Name: ultrasound-guided induced pluripotent stem cell-derived cardiomyocyte implantation in myocardial infarcted mice
Uploaded: 2022-03-30T15:00:00
Description: Watch this Scientific Journal Video about Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice at JoVE.com

Dit werk werd ondersteund door het Major Research Plan van de National Natural Science Foundation of China (nr. 91539111 tot JY), Key Project of Science and Technology van de provincie Hunan (nr. 2020SK53420 tot JY) en het Science and Technology Innovation Program van de provincie Hunan (2021RC2106 tot CF).

Alle dierproeven in deze studie werden beoordeeld en goedgekeurd door de ethische commissie van het Second Xiangya Hospital van de Central South University. Zie de Tabel met materialen voor details over alle materialen en apparatuur die in dit protocol worden gebruikt. De tijdlijnen voor celinjectie, beeldvorming en euthanasie zijn als volgt: t0- induce infarct, t1 week- beeld- en implantaatcellen, t2 weken- beeld- en implantaatcellen, t4 weken- definitieve beeldvorming, euthanasie en weefselverzameling....

<ol>
	<li>Leuschner, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+monocyte+kinetics+in+acute+myocardial+infarction+are+sustained+by+extramedullary+monocytopoiesis.">Rapid monocyte kinetics in acute myocardial infarction are sustained by extramedullary monocytopoiesis.</a> The Journal of Experimental Medicine. 209 (1), 123-137 (2012).</li><li>L&#225;z&#225;r, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocyte+renewal+in+the+human+heart:+insights+from+the+fall-out.">Cardiomyocyte renewal in the human heart: insights from the fall-out.</a> European Heart Journal. 38 (30), 2333-2342 (2017).</li><li>Davis, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=State+of+the+art:+cardiac+transplantation.">State of the art: cardiac transplantation.</a> Trends in Cardiovascular Medicine. 24 (8), 341-349 (2014).</li><li>Mancini, D., Colombo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Left+ventricular+assist+devices:+A+rapidly+evolving+alternative+to+transplant.">Left ventricular assist devices: A rapidly evolving alternative to transplant.</a> Journal of the American College of Cardiology. 65 (23), 2542-2555 (2015).</li><li>Zimmermann, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+myocardial+remuscularization.">Translating myocardial remuscularization.</a> Circulation Research. 120 (2), 278-281 (2017).</li><li>Hu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+large-scale+investigation+of+hypoxia-preconditioned+allogeneic+mesenchymal+stem+cells+for+myocardial+repair+in+nonhuman+primates:+Paracrine+activity+without+remuscularization.">A large-scale investigation of hypoxia-preconditioned allogeneic mesenchymal stem cells for myocardial repair in nonhuman primates: Paracrine activity without remuscularization.</a> Circulation Research. 118 (6), 970-983 (2016).</li><li>Kempf, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+differentiation+of+human+pluripotent+stem+cells+in+scalable+suspension+culture.">Cardiac differentiation of human pluripotent stem cells in scalable suspension culture.</a> Nature Protocols. 10 (9), 1345-1361 (2015).</li><li>Chong, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic-stem-cell-derived+cardiomyocytes+regenerate+non-human+primate+hearts.">Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts.</a> Nature. 510 (7504), 273-277 (2014).</li><li>Shiba, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allogeneic+transplantation+of+iPS+cell-derived+cardiomyocytes+regenerates+primate+hearts.">Allogeneic transplantation of iPS cell-derived cardiomyocytes regenerates primate hearts.</a> Nature. 538 (7625), 388-391 (2016).</li><li>Nguyen, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potential+strategies+to+address+the+major+clinical+barriers+facing+stem+cell+regenerative+therapy+for+cardiovascular+disease:+A+review.">Potential strategies to address the major clinical barriers facing stem cell regenerative therapy for cardiovascular disease: A review.</a> JAMA Cardiology. 1 (8), 953-962 (2016).</li><li>Zimmermann, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Remuscularization+of+the+failing+heart.">Remuscularization of the failing heart.</a> The Journal of Physiology. 595 (12), 3685-3690 (2017).</li><li>Hu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplantation+of+hypoxia-preconditioned+mesenchymal+stem+cells+improves+infarcted+heart+function+via+enhanced+survival+of+implanted+cells+and+angiogenesis.">Transplantation of hypoxia-preconditioned mesenchymal stem cells improves infarcted heart function via enhanced survival of implanted cells and angiogenesis.</a> The Journal of Thoracic and Cardiovascular Surgery. 135 (4), 799-808 (2008).</li><li>Feng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heat+shock+improves+Sca-1++stem+cell+survival+and+directs+ischemic+cardiomyocytes+toward+a+prosurvival+phenotype+via+exosomal+transfer:+a+critical+role+for+HSF1/miR-34a/HSP70+pathway.">Heat shock improves Sca-1+ stem cell survival and directs ischemic cardiomyocytes toward a prosurvival phenotype via exosomal transfer: a critical role for HSF1/miR-34a/HSP70 pathway.</a> Stem Cells. 32 (2), 462-472 (2014).</li><li>Fan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocytes+from+CCND2-overexpressing+human+induced-pluripotent+stem+cells+repopulate+the+myocardial+scar+in+mice:+A+6-month+study.">Cardiomyocytes from CCND2-overexpressing human induced-pluripotent stem cells repopulate the myocardial scar in mice: A 6-month study.</a> Journal of Molecular and Cellular Cardiology. 137, 25-33 (2019).</li><li>Lou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-cadherin+overexpression+enhances+the+reparative+potency+of+human-induced+pluripotent+stem+cell-derived+cardiac+myocytes+in+infarcted+mouse+hearts.">N-cadherin overexpression enhances the reparative potency of human-induced pluripotent stem cell-derived cardiac myocytes in infarcted mouse hearts.</a> Cardiovascular Research. 116 (3), 671-685 (2020).</li><li>Sun, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplanted+microvessels+improve+pluripotent+stem+cell-derived+cardiomyocyte+engraftment+and+cardiac+function+after+infarction+in+rats.">Transplanted microvessels improve pluripotent stem cell-derived cardiomyocyte engraftment and cardiac function after infarction in rats.</a> Science Translational Medicine. 12 (562), (2020).</li><li>Wu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+repair+with+echocardiography-guided+multiple+percutaneous+left+ventricular+intramyocardial+injection+of+hiPSC-CMs+after+myocardial+infarction.">Cardiac repair with echocardiography-guided multiple percutaneous left ventricular intramyocardial injection of hiPSC-CMs after myocardial infarction.</a> Frontiers in Cardiovascular Medicine. 8, 768873 (2021).</li><li>Kannappan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionally+competent+DNA+damage-free+induced+pluripotent+stem+cell-derived+cardiomyocytes+for+myocardial+repair.">Functionally competent DNA damage-free induced pluripotent stem cell-derived cardiomyocytes for myocardial repair.</a> Circulation. 140 (6), 520-522 (2019).</li><li>Lou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-cadherin+overexpression+enhances+the+reparative+potency+of+human-induced+pluripotent+stem+cell-derived+cardiac+myocytes+in+infarcted+mouse+hearts.">N-cadherin overexpression enhances the reparative potency of human-induced pluripotent stem cell-derived cardiac myocytes in infarcted mouse hearts.</a> Cardiovascular Research. 116 (3), 671-685 (2020).</li><li>Zhao, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Y-27632+preconditioning+enhances+transplantation+of+human-induced+pluripotent+stem+cell-derived+cardiomyocytes+in+myocardial+infarction+mice.">Y-27632 preconditioning enhances transplantation of human-induced pluripotent stem cell-derived cardiomyocytes in myocardial infarction mice.</a> Cardiovascular Research. 115 (2), 343-356 (2019).</li><li>Zhao, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+the+engraftment+of+human+induced+pluripotent+stem+cell-derived+cardiomyocytes+via+a+transient+inhibition+of+rho+kinase+activity.">Enhancing the engraftment of human induced pluripotent stem cell-derived cardiomyocytes via a transient inhibition of rho kinase activity.</a> Journal of Visualized Experiments: JoVE. (149), e59452 (2019).</li><li>O'Brien, J., Hayder, H., Peng, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+quantification+and+analysis+of+cell+counting+procedures+using+ImageJ+plugins.">Automated quantification and analysis of cell counting procedures using ImageJ plugins.</a> Journal of Visualized Experiments: JoVE. (117), e54719 (2016).</li><li>Kain, V., Prabhu, S. D., Halade, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammation+revisited:+inflammation+versus+resolution+of+inflammation+following+myocardial+infarction.">Inflammation revisited: inflammation versus resolution of inflammation following myocardial infarction.</a> Basic Research in Cardiology. 109 (6), 444 (2014).</li><li>Rainer, P. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocyte-specific+transforming+growth+factor+&#946;+suppression+blocks+neutrophil+infiltration,+augments+multiple+cytoprotective+cascades,+and+reduces+early+mortality+after+myocardial+infarction.">Cardiomyocyte-specific transforming growth factor &#946; suppression blocks neutrophil infiltration, augments multiple cytoprotective cascades, and reduces early mortality after myocardial infarction.</a> Circulation Research. 114 (8), 1246-1257 (2014).</li><li>Yu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cell-derived+cardiomyocyte+therapy+in+mouse+permanent+ischemia+and+ischemia-reperfusion+models.">Human embryonic stem cell-derived cardiomyocyte therapy in mouse permanent ischemia and ischemia-reperfusion models.</a> Stem Cell Research &amp; Therapy. 10 (1), 167 (2019).</li><li>Iwanaga, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+G-CSF+on+cardiac+remodeling+after+acute+myocardial+infarction+in+swine.">Effects of G-CSF on cardiac remodeling after acute myocardial infarction in swine.</a> Biochemical and Biophysical Research Communications. 325 (4), 1353-1359 (2004).</li></ol>

De kritieke stappen van deze studie omvatten hiPSC-cultuur, cardiomyocytendifferentiatie, hiPSC-CM-zuivering en hiPSC-CM-transplantatie in de plaats van het myocardinfarct van de muis. De sleutel is om cardiale echografie te gebruiken om de behandeling transcutaan te leiden naar de infarctplaats aan de rand van het infarct waar hiPSC-CMs in het gebied werden geïnjecteerd.
Met de verlenging van de kweektijd verandert het hiPSC-CM-fenotype in morfologie (grotere celgrootte), structuur (spier, f...

Wanneer acute MI optreedt, sterven myocardiale cellen in het infarctgebied snel als gevolg van ischemie en hypoxie. Verschillende ontstekingsfactoren komen vrij na celdood en breuk, terwijl ontstekingscellen de infarctplaats infiltreren om ontsteking1 te veroorzaken. Significant is dat fibroblasten en collageen, beide zonder contractiliteit en elektrische geleidbaarheid, de myocardiale cellen op de infarctplaats vervangen om littekenweefsel te vormen. Vanwege de beperkte regeneratiecapaciteit van cardiomyocyten bij volwassen zoogdieren is levensvatbaar weefsel gevormd na een groot infarctgebied meestal niet voldoende voor het handhaven van voldoende cardiale output2. MI veroorzaakt hartfalen en in ernstige gevallen van hartfalen kunnen patiënten alleen vertrouwen op harttransplantaties of ventriculaire hulpmiddelen om normale hartfuncties te behouden 3,4.
Na MI is de ideale behandelingsstrategie om de dode cardiomyocyten te vervangen door nieuw gevormde cardiomyocyten, waarbij elektromechanische koppeling met gezonde weefsels wordt gevormd. Behandelingsopties hebben echter meestal myocardiale berging aangenomen in plaats van vervanging. Momenteel behoren op stamcellen en voorlopercellen gebaseerde therapieën tot de meest veelbelovende strategieën om myocardherstel na MI5 te bevorderen. De transplantatie van deze cellen heeft echter verschillende problemen, voornamelijk het onvermogen van volwassen stamcellen om te differentiëren in cardiomyocyten en hun korte levensduur6.
De ethische kwesties met betrekking tot het gebruik van embryonale stamcellen (ES) kunnen worden omzeild door iPSC's, die een veelbelovende bron van cellen zijn. Bovendien beschikken iPSC's over sterke zelfvernieuwingscapaciteiten en kunnen ze differentiëren in cardiomyocyten7. Studies hebben aangetoond dat hiPSC-CMs getransplanteerd in de MI-site kunnen overleven en gap junctions vormen met gastheercellen 8,9. Omdat deze getransplanteerde cellen zich echter in de micro-omgeving van ischemie en ontsteking bevinden, is hun overlevingskans extreem laag10,11.
Er zijn verschillende methoden ontwikkeld om de overlevingskans van getransplanteerde cellen te verbeteren, zoals hypoxie en hitteschokvoorbehandeling van getransplanteerde cellen12,13, genetische modificatie 14,15 en de gelijktijdige transplantatie van cellen en haarvaten 16. Helaas worden de meeste methoden beperkt door complexiteit en hoge kosten. Daarom stelt deze studie een reproduceerbare, handige, relatief invasieve en effectieve hiPSC-CM-toedieningsmethode voor.
Echogeleide intramyocardiale celinjectie kan worden uitgevoerd met alleen een kleine veterinaire echografiemachine met hoge resolutie en een micro-injector, ongeacht de locatie. Onder echografische begeleiding is het direct afleveren van cellen onder het xiphoid-proces van het hartzakje naar het myocardium bij muizen een veilig protocol dat lever- en longschade voorkomt. Deze methode kan gelijktijdig met andere technologieën worden gecombineerd om de overlevingskans van getransplanteerde cellen aanzienlijk te verbeteren.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibody</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cardiac troponin T</td>
			<td>Abcam</td>
			<td>ab8295</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Mouse IgG H&#38;L (Alexa Fluor 488)</td>
			<td>Abcam</td>
			<td>ab150105</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Mouse IgG H&#38;L (Alexa Fluor 555)</td>
			<td>Abcam</td>
			<td>ab150110</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Rabbit IgG H&#38;L (Alexa Fluor 488)</td>
			<td>Abcam</td>
			<td>ab150073</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Rabbit IgG H&#38;L (Alexa Fluor 555)</td>
			<td>Abcam</td>
			<td>ab150062</td>
			<td></td>
		</tr>
		<tr>
			<td>Human cardiac troponin T</td>
			<td>Abcam</td>
			<td>ab91605</td>
			<td></td>
		</tr>
		<tr>
			<td>Isolectin B4</td>
			<td>Vector</td>
			<td>FL-1201</td>
			<td></td>
		</tr>
		<tr>
			<td>Sarcomeric alpha actinin</td>
			<td>Abcam</td>
			<td>ab9465</td>
			<td></td>
		</tr>
		<tr>
			<td>Wheat germ agglutinin</td>
			<td>Thermo Fisher Scientific</td>
			<td>W11261</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>Thermo Fisher Scientific</td>
			<td>00-4555-56</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 Supplement(minus insulin)</td>
			<td>Thermo Fisher Scientific</td>
			<td>A1895601</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 Supplement(serum free)</td>
			<td>Thermo Fisher Scientific</td>
			<td>17&#8211;504-044</td>
			<td></td>
		</tr>
		<tr>
			<td>Bouin&#39;s solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>SDHT10132</td>
			<td></td>
		</tr>
		<tr>
			<td>CHIR99021</td>
			<td>Selleck</td>
			<td>CT99021</td>
			<td></td>
		</tr>
		<tr>
			<td>cyclosporin A</td>
			<td>Medchemexpress</td>
			<td>HY-B0579</td>
			<td></td>
		</tr>
		<tr>
			<td>DIRECT RED</td>
			<td>Sigma-Aldrich</td>
			<td>365548-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Thermo Fisher Scientific</td>
			<td>11320033</td>
			<td></td>
		</tr>
		<tr>
			<td>DNeasy Blood &#38; Tissue Kit</td>
			<td>Qiagen</td>
			<td>69504</td>
			<td></td>
		</tr>
		<tr>
			<td>FAST GREEN FCF</td>
			<td>Sigma-Aldrich</td>
			<td>&#160;F7252-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose-free RPMI 1640</td>
			<td>Thermo Fisher Scientific</td>
			<td>11879020</td>
			<td></td>
		</tr>
		<tr>
			<td>IWR1</td>
			<td>Selleck</td>
			<td>S7086</td>
			<td></td>
		</tr>
		<tr>
			<td>lactic acid</td>
			<td>Sigma-Aldrich</td>
			<td>L6661</td>
			<td></td>
		</tr>
		<tr>
			<td>Matrigel</td>
			<td>BD Biosciences</td>
			<td>BD356234</td>
			<td></td>
		</tr>
		<tr>
			<td>mTeSR1</td>
			<td>Stem Cell Technologies</td>
			<td>72562</td>
			<td></td>
		</tr>
		<tr>
			<td>O.C.T. Compound</td>
			<td>SAKURA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma-Aldrich</td>
			<td>158127</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUP SYBR Green MasterMix kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI1640</td>
			<td>Thermo Fisher Scientific</td>
			<td>11875119</td>
			<td></td>
		</tr>
		<tr>
			<td>STEMdif Cardiomyocyte Freezing Medium/STEMdiff</td>
			<td>Stem Cell Technologies</td>
			<td>5030</td>
			<td></td>
		</tr>
		<tr>
			<td>STEMdiff Cardiomyocyte Support Medium</td>
			<td>Stem Cell Technologies</td>
			<td>5027</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td></td>
		</tr>
		<tr>
			<td>ultrasound coupling agent</td>
			<td>CARENT</td>
			<td>22396269389</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632</td>
			<td>Selleck</td>
			<td>S6390</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment and Supplies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Applied Biosystems</td>
			<td>Thermo Fisher Scientific</td>
			<td>7500 Real-Time PCR</td>
			<td></td>
		</tr>
		<tr>
			<td>cryostat</td>
			<td>Leica</td>
			<td>CM1950</td>
			<td></td>
		</tr>
		<tr>
			<td>fluoresence microscope</td>
			<td>Olympus</td>
			<td>IX83</td>
			<td></td>
		</tr>
		<tr>
			<td>fine anatomical scissors</td>
			<td>Fine Science Tools</td>
			<td>15000-08</td>
			<td></td>
		</tr>
		<tr>
			<td>fine dissecting forceps</td>
			<td>Fine Science Tools</td>
			<td>11255-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Micro syringe</td>
			<td>Hamilton</td>
			<td>7633</td>
			<td></td>
		</tr>
		<tr>
			<td>Small animal anesthesia machine</td>
			<td>MATRX</td>
			<td>VMR</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-high resolution small animal ultrasound imaging system</td>
			<td>VisualSonics</td>
			<td>Vevo 2100</td>
			<td></td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Statistical Product and Service Solutions</td>
			<td>IBM</td>
			<td>21</td>
			<td></td>
		</tr>
		<tr>
			<td>Image J</td>
			<td>NIH</td>
			<td>1.48</td>
			<td></td>
		</tr>
		<tr>
			<td>Human mitochondrial DNA primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>the forward primer sequence</td>
			<td>CCGCTACCATAATCATCGCTAT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>the reverse primer sequence</td>
			<td>TGCTAATACAATGCCAGTCAGG</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

ultrasound-guided induced pluripotent stem cell-derived cardiomyocyte implantation in myocardial infarcted mice

Het belangrijkste doel van celtherapie na myocardinfarct (MI) is om de celgetransplanteerde snelheid effectief te verbeteren, en door de mens geïnduceerde pluripotente stamcel-afgeleide cardiomyocyten (hiPSC-CMs) zijn een veelbelovende celbron voor hartherstel na ischemische schade. Een lage getransplanteerde snelheid is echter een belangrijk obstakel voor effectieve hartweefselregeneratie na transplantatie. Dit protocol toont aan dat meerdere hiPSC-CM echogeleide percutane injecties in een MI-gebied de celtransplantatiesnelheden effectief verhogen. De studie beschrijft ook het volledige hiPSC-CM-cultuurproces, voorbehandeling en echogeleide percutane toedieningsmethoden. Bovendien helpt het gebruik van menselijk mitochondriaal DNA de afwezigheid van hiPSC-CMs in andere muisorganen te detecteren. Ten slotte beschrijft dit artikel de veranderingen in hartfunctie, angiogenese, celgrootte en apoptose in de infarctgrenszone bij muizen 4 weken na celafgifte. Er kan worden geconcludeerd dat echocardiografie-geleide percutane injectie van het linkerventrikelmyocardium een haalbare, relatief invasieve, bevredigende, herhaalbare en effectieve cellulaire therapie is.

Echocardiografie voor evaluatie van de linkerventrikelfunctie van de muizen in elke groep toonde aan dat de MI-verwondingen effectief waren omgekeerd in de MD-groep (figuur 2A). Vergeleken met de MI-groep vertoonde de SD-groep een verhoogde ejectiefractie (EF) (van 30% tot 35%; Figuur 2B) en fractieverkorting (FS) (van 18% naar 22%; Figuur 2C) na MI. Het is echter nog belangrijker om op te merken dat meerdere injecties van de hiPSC-...

Watch this Scientific Journal Video about Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice at JoVE.com

Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice

Echogeleide celafgifte rond de plaats van myocardinfarct bij muizen is een veilige, effectieve en handige manier van celtransplantatie.

Echogeleide geïnduceerde pluripotente stamcel-afgeleide cardiomyocytenimplantatie bij myocardinfarct muizen

The key objective of cell therapy after myocardial infarction (MI) is to effectively enhance the cell grafted rate, and human induced pluripotent stem ...

Dit is het eerste rapport dat aantoont dat echocardiografie-geleide, percutane intramyocardiale injectie van cardiomyocyten de herstellende eigenschap van menselijke iPS-afgeleide cardiomyocyten aanzienlijk verbetert. Deze methode is een haalbare, bevredigende, herhaalbare minder invasieve en effectieve procedure voor het leveren van humane iPS-afgeleide cardiomyocytentherapie. Wij geloven dat percutane intramyocardiale toediening een veilige en efficiënte methode is voor lokale medicijnafgifte voor ziekten zoals ischemische hartziekte, myocardinfarct en hartfalen.Dit project wordt begeleid door professor Jinfu Yang en professor Jun Peng. het demonstreren van de procedure zal Xun Wu, Kele Qin en Kun Xiang, MD PhD's van mijn laboratorium en Di Wang, een PhD van Hunan Provincial Key Laboratory of Cardiovascular Research. Om te beginnen, vacuüm aspirateer de cultuur supernatant van een 60-daagse cultuur van hiPSC-CMs.Was de cellen driemaal met PBS. Dissocieer vervolgens de hiPSC-CMs in individuele cellen met behulp van het celloslatingsenzymmengsel bij 37 graden Celsius gedurende drie tot vijf minuten. Verzamel de cellen in een buis van 15 milliliter met vijf milliliter RPMI plus B27-medium en meng.Tel de cellen en bereken het totale aantal cellen. Centrifugeer de celsuspensie op 300G gedurende twee minuten bij kamertemperatuur. Gooi het supernatant weg en resuspensie de pellet in cardiomyocytensteunmedium tot een concentratie van 6 x 10 van de 4e cellen per microliter.Plaats de buis op 37 graden Celsius tot de injectiestap. Nadat de muis voldoende is verdoofd, fixeert u de ledematen en staart met tape. Bevestig vervolgens de snijtanden van de muis met een 2/0 zijden draad en tape.Steriliseer de mediane hals en linkerborst met drie afwisselende rondes betaïne gevolgd door alcohol. Maak een mediane nekincisie met een fijne anatomische schaar en een fijne ontleedtang. Snijd een paar voorste cervicale spieren af om de luchtpijp te stabiliseren en volledig bloot te leggen.Steek een 20-gauge katheterpunctienaald als een tracheale buis door de mond. Sluit de tracheale buis aan op de ventilator en controleer op thoracale beweging om ervoor te zorgen dat beide longen goed worden geventileerd. Pas de ademhalingsparameters aan.Bevestig vervolgens de linkerachterpoot aan de rechteronderzijde en maak de tape rond de linker bovenste ledemaat los. Voer met een fijne ontleedschaar en tang een thoracotomie uit op de drie tot vier intercostale ruimte van de linker thorax. Verwijder met een tang het hartzakje en lokaliseer de linker voorste dalende kransslagader.Gebruik een 6/0 zijden draad om het proximale uiteinde van de slagader te ligateren. Om ervoor te zorgen dat het acute myocardinfarctmodel wordt vastgesteld, wacht u tot de distale kant van de slagader op de ligatieplaats verandert van rood naar wit. Sluit de borst laag voor laag en hecht de huid met 4/0 draad.Voer voor de schijngroep van dieren alle chirurgische procedures uit, behalve ligatie. Plaats de muizen in de eerste twee weken na een hartinfarct in een anesthesiedoos die is verbonden met 5% isofluoraan en voer tracheale intubatie uit. Injecteer drie dagen voor toediening van hiPSC-CMs ciclosporine A in de intraperitoneale holte in een dosis van 10 milligram per kilogram per dag.Verwijder het haar van de borst en bovenbuik van de muis met ontharingscrème. Toevoerinhalatie isofluoraan totdat de hartslag op 400 tot 500 slagen per minuut wordt gehouden. Bevestig de ledematen en staart van de muis met tape op de detectieconsole en stel de platformtemperatuur in op 37 graden Celsius.Breng de echografie gelei aan op de bovenbuik. Met behulp van een hoge resolutie veterinaire echografie sonde, verkrijgen muis leverbeelden. Trek met behulp van een microliter microspuit ongeveer 3 x 10 tot de 5e hiPSC-CMs.Houd de spuit vast en plaats een naald van drie millimeter bij het linker paraxiphoïde proces. Volg onder echografische begeleiding de bovenrand van het diafragma. Observeer het ademhalingsritme en het bereik.Voer het hartzakje in aan het einde van de expiratoire cirkel en vermijd schade aan de lever en de longen. Verkrijg vervolgens het parasternale lange-asbeeld van het muizenhart door B-modus echocardiografie. Injecteer onder ultrasone begeleiding 1 x 10 in de 5e hiPSC-CMs-cellen in elk van de drie marginale gebieden van de infarctplaats.Verwijder de ultrasone sonde en spoel de gelei af. Spenen de muis van de anesthesie en breng hem terug naar zijn kooi. Injecteer cyclosporine A continu gedurende één maand na transplantatie.Echocardiogram van de linker ventrikel toonde aan dat de verwondingen als gevolg van een myocardinfarct omgekeerd waren in de groep met meerdere doses. Transplantatie van hiPSC-CMs resulteerde ook in verhoogde ejectiefractie en fractieverkorting. Meting van hartparameters met behulp van Sirius Red en Fast Green-kleuring toonde aan dat de infarctgrootte en collageenvolumefractie afnamen, terwijl de dikte van de linkerventrikel voorste wand na transplantatie toenam.Etikettering voor niet-specifieke alfa-actine in groen, DAPI in blauw en mensspecifieke troponine T in rood toonde de aanwezigheid van getransplanteerde cellen in infarct en marginaal infarctgebied. Het aantal en het percentage getransplanteerde cellen waren hoger in de groep met meerdere doses in vergelijking met een enkele dosis. 28 dagen na een hartinfarct vertoonde de groep met meerdere doses een toename van het aantal cellen dat de endotheelcelmarker, I-B4, tot expressie bracht.Tarwekiemagglutinine en sarcomerische alfa-actininekleuring op cardiomyocyten vertoonden een vermindering van de minimale vezeldiameter. Een lager aantal tunnelpositieve cardiomyocytenkernen in de groep met meerdere doses duidde op verminderde apoptose. PCR-analyse detecteerde het menselijke mitochondriale DNA alleen in het hart, met specifieke transplantatie.Zorg er bij het inbrengen van de naald voor dat deze de pericardholte binnengaat, samen met de bovenste marge van het diafragma en aan het einde van de expiratoire cirkel om de verwonding aan de lever of de long te voorkomen.

Research

JoVE Journal

Medicine

Implantation of a Carotid Cuff for Triggering Shear-stress Induced Atherosclerosis in Mice

Implantatie van een carotis Cuff voor het activeren van Shear-stress geïnduceerde atherosclerose in Muizen

It is widely accepted that alterations in vascular shear stress trigger the expression of inflammatory genes in endothelial cells and thereby induce ...

Isolation of Cardiomyocyte Nuclei from Post-mortem Tissue

Isolatie van cardiomyocyten Kernen van Post-mortem weefsel

Identification of cardiomyocyte nuclei has been challenging in tissue sections as most strategies rely only on cytoplasmic marker proteins1. Rare events ...

Ultrasound-guided Transthoracic Intramyocardial Injection in Mice

Echogeleide Transthoracale intramyocardiale Injectie in Muizen

Murine models of cardiovascular disease are important for investigating pathophysiological mechanisms and exploring potential regenerative therapies. ...

Substernal Thyroid Biopsy Using Endobronchial Ultrasound-guided Transbronchial Needle Aspiration

Substernale Schildklier Biopsie behulp Endobronchiale Echogeleide transbronchiale Needle Aspiration

Substernal thyroid goiter (STG) represents about 5.8% of all mediastinal lesions1. There is a wide variation in the published incidence rates due to the ...

Targeted and Selective Treatment of Pluripotent Stem Cell-derived Teratomas Using External Beam Radiation in a Small-animal Model

Gerichte en selectieve behandeling van pluripotente stamcel afkomstige Teratomas met behulp van externe Beam straling in een kleine-dier-Model

The growing number of victims of &#34;stem cell tourism,&#34; the unregulated transplantation of stem cells worldwide, has raised concerns about the ...

A Cryoinjury Model to Study Myocardial Infarction in the Mouse

Een Cryoblessure model om myocardinfarct in de muis te bestuderen

The use of animal models is essential for developing new therapeutic strategies for acute coronary syndrome and its complications. In this article, we ...

Sarcomere Shortening of Pluripotent Stem Cell-Derived Cardiomyocytes using Fluorescent-Tagged Sarcomere Proteins.

Sarcomere Verkorting van Pluripotente Stamcel-Afgeleide Cardiomyocyten met behulp van Fluorescerende-Tagged Sarcomere Eiwitten.

Pluripotent stem cell-derived cardiomyocytes (PSC-CMs) can be produced from both embryonic and induced pluripotent stem (ES/iPS) cells. These cells ...

Endoscopic Ultrasound-Guided Biliary Drainage: Endoscopic Ultrasound-Guided Hepaticogastrostomy in Malignant Biliary Obstruction

Endoscopische echogeleide galdrainage: endoscopische echografie-geleide hepaticogastrostomie bij kwaadaardige galwegobstructie

Patients with unresectable malignant biliary obstruction often require biliary drainage to decompress the biliary system. Endoscopic Retrograde ...

Induction of Myocardial Infarction and Myocardial Ischemia-Reperfusion Injury in Mice

Inductie van myocardinfarct en myocardischemie-reperfusieletsel bij muizen

Acute myocardial infarction is a common cardiovascular disease with high mortality. Myocardial reperfusion injury can counteract the beneficial effects of ...

Technical Applications of Microelectrode Array and Patch Clamp Recordings on Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes

Technische toepassingen van micro-elektrode array en patchklemopnamen op door mensen geïnduceerde pluripotente stamcel-afgeleide cardiomyocyten

Drug-induced cardiotoxicity is the leading cause of drug attrition and withdrawal from the market. Therefore, using appropriate preclinical cardiac safety ...