Name: ultrasound-guided induced pluripotent stem cell-derived cardiomyocyte implantation in myocardial infarcted mice
Uploaded: 2022-03-30T15:00:00
Description: Watch this Scientific Journal Video about Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice at JoVE.com

이 연구는 중국 국립 자연 과학 재단의 주요 연구 계획 (No. 91539111to JY), 후난 성 과학 기술 핵심 프로젝트 (No. 2020SK53420-JY) 및 후난 성 과학 기술 혁신 프로그램 (2021RC2106-CF)의 지원을 받았습니다.

본 연구의 모든 동물실험은 중남대학교 제2샹야병원 윤리위원회의 검토 및 승인을 받았다. 이 프로토콜에 사용된 모든 재료 및 장비에 대한 자세한 내용은 재료 표를 참조하십시오. 세포 주입, 영상화 및 안락사에 대한 타임라인은 다음과 같다: t0-유도 경색, t1주-영상 및 이식 세포, t2-영상 및 이식 세포, t4-최종 영상화, 안락사 및 조직 수집.
1. hiPSC 배양, 심근...

<ol>
	<li>Leuschner, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+monocyte+kinetics+in+acute+myocardial+infarction+are+sustained+by+extramedullary+monocytopoiesis.">Rapid monocyte kinetics in acute myocardial infarction are sustained by extramedullary monocytopoiesis.</a> The Journal of Experimental Medicine. 209 (1), 123-137 (2012).</li><li>L&#225;z&#225;r, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocyte+renewal+in+the+human+heart:+insights+from+the+fall-out.">Cardiomyocyte renewal in the human heart: insights from the fall-out.</a> European Heart Journal. 38 (30), 2333-2342 (2017).</li><li>Davis, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=State+of+the+art:+cardiac+transplantation.">State of the art: cardiac transplantation.</a> Trends in Cardiovascular Medicine. 24 (8), 341-349 (2014).</li><li>Mancini, D., Colombo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Left+ventricular+assist+devices:+A+rapidly+evolving+alternative+to+transplant.">Left ventricular assist devices: A rapidly evolving alternative to transplant.</a> Journal of the American College of Cardiology. 65 (23), 2542-2555 (2015).</li><li>Zimmermann, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+myocardial+remuscularization.">Translating myocardial remuscularization.</a> Circulation Research. 120 (2), 278-281 (2017).</li><li>Hu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+large-scale+investigation+of+hypoxia-preconditioned+allogeneic+mesenchymal+stem+cells+for+myocardial+repair+in+nonhuman+primates:+Paracrine+activity+without+remuscularization.">A large-scale investigation of hypoxia-preconditioned allogeneic mesenchymal stem cells for myocardial repair in nonhuman primates: Paracrine activity without remuscularization.</a> Circulation Research. 118 (6), 970-983 (2016).</li><li>Kempf, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+differentiation+of+human+pluripotent+stem+cells+in+scalable+suspension+culture.">Cardiac differentiation of human pluripotent stem cells in scalable suspension culture.</a> Nature Protocols. 10 (9), 1345-1361 (2015).</li><li>Chong, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic-stem-cell-derived+cardiomyocytes+regenerate+non-human+primate+hearts.">Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts.</a> Nature. 510 (7504), 273-277 (2014).</li><li>Shiba, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allogeneic+transplantation+of+iPS+cell-derived+cardiomyocytes+regenerates+primate+hearts.">Allogeneic transplantation of iPS cell-derived cardiomyocytes regenerates primate hearts.</a> Nature. 538 (7625), 388-391 (2016).</li><li>Nguyen, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potential+strategies+to+address+the+major+clinical+barriers+facing+stem+cell+regenerative+therapy+for+cardiovascular+disease:+A+review.">Potential strategies to address the major clinical barriers facing stem cell regenerative therapy for cardiovascular disease: A review.</a> JAMA Cardiology. 1 (8), 953-962 (2016).</li><li>Zimmermann, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Remuscularization+of+the+failing+heart.">Remuscularization of the failing heart.</a> The Journal of Physiology. 595 (12), 3685-3690 (2017).</li><li>Hu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplantation+of+hypoxia-preconditioned+mesenchymal+stem+cells+improves+infarcted+heart+function+via+enhanced+survival+of+implanted+cells+and+angiogenesis.">Transplantation of hypoxia-preconditioned mesenchymal stem cells improves infarcted heart function via enhanced survival of implanted cells and angiogenesis.</a> The Journal of Thoracic and Cardiovascular Surgery. 135 (4), 799-808 (2008).</li><li>Feng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heat+shock+improves+Sca-1++stem+cell+survival+and+directs+ischemic+cardiomyocytes+toward+a+prosurvival+phenotype+via+exosomal+transfer:+a+critical+role+for+HSF1/miR-34a/HSP70+pathway.">Heat shock improves Sca-1+ stem cell survival and directs ischemic cardiomyocytes toward a prosurvival phenotype via exosomal transfer: a critical role for HSF1/miR-34a/HSP70 pathway.</a> Stem Cells. 32 (2), 462-472 (2014).</li><li>Fan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocytes+from+CCND2-overexpressing+human+induced-pluripotent+stem+cells+repopulate+the+myocardial+scar+in+mice:+A+6-month+study.">Cardiomyocytes from CCND2-overexpressing human induced-pluripotent stem cells repopulate the myocardial scar in mice: A 6-month study.</a> Journal of Molecular and Cellular Cardiology. 137, 25-33 (2019).</li><li>Lou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-cadherin+overexpression+enhances+the+reparative+potency+of+human-induced+pluripotent+stem+cell-derived+cardiac+myocytes+in+infarcted+mouse+hearts.">N-cadherin overexpression enhances the reparative potency of human-induced pluripotent stem cell-derived cardiac myocytes in infarcted mouse hearts.</a> Cardiovascular Research. 116 (3), 671-685 (2020).</li><li>Sun, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplanted+microvessels+improve+pluripotent+stem+cell-derived+cardiomyocyte+engraftment+and+cardiac+function+after+infarction+in+rats.">Transplanted microvessels improve pluripotent stem cell-derived cardiomyocyte engraftment and cardiac function after infarction in rats.</a> Science Translational Medicine. 12 (562), (2020).</li><li>Wu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+repair+with+echocardiography-guided+multiple+percutaneous+left+ventricular+intramyocardial+injection+of+hiPSC-CMs+after+myocardial+infarction.">Cardiac repair with echocardiography-guided multiple percutaneous left ventricular intramyocardial injection of hiPSC-CMs after myocardial infarction.</a> Frontiers in Cardiovascular Medicine. 8, 768873 (2021).</li><li>Kannappan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionally+competent+DNA+damage-free+induced+pluripotent+stem+cell-derived+cardiomyocytes+for+myocardial+repair.">Functionally competent DNA damage-free induced pluripotent stem cell-derived cardiomyocytes for myocardial repair.</a> Circulation. 140 (6), 520-522 (2019).</li><li>Lou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-cadherin+overexpression+enhances+the+reparative+potency+of+human-induced+pluripotent+stem+cell-derived+cardiac+myocytes+in+infarcted+mouse+hearts.">N-cadherin overexpression enhances the reparative potency of human-induced pluripotent stem cell-derived cardiac myocytes in infarcted mouse hearts.</a> Cardiovascular Research. 116 (3), 671-685 (2020).</li><li>Zhao, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Y-27632+preconditioning+enhances+transplantation+of+human-induced+pluripotent+stem+cell-derived+cardiomyocytes+in+myocardial+infarction+mice.">Y-27632 preconditioning enhances transplantation of human-induced pluripotent stem cell-derived cardiomyocytes in myocardial infarction mice.</a> Cardiovascular Research. 115 (2), 343-356 (2019).</li><li>Zhao, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+the+engraftment+of+human+induced+pluripotent+stem+cell-derived+cardiomyocytes+via+a+transient+inhibition+of+rho+kinase+activity.">Enhancing the engraftment of human induced pluripotent stem cell-derived cardiomyocytes via a transient inhibition of rho kinase activity.</a> Journal of Visualized Experiments: JoVE. (149), e59452 (2019).</li><li>O'Brien, J., Hayder, H., Peng, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+quantification+and+analysis+of+cell+counting+procedures+using+ImageJ+plugins.">Automated quantification and analysis of cell counting procedures using ImageJ plugins.</a> Journal of Visualized Experiments: JoVE. (117), e54719 (2016).</li><li>Kain, V., Prabhu, S. D., Halade, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammation+revisited:+inflammation+versus+resolution+of+inflammation+following+myocardial+infarction.">Inflammation revisited: inflammation versus resolution of inflammation following myocardial infarction.</a> Basic Research in Cardiology. 109 (6), 444 (2014).</li><li>Rainer, P. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiomyocyte-specific+transforming+growth+factor+&#946;+suppression+blocks+neutrophil+infiltration,+augments+multiple+cytoprotective+cascades,+and+reduces+early+mortality+after+myocardial+infarction.">Cardiomyocyte-specific transforming growth factor &#946; suppression blocks neutrophil infiltration, augments multiple cytoprotective cascades, and reduces early mortality after myocardial infarction.</a> Circulation Research. 114 (8), 1246-1257 (2014).</li><li>Yu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cell-derived+cardiomyocyte+therapy+in+mouse+permanent+ischemia+and+ischemia-reperfusion+models.">Human embryonic stem cell-derived cardiomyocyte therapy in mouse permanent ischemia and ischemia-reperfusion models.</a> Stem Cell Research &amp; Therapy. 10 (1), 167 (2019).</li><li>Iwanaga, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+G-CSF+on+cardiac+remodeling+after+acute+myocardial+infarction+in+swine.">Effects of G-CSF on cardiac remodeling after acute myocardial infarction in swine.</a> Biochemical and Biophysical Research Communications. 325 (4), 1353-1359 (2004).</li></ol>

이 연구의 중요한 단계에는 hiPSC 배양, 심근 세포 분화, hiPSC-CM 정제 및 마우스 심근 경색 부위로의 hiPSC-CM 이식이 포함됩니다. 핵심은 심장 초음파를 사용하여 hiPSC-CM이 해당 부위에 주입된 경색 가장자리의 경색 부위로 경피적으로 치료를 안내하는 것입니다.
배양 시간이 길어짐에 따라 hiPSC-CM 표현형은 시간이 지남에 따라 분화에 따라 형태(더 큰 세포 크기), 구조(근육, 섬유?...

급성 MI가 발생하면 경색 부위의 심근 세포가 허혈과 저산소증으로 인해 빠르게 죽습니다. 세포 사멸 및 파열 후 여러 염증 인자가 방출되는 반면, 염증 세포는 경색 부위에 침투하여 염증을 유발합니다1. 의미심장하게도, 수축성과 전기 전도성이 없는 섬유아세포와 콜라겐은 경색 부위의 심근 세포를 대체하여 흉터 조직을 형성합니다. 성인 포유류에서 심근 세포의 제한된 재생 능력으로 인해, 넓은 면적의 경색 후에 형성되는 생존 조직은 일반적으로 충분한 심박출량을 유지하기에 적합하지 않다2. 심근경색은 심부전을 일으키며, 심한 심부전의 경우 환자는 정상적인 심장 기능을 유지하기 위해 심장 이식 또는 심실 보조 장치에만 의존할 수 있습니다 3,4.
MI 후 이상적인 치료 전략은 죽은 심근 세포를 새로 형성된 심근 세포로 대체하여 건강한 조직과 전기 기계적 결합을 형성하는 것입니다. 그러나 치료 옵션은 일반적으로 교체보다는 심근 구제를 채택했습니다. 현재, 줄기 세포 및 전구 세포 기반 요법은 MI5 후 심근 복구를 촉진하는 가장 유망한 전략 중 하나입니다. 그러나, 이들 세포의 이식은 몇 가지 문제를 가지고 있는데, 주로 성체 줄기세포가 심근 세포로 분화할 수 없고 수명이 짧다는 점이 있다6.
배아 줄기 세포(ES) 세포의 사용과 관련된 윤리적 문제는 유망한 세포 공급원인 iPSC에 의해 우회될 수 있습니다. 또한, iPSC는 강력한 자가 재생 능력을 가지고 있으며 심근 세포로 분화할 수 있다7. 연구에 따르면 MI 부위에 이식된 hiPSC-CM은 생존할 수 있고 숙주 세포와 갭 접합을 형성할 수 있습니다 8,9. 그러나, 이러한 이식된 세포는 허혈 및 염증의 미세환경에 위치하기 때문에, 이들의 생존율은 극히 낮다10,11.
이식된 세포의 생존율을 향상시키기 위해 저산소증과 열충격 전처리(12,13), 유전자 변형(gene modification)14,15, 세포와 모세혈관의 동시 이식(16) 등 여러 가지 방법이 확립되었다. 불행히도 대부분의 방법은 복잡성과 높은 비용으로 인해 제한됩니다. 따라서, 본 연구에서는 재현 가능하고 편리하며 비교적 침습적이며 효과적인 hiPSC-CM 전달 방법을 제안한다.
초음파 유도 심근 내 세포 주입은 부위에 관계없이 고해상도 소형 수의학 초음파 기계와 미세 주입기만으로 수행 할 수 있습니다. 초음파 유도에 따라 심낭에서 생쥐의 심근으로 검상돌기 과정에 따라 세포를 직접 전달하는 것은 간 및 폐 손상을 방지하는 안전한 프로토콜입니다. 이 방법은 이식 된 세포의 생존율을 크게 향상시키기 위해 다른 기술과 동시에 결합 될 수 있습니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibody</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cardiac troponin T</td>
			<td>Abcam</td>
			<td>ab8295</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Mouse IgG H&#38;L (Alexa Fluor 488)</td>
			<td>Abcam</td>
			<td>ab150105</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Mouse IgG H&#38;L (Alexa Fluor 555)</td>
			<td>Abcam</td>
			<td>ab150110</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Rabbit IgG H&#38;L (Alexa Fluor 488)</td>
			<td>Abcam</td>
			<td>ab150073</td>
			<td></td>
		</tr>
		<tr>
			<td>Donkey Anti-Rabbit IgG H&#38;L (Alexa Fluor 555)</td>
			<td>Abcam</td>
			<td>ab150062</td>
			<td></td>
		</tr>
		<tr>
			<td>Human cardiac troponin T</td>
			<td>Abcam</td>
			<td>ab91605</td>
			<td></td>
		</tr>
		<tr>
			<td>Isolectin B4</td>
			<td>Vector</td>
			<td>FL-1201</td>
			<td></td>
		</tr>
		<tr>
			<td>Sarcomeric alpha actinin</td>
			<td>Abcam</td>
			<td>ab9465</td>
			<td></td>
		</tr>
		<tr>
			<td>Wheat germ agglutinin</td>
			<td>Thermo Fisher Scientific</td>
			<td>W11261</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>Thermo Fisher Scientific</td>
			<td>00-4555-56</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 Supplement(minus insulin)</td>
			<td>Thermo Fisher Scientific</td>
			<td>A1895601</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 Supplement(serum free)</td>
			<td>Thermo Fisher Scientific</td>
			<td>17&#8211;504-044</td>
			<td></td>
		</tr>
		<tr>
			<td>Bouin&#39;s solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>SDHT10132</td>
			<td></td>
		</tr>
		<tr>
			<td>CHIR99021</td>
			<td>Selleck</td>
			<td>CT99021</td>
			<td></td>
		</tr>
		<tr>
			<td>cyclosporin A</td>
			<td>Medchemexpress</td>
			<td>HY-B0579</td>
			<td></td>
		</tr>
		<tr>
			<td>DIRECT RED</td>
			<td>Sigma-Aldrich</td>
			<td>365548-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Thermo Fisher Scientific</td>
			<td>11320033</td>
			<td></td>
		</tr>
		<tr>
			<td>DNeasy Blood &#38; Tissue Kit</td>
			<td>Qiagen</td>
			<td>69504</td>
			<td></td>
		</tr>
		<tr>
			<td>FAST GREEN FCF</td>
			<td>Sigma-Aldrich</td>
			<td>&#160;F7252-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose-free RPMI 1640</td>
			<td>Thermo Fisher Scientific</td>
			<td>11879020</td>
			<td></td>
		</tr>
		<tr>
			<td>IWR1</td>
			<td>Selleck</td>
			<td>S7086</td>
			<td></td>
		</tr>
		<tr>
			<td>lactic acid</td>
			<td>Sigma-Aldrich</td>
			<td>L6661</td>
			<td></td>
		</tr>
		<tr>
			<td>Matrigel</td>
			<td>BD Biosciences</td>
			<td>BD356234</td>
			<td></td>
		</tr>
		<tr>
			<td>mTeSR1</td>
			<td>Stem Cell Technologies</td>
			<td>72562</td>
			<td></td>
		</tr>
		<tr>
			<td>O.C.T. Compound</td>
			<td>SAKURA</td>
			<td>4583</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma-Aldrich</td>
			<td>158127</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUP SYBR Green MasterMix kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI1640</td>
			<td>Thermo Fisher Scientific</td>
			<td>11875119</td>
			<td></td>
		</tr>
		<tr>
			<td>STEMdif Cardiomyocyte Freezing Medium/STEMdiff</td>
			<td>Stem Cell Technologies</td>
			<td>5030</td>
			<td></td>
		</tr>
		<tr>
			<td>STEMdiff Cardiomyocyte Support Medium</td>
			<td>Stem Cell Technologies</td>
			<td>5027</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td></td>
		</tr>
		<tr>
			<td>ultrasound coupling agent</td>
			<td>CARENT</td>
			<td>22396269389</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632</td>
			<td>Selleck</td>
			<td>S6390</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment and Supplies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Applied Biosystems</td>
			<td>Thermo Fisher Scientific</td>
			<td>7500 Real-Time PCR</td>
			<td></td>
		</tr>
		<tr>
			<td>cryostat</td>
			<td>Leica</td>
			<td>CM1950</td>
			<td></td>
		</tr>
		<tr>
			<td>fluoresence microscope</td>
			<td>Olympus</td>
			<td>IX83</td>
			<td></td>
		</tr>
		<tr>
			<td>fine anatomical scissors</td>
			<td>Fine Science Tools</td>
			<td>15000-08</td>
			<td></td>
		</tr>
		<tr>
			<td>fine dissecting forceps</td>
			<td>Fine Science Tools</td>
			<td>11255-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Micro syringe</td>
			<td>Hamilton</td>
			<td>7633</td>
			<td></td>
		</tr>
		<tr>
			<td>Small animal anesthesia machine</td>
			<td>MATRX</td>
			<td>VMR</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-high resolution small animal ultrasound imaging system</td>
			<td>VisualSonics</td>
			<td>Vevo 2100</td>
			<td></td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Statistical Product and Service Solutions</td>
			<td>IBM</td>
			<td>21</td>
			<td></td>
		</tr>
		<tr>
			<td>Image J</td>
			<td>NIH</td>
			<td>1.48</td>
			<td></td>
		</tr>
		<tr>
			<td>Human mitochondrial DNA primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>the forward primer sequence</td>
			<td>CCGCTACCATAATCATCGCTAT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>the reverse primer sequence</td>
			<td>TGCTAATACAATGCCAGTCAGG</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

ultrasound-guided induced pluripotent stem cell-derived cardiomyocyte implantation in myocardial infarcted mice

심근경색(MI) 후 세포 치료의 주요 목적은 세포 이식률을 효과적으로 향상시키는 것이며, 인간 유도만능줄기세포 유래 심근세포(hiPSC-CM)는 허혈성 손상 후 심장 복구를 위한 유망한 세포 공급원입니다. 그러나 낮은 이식률은 이식 후 효과적인 심장 조직 재생에 중요한 장애물입니다. 이 프로토콜은 MI 영역에 여러 hiPSC-CM 초음파 유도 경피 주사가 세포 이식 속도를 효과적으로 증가시킨다는 것을 보여줍니다. 이 연구는 또한 전체 hiPSC-CM 배양 과정, 전처리 및 초음파 유도 경피적 전달 방법에 대해 설명합니다. 또한 인간 미토콘드리아 DNA를 사용하면 다른 마우스 기관에서 hiPSC-CM의 부재를 감지하는 데 도움이 됩니다. 마지막으로, 본 논문은 세포 전달 후 4주 동안 마우스의 경색된 경계 영역에서의 심장 기능, 혈관신생, 세포 크기 및 세포자멸사의 변화를 설명합니다. 좌심실 심근의 심 초음파 유도 경피 주사는 실현 가능하고 상대적으로 침습적이며 만족스럽고 반복 가능하며 효과적인 세포 요법이라고 결론 지을 수 있습니다.

각 그룹에서 마우스의 좌심실 기능을 평가하기 위한 심초음파는 MI 손상이 MD 그룹에서 효과적으로 역전되었음을 보여주었습니다(그림 2A). MI 그룹과 비교하여 SD 그룹은 박출률(EF)이 증가한 것으로 나타났습니다(30%에서 35%로; 그림 2B) 및 분획 단축 (FS) (18 %에서 22 %까지; 그림 2C) MI 후. 그러나 MD 그룹 마우스에서 hiPSC-CM을 여러 번 주...

Watch this Scientific Journal Video about Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice at JoVE.com

Ultrasound-Guided Induced Pluripotent Stem Cell-Derived Cardiomyocyte Implantation in Myocardial Infarcted Mice

생쥐의 심근 경색 부위 주변의 초음파 유도 세포 전달은 안전하고 효과적이며 편리한 세포 이식 방법입니다.

심근 경색 마우스에서 초음파 유도 유도 만능 줄기 세포 유래 심근 세포 이식

The key objective of cell therapy after myocardial infarction (MI) is to effectively enhance the cell grafted rate, and human induced pluripotent stem ...

이것은 심근 세포의 심 초음파 유도 경피적 심근 내 주사가 인간 iPS 유래 심근 세포의 회복 특성을 크게 향상 시킨다는 것을 입증 한 첫 번째 보고서입니다. 이 방법은 인간 iPS 유래 심근세포 치료를 전달하기 위한 실현 가능하고 만족스럽고 반복 가능하며 덜 침습적이며 효과적인 절차입니다. 우리는 경피적 심근내 전달이 허혈성 심장 질환, 심근 경색 및 심부전을 포함한 질병에 대한 국소 약물 전달을 위한 안전하고 효율적인 방법이라고 믿습니다.이 프로젝트는 Jinfu Yang 교수와 Jun Peng 교수가 감독합니다. 이 절차를 시연하는 것은 Xun Wu, Kele Qin 및 Kun Xiang, 내 실험실의 MD PhD와 Hunan Provincial Key Laboratory of Cardiovascular Research의 PhD 인 Di Wang이 될 것입니다. 시작하려면 hiPSC-CM의 60일 배양에서 배양 상청액을 진공 흡인합니다.세포를 PBS로 세 번 세척한다. 그런 다음 섭씨 37도에서 3-5분 동안 세포 분리 효소 혼합물을 사용하여 hiPSC-CM을 개별 세포로 해리합니다. 5밀리리터의 RPMI와 B27 배지가 들어 있는 15밀리리터 튜브에 세포를 수집하고 혼합합니다.셀을 세고 총 셀 수를 계산합니다. 세포 현탁액을 실온에서 2분 동안 300G에서 원심분리한다. 상청액을 버리고 펠릿을 심근 세포 지지 배지에 마이크로리터당 4번째 세포의 6 x 10 농도로 재현탁합니다.주입 단계까지 튜브를 섭씨 37도에 놓습니다. 마우스를 충분히 마취 한 후 팔다리와 꼬리를 테이프로 고정하십시오. 그런 다음 마우스 앞니를 2/0 실크 실과 테이프로 고정합니다.중앙 목과 왼쪽 가슴을 베타인을 세 번 번갈아 가며 소독한 다음 알코올을 주입합니다. 미세한 해부학적 가위와 미세 해부 집게를 사용하여 중앙 목 절개를 합니다. 기관을 안정시키고 완전히 노출시키기 위해 몇 개의 전방 자궁 경부 근육을 잘라냅니다.20게이지 카테터 천자 바늘을 기관 튜브로 입을 통해 삽입합니다. 기관 튜브를 인공 호흡기에 연결하고 흉부 움직임을 확인하여 양쪽 폐가 잘 환기되는지 확인하십시오. 호흡 매개 변수를 조정하십시오.그런 다음 왼쪽 뒷다리를 오른쪽 하단에 다시 고정하고 왼쪽 상지 주위의 테이프를 풉니다. 미세 해부 가위와 집게를 사용하여 왼쪽 흉부의 3-4 늑간 공간에서 개흉술을 시행하십시오. 집게를 사용하여 심낭을 떼어내고 왼쪽 전방 하행 관상 동맥을 찾습니다.6/0 실크 실을 사용하여 동맥의 근위 끝을 결찰합니다. 급성 심근경색 모델이 확립되도록 하려면 결찰 부위의 동맥 원위부가 빨간색에서 흰색으로 바뀔 때까지 기다리십시오. 가슴을 층별로 닫고 4/0 실로 피부를 봉합하십시오.가짜 동물 그룹의 경우 결찰을 제외한 모든 수술 절차를 수행하십시오. 심근 경색 후 처음 2 주 동안 마우스를 5 % 이소 플루오란과 연결된 마취 상자에 넣고 기관 삽관을 시행합니다. hiPSC-CM을 투여하기 3 일 전에 사이클로스포린 A를 하루 킬로그램 당 10 밀리그램의 용량으로 복강 내 주사하십시오.탈모 크림으로 마우스의 가슴과 상복부에서 머리카락을 제거하십시오. 심박수가 분당 400 내지 500 비트로 유지될 때까지 흡입 이소플루오란을 공급한다. 감지 콘솔에 테이프로 마우스 팔다리와 꼬리를 고정하고 플랫폼 온도를 섭씨 37도로 설정합니다.상복부에 초음파 젤리를 바릅니다. 고해상도 수의학 초음파 프로브를 사용하여 마우스 간 이미지를 얻습니다. 5마이크로리터 마이크로 주사기를 사용하여 약 3 x 10을 5번째 hiPSC-CM에 그립니다.주사기를 잡고 왼쪽 paraxiphoid process에 3 밀리미터 바늘을 삽입하십시오. 초음파 유도에서 다이어프램의 상단 가장자리를 따르십시오. 호흡 리듬과 범위를 관찰하십시오.호기 원의 끝에서 심낭에 들어가 간과 폐의 손상을 피하십시오. 그런 다음 B 모드 심초음파로 마우스 심장의 흉골주위 장축 이미지를 획득합니다. 초음파 유도하에 1 x 10을 5번째 hiPSC-CMs 세포에 경색 부위의 3개 가장자리 영역 각각에 주입합니다.초음파 프로브를 제거하고 젤리를 헹굽니다. 마우스를 마취에서 떼어 내고 새장으로 되돌립니다. 사이클로스포린 A를 이식 후 1개월 동안 지속적으로 주사합니다.좌심실의 심초음파는 심근경색으로 인한 손상이 다회 투여군에서 역전된 것으로 나타났다. hiPSC-CM의 이식은 또한 박출률 증가 및 분획 단축을 가져왔다. 시리우스 레드(Sirius Red) 및 패스트 그린(Fast Green) 염색을 이용한 심장 파라미터 측정은 이식 후 경색 크기와 콜라겐 부피 분율이 감소한 반면, 좌심실 전벽 두께는 증가한 것으로 나타났다.녹색의 비특이적 알파 액틴, 파란색의 DAPI 및 빨간색의 인간 특이적 트로포닌 T에 대한 표지는 경색 및 변연부 경색 영역에 이식된 세포의 존재를 보여주었습니다. 이식된 세포의 수 및 백분율은 단일 투여에 비해 다중 투여군에서 더 높았다. 심근 경색 28일 후, 다중 투여 그룹은 내피 세포 마커인 I-B4를 발현하는 세포의 수의 증가를 보였다.심근 세포에 대한 밀 배아 응집소 및 육종 알파 액티닌 염색은 최소 섬유 직경의 감소를 보여주었습니다. 다중 투여군에서 터널 양성 심근세포 핵의 수가 적을수록 세포자멸사 감소를 나타냅니다. PCR 분석은 심장에서만 인간 미토콘드리아 DNA를 검출하여 특이적 이식을 보여주었습니다.바늘을 삽입할 때 간이나 폐의 손상을 방지하기 위해 횡격막의 위쪽 가장자리와 호기원의 끝과 함께 심낭강에 들어가야 합니다.

Research

JoVE Journal

Medicine

Implantation of a Carotid Cuff for Triggering Shear-stress Induced Atherosclerosis in Mice

마우스의 전단 응력 유발 죽상 경화증을 실행을위한 경동맥 혈압계의 주입

It is widely accepted that alterations in vascular shear stress trigger the expression of inflammatory genes in endothelial cells and thereby induce ...

연구

의학

Isolation of Cardiomyocyte Nuclei from Post-mortem Tissue

사후 조직에서 Cardiomyocyte 핵의 분리

Identification of cardiomyocyte nuclei has been challenging in tissue sections as most strategies rely only on cytoplasmic marker proteins1. Rare events ...

Ultrasound-guided Transthoracic Intramyocardial Injection in Mice

마우스의 초음파 유도 경 흉부 심근 내 주입

Murine models of cardiovascular disease are important for investigating pathophysiological mechanisms and exploring potential regenerative therapies. ...

Substernal Thyroid Biopsy Using Endobronchial Ultrasound-guided Transbronchial Needle Aspiration

흉골 하 갑상선 조직 검사는 기관지 초음파 유도 기관지 바늘 흡인을 사용하여

Substernal thyroid goiter (STG) represents about 5.8% of all mediastinal lesions1. There is a wide variation in the published incidence rates due to the ...

Targeted and Selective Treatment of Pluripotent Stem Cell-derived Teratomas Using External Beam Radiation in a Small-animal Model

만능 줄기 세포 유래 Teratomas 외부 빔 방사선을 사용 하 여 작은 동물 모델에서의 타겟 및 선택적 치료

The growing number of victims of &#34;stem cell tourism,&#34; the unregulated transplantation of stem cells worldwide, has raised concerns about the ...

A Cryoinjury Model to Study Myocardial Infarction in the Mouse

마우스에서 심근 경색을 연구하는 극저온 손상 모델

The use of animal models is essential for developing new therapeutic strategies for acute coronary syndrome and its complications. In this article, we ...

Sarcomere Shortening of Pluripotent Stem Cell-Derived Cardiomyocytes using Fluorescent-Tagged Sarcomere Proteins.

형광 태그 사코레 단백질을 사용하여 다능줄기 세포 유래 심근 세포의 Sarcomere 단축.

Pluripotent stem cell-derived cardiomyocytes (PSC-CMs) can be produced from both embryonic and induced pluripotent stem (ES/iPS) cells. These cells ...

Endoscopic Ultrasound-Guided Biliary Drainage: Endoscopic Ultrasound-Guided Hepaticogastrostomy in Malignant Biliary Obstruction

내시경 초음파 유도 담즙 배수: 악성 담즙 방해에 내시경 초음파 유도 간 부간 위증 절제술

Patients with unresectable malignant biliary obstruction often require biliary drainage to decompress the biliary system. Endoscopic Retrograde ...

Induction of Myocardial Infarction and Myocardial Ischemia-Reperfusion Injury in Mice

마우스의 심근경색 및 심근 허혈-재관류 손상 유도

Acute myocardial infarction is a common cardiovascular disease with high mortality. Myocardial reperfusion injury can counteract the beneficial effects of ...

Technical Applications of Microelectrode Array and Patch Clamp Recordings on Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes

인간 유도 만능 줄기 세포 유래 심근 세포에 대한 미세 전극 어레이 및 패치 클램프 기록의 기술적 응용

Drug-induced cardiotoxicity is the leading cause of drug attrition and withdrawal from the market. Therefore, using appropriate preclinical cardiac safety ...