeres are repetitive sequences which are present at chromosomal ends; their shortening is a characteristic feature of human somatic cells. Shortening ...

https://cloudfront.jove.com/CDNSource/teasers/65288.jpg

Pharmacological Targeting of Ion Channels to Treat Solid Tumors

Screening Ion Channels in Cancer Cells

Author Spotlight: Exploring the Role of Ion Channels in Cancer: Characterization and Potential Treatment Approaches 

암세포의 이온 채널 스크리닝

Ion channels are critical for cell development and maintaining cell homeostasis. The perturbation of ion channel function contributes to the development ...