Name: lentiviral mediated delivery of shrnas to hescs and npcs using low-cost cationic polymer polyethylenimine (pei)
Uploaded: 2022-05-24T15:00:00
Description: Watch this Scientific Journal Video about Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI at JoVE.com

이 연구는 아랍 에미리트 대학 (UAEU), 보조금 # 31R170 (건강 과학을위한 Zayed 센터) 및 # 12R010 (UAEU-AUA 보조금)의 연구 보조금에 의해 지원되었습니다. 우리는 Randall Morse 교수 (Wadsworth Center, Albany, NY)가 스타일과 문법을 위해 원고를 편집 할 수 있도록 도와 주신 것에 감사드립니다.
모든 데이터는 요청시 사용할 수 있습니다.

1. PEI 또는 리포펙타민 3000 시약을 사용한 HEK293T 세포의 형질감염
<ol><li>HEK293T 세포를 형질감염을 위해 시딩하기 전에 90% 합류할 때까지 5% CO2 및21% O2의 대기를 갖는 가습된 인큐베이터에서 37°C에서 DMEM + 10% FBS + 1x 페니실린/스트렙토마이신으로 배양한다. 높은 역가 바이러스 생산을 위해 상대적으로 낮은 통과 수의 세포를 사용하십시오 (이상적으로는 P30 미만).</li>
	<...

<ol>
	<li>Thomson, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+derived+from+human+blastocysts.">Embryonic stem cell lines derived from human blastocysts.</a> Science. 282 (5391), 1145-1147 (1998).</li><li>Reubinoff, B. E., Pera, M. F., Fong, C. Y., Trounson, A., Bongso, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+from+human+blastocysts:+Somatic+differentiation+in+vitro.">Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro.</a> Nature Biotechnology. 18 (4), 399-404 (2000).</li><li>Strulovici, Y., Leopold, P. L., O'Connor, T. P., Pergolizzi, R. G., Crystal, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+embryonic+stem+cells+and+gene+therapy.">Human embryonic stem cells and gene therapy.</a> Molecular Therapy. 15 (5), 850-866 (2007).</li><li>Kane, N., McRae, S., Denning, C., Baker, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+and+nonviral+gene+delivery+and+its+role+in+pluripotent+stem+cell+engineering.">Viral and nonviral gene delivery and its role in pluripotent stem cell engineering.</a> Drug Discovery Today. Technologies. 5 (4), 105 (2008).</li><li>Li, S. D., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonviral+is+superior+to+viral+gene+delivery.">Nonviral is superior to viral gene delivery.</a> Journal of Controlled Release. 123 (3), 181-183 (2007).</li><li>Mastrobattista, E., Bravo, S. A., vander Aa, M., Crommelin, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonviral+gene+delivery+systems:+From+simple+transfection+agents+to+artificial+viruses.">Nonviral gene delivery systems: From simple transfection agents to artificial viruses.</a> Drug Discovery Today. Technologies. 2 (1), 103-109 (2005).</li><li>Cao, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+gene-transfer+efficiency+in+human+embryonic+stem+cells.">Comparison of gene-transfer efficiency in human embryonic stem cells.</a> Molecular Imaging and Biology. 12 (1), 15-24 (2010).</li><li>Mohr, J. C., de Pablo, J. J., Palecek, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+human+embryonic+stem+cells:+Small+and+macromolecule+loading+and+DNA+transfection.">Electroporation of human embryonic stem cells: Small and macromolecule loading and DNA transfection.</a> Biotechnology Progress. 22 (3), 825-834 (2006).</li><li>Sukhorukov, V. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surviving+high-intensity+field+pulses:+Strategies+for+improving+robustness+and+performance+of+electrotransfection+and+electrofusion.">Surviving high-intensity field pulses: Strategies for improving robustness and performance of electrotransfection and electrofusion.</a> The Journal of Membrane Biology. 206 (3), 187-201 (2005).</li><li>Floch, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cationic+phosphonolipids+as+non+viral+vectors+for+DNA+transfection+in+hematopoietic+cell+lines+and+CD34++cells.">Cationic phosphonolipids as non viral vectors for DNA transfection in hematopoietic cell lines and CD34+ cells.</a> Blood Cells, Molecules and Diseases. 23 (1), 69-87 (1997).</li><li>Lakshmipathy, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transfection+of+embryonic+and+adult+stem+cells.">Efficient transfection of embryonic and adult stem cells.</a> Stem Cells. 22 (4), 531-543 (2004).</li><li>Siemen, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleofection+of+human+embryonic+stem+cells.">Nucleofection of human embryonic stem cells.</a> Stem Cells and Development. 14 (4), 378-383 (2005).</li><li>Zhang, X., Godbey, W. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+vectors+for+gene+delivery+in+tissue+engineering.">Viral vectors for gene delivery in tissue engineering.</a> Advanced Drug Delivery Reviews. 58 (4), 515-534 (2006).</li><li>Ma, Y., Ramezani, A., Lewis, R., Hawley, R. G., Thomson, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-level+sustained+transgene+expression+in+human+embryonic+stem+cells+using+lentiviral+vectors.">High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors.</a> Stem Cells. 21 (1), 111-117 (2003).</li><li>Gropp, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+genetic+modification+of+human+embryonic+stem+cells+by+lentiviral+vectors.">Stable genetic modification of human embryonic stem cells by lentiviral vectors.</a> Molecular Therapy. 7 (2), 281-287 (2003).</li><li>Tan, E., Chin, C. S. H., Lim, Z. F. S., Ng, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HEK293+cell+line+as+a+platform+to+produce+recombinant+proteins+and+viral+vectors.">HEK293 cell line as a platform to produce recombinant proteins and viral vectors.</a> Frontiers in Bioengineering and Biotechnology. 9, 796991 (2021).</li><li>Merten, O. W., Hebben, M., Bovolenta, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+lentiviral+vectors.">Production of lentiviral vectors.</a> Molecular Therapy: Methods &amp; Clinical Development. 3, 16017 (2016).</li><li>Lungwitz, U., Breunig, M., Blunk, T., G&#246;pferich, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+nonviral+gene+delivery+systems.">Polyethylenimine-based nonviral gene delivery systems.</a> European Journal of Pharmaceutics and Biopharmaceutics. 60 (2), 247-266 (2005).</li><li>Parween, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher+O-GlcNAc+levels+are+associated+with+defects+in+progenitor+proliferation+and+premature+neuronal+differentiation+during+in-vitro+human+embryonic+cortical+neurogenesis.">Higher O-GlcNAc levels are associated with defects in progenitor proliferation and premature neuronal differentiation during in-vitro human embryonic cortical neurogenesis.</a> Frontiers in Cellular Neuroscience. 11, 415 (2017).</li><li>Weissinger, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+in+purified+human+hematopoietic+peripheral-blood+stem+cells+by+means+of+electroporation+without+prestimulation.">Gene transfer in purified human hematopoietic peripheral-blood stem cells by means of electroporation without prestimulation.</a> Journal of Laboratory and Clinical Medicine. 141 (2), 138-149 (2003).</li><li>Cui, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+transgene+expression+to+antigen-presenting+cells+derived+from+lentivirus-transduced+engrafting+human+hematopoietic+stem/progenitor+cells.">Targeting transgene expression to antigen-presenting cells derived from lentivirus-transduced engrafting human hematopoietic stem/progenitor cells.</a> Blood. 99 (2), 399-408 (2002).</li><li>Yu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+vectors+with+two+independent+internal+promoters+transfer+high-level+expression+of+multiple+transgenes+to+human+hematopoietic+stem-progenitor+cells.">Lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells.</a> Molecular Therapy. 7 (6), 827-838 (2003).</li><li>Sweeney, N. P., Vink, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+impact+of+lentiviral+vector+genome+size+and+producer+cell+genomic+to+gag-pol+mRNA+ratios+on+packaging+efficiency+and+titre.">The impact of lentiviral vector genome size and producer cell genomic to gag-pol mRNA ratios on packaging efficiency and titre.</a> Molecular Therapy - Methods &amp; Clinical Development. 21, 574-584 (2021).</li></ol>

연구 또는 임상 목적을 위해 줄기 세포를 유 전적으로 변형시키는 능력은 hESC의 생물학에 대한 기술과 기본적인 이해에 의해 제한됩니다. 리포펙션 및 전기천공과 같은 마우스 ESC에서 상당한 잠재력을 보인 기술은 hESC에 대해 매우 효율적이지 않으며, 이는 통상적인 방법(20)에 의한 유전자 전달에 대해 악명 높게 어렵다. 이 개념은 기존 기술의 최적화뿐만 아니라 hESC에서 형질감...

배반포 내부 세포괴로부터 유래된 인간 배아줄기세포(hESCs)는 다능성이며, 시험관내 조건 1,2 하에서 외부 인자에 따라 상이한 세포 유형으로 분화될 수 있다. hESC의 잠재력을 완전히 활용하기 위해서는 이러한 세포에 대한 신속하고 신뢰할 수있는 유전자 전달 방법이 필수적입니다. 종래, 사용된 기술은 크게 두 가지 유형으로 분류될 수 있다: 비바이러스성 및 바이러스 유전자 전달 시스템(3,4). 더 자주 사용되는 비바이러스 유전자 전달 시스템은 리포펙션, 전기천공 및 핵형성이다. 비바이러스 전달 시스템은 더 적은 삽입 돌연변이 및 면역원성의 전반적인 감소 5,6 때문에 유리하다. 그러나, 이들 방법은 낮은 형질감염 효율 및 짧은 일시적 유전자 발현의 기간을 초래하며, 이는 장기 분화 연구7에 대한 주요한 한계이다. 전기천공은 리포펙션에 비해 더 나은 형질감염 효율을 초래한다; 그러나, 50% 이상의 세포 사멸 8,9,10을 초래한다. 핵을 사용하여, 세포 생존 및 형질감염 효율은 리포펙션과 전기천공을 결합함으로써 개선될 수 있지만, 접근법은 세포-특이적 완충액 및 특수 장비를 필요로 하며, 따라서, 스케일업 응용(11,12)을 위해 상당히 비용이 많이 든다.
대조적으로, 바이러스 벡터는 형질도입 후 개선된 형질감염 효율뿐만 아니라 전반적으로 낮은 세포독성을 나타냈다. 또한, 전달된 유전자는 안정적으로 발현되고, 따라서, 이 방법은 장기 연구13에 이상적이다. hESCs로의 유전자 전달을 위해 가장 일반적으로 사용되는 바이러스 벡터 중에는 높은 역가 바이러스 입자14,15를 사용하여 80% 이상의 형질도입 효율을 제공할 수 있는 렌티바이러스 벡터(LVS)가 있다. 리포펙션 및CaPO4 침전은 렌티바이러스 입자(16)를 수득하기 위해 패키징 플라스미드와 함께 HEK293T 세포 또는 그의 유도체를 유전자 전달 벡터로 일시적으로 형질감염시키는 데 가장 일반적으로 사용되는 방법 중 하나이다. 지방 감염은 좋은 형질감염 효율과 낮은 세포 독성을 초래하지만,이 기술은 비용에 의해 방해 받고 높은 역가 렌티 바이러스 입자를 얻기 위해 확장하는 것은 매우 비쌉니다. CaPO4 침전은 리포펙션을 사용하여 수득된 것과 비교적 유사한 형질감염 효율을 초래한다. 비용 효율적이지만, CaPO4 침전은 형질감염 후 상당한 세포 사멸을 초래하며, 이는 표준화를 어렵게 하고 배치-배치-배치 변이(batch-to-batch) 변이를 피한다(17). 이 시나리오에서, 높은 형질감염 효율, 낮은 세포독성 및 비용 효율성을 제공하는 방법을 개발하는 것은 hESCs에 사용되는 높은 역가 렌티바이러스 입자의 생산을 위해 매우 중요하다.
폴리에틸렌이민(PEI)은 HEK293T 세포를 많은 세포독성 없이 고효율로 형질감염시킬 수 있는 양이온성 고분자이며, 리포펙션 기반 방법(18)에 비해 무시할 수 있는 비용을 갖는다. 이러한 상황에서, PEI는 다양한 기술을 사용하는 배양 상청액으로부터의 렌티바이러스 입자의 농도를 통한 고역가 LVS 생산의 스케일업 응용에 사용될 수 있다. 제시된 기사는 슈크로스 쿠션을 통한 초원심분리를 사용하여 HEK293T 세포 및 렌티바이러스 벡터 농도를 형질감염시키기 위한 PEI의 사용을 기술한다. 이 방법을 사용하여, 우리는 정기적으로 낮은 배치 대 배치 변화로 5 x 107 IU / mL 이상의 역가를 얻습니다. 이 방법은 hESC 및 hESC 유래 세포로의 유전자 전달을 위한 확장 적용에 간단하고 간단하며 비용 효율적입니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Invitrogen</td>
			<td>31350010</td>
			<td></td>
		</tr>
		<tr>
			<td>38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear Tubes</td>
			<td>Beckman Coulter</td>
			<td>C14292</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>Stem Cell Technologies</td>
			<td>7920</td>
			<td></td>
		</tr>
		<tr>
			<td>bFGF Recombinant human</td>
			<td>Invitrogen</td>
			<td>PHG0261</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine serum albumin FRAC V</td>
			<td>Invitrogen</td>
			<td>15260037</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning Matrigel Basement Membrane Matrix, LDEV-free</td>
			<td>Corning</td>
			<td>354234</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyclopamine</td>
			<td>Stem Cell Technologies</td>
			<td>72074</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM media</td>
			<td>Invitrogen</td>
			<td>11995073</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM Nutrient mix F12&#160;</td>
			<td>Invitrogen</td>
			<td>11320033</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS w/o: Ca and Mg</td>
			<td>PAN Biotech</td>
			<td>P04-36500</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovie serum</td>
			<td>Invitrogen</td>
			<td>10270106</td>
			<td></td>
		</tr>
		<tr>
			<td>GAPDH (14C10) Rabbit mAb Antibody</td>
			<td>CST</td>
			<td>2118S</td>
			<td></td>
		</tr>
		<tr>
			<td>Gentle Cell Dissociation Reagent</td>
			<td>Stem Cell Technologies</td>
			<td>7174</td>
			<td></td>
		</tr>
		<tr>
			<td>HyClone Non Essential Amino Acids (NEAA) 100X Solution</td>
			<td>GE healthcare</td>
			<td>SH30238.01</td>
			<td></td>
		</tr>
		<tr>
			<td>L Glutamine, 100X&#160;</td>
			<td>Invitrogen</td>
			<td>2924190090</td>
			<td></td>
		</tr>
		<tr>
			<td>L2HGDH Polyclonal antibody</td>
			<td>Proteintech</td>
			<td>15707-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>L2HGDH shRNA</td>
			<td>Macrogen</td>
			<td></td>
			<td>Seq: CGCATTCTTCATGTGAGAAAT</td>
		</tr>
		<tr>
			<td>Lipofectamine 3000 kit</td>
			<td>Thermo Fisher</td>
			<td>L3000001</td>
			<td></td>
		</tr>
		<tr>
			<td>mTesR1 complete media</td>
			<td>Stem Cell Technologies</td>
			<td>85850</td>
			<td></td>
		</tr>
		<tr>
			<td>Neurobasal medium 1X CTS</td>
			<td>Invitrogen</td>
			<td>A1371201</td>
			<td></td>
		</tr>
		<tr>
			<td>Neuropan 2 Supplement 100x</td>
			<td>PAN Biotech</td>
			<td>P07-11050</td>
			<td></td>
		</tr>
		<tr>
			<td>Neuropan 27 Supplement 50x</td>
			<td>PAN Biotech</td>
			<td>P07-07200</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin streptomycin SOL</td>
			<td>Invitrogen</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>pLKO.1 TRC vector</td>
			<td>Addgene</td>
			<td>10878</td>
			<td></td>
		</tr>
		<tr>
			<td>pLL3.7 vector&#160;</td>
			<td>Addgene</td>
			<td>11795</td>
			<td></td>
		</tr>
		<tr>
			<td>pMD2.G</td>
			<td>Addgene</td>
			<td>12259</td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene infection reagent</td>
			<td>Sigma</td>
			<td>TR1003- G</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine, branched</td>
			<td>Sigma</td>
			<td>408727</td>
			<td></td>
		</tr>
		<tr>
			<td>psPAX2.0</td>
			<td>Addgene</td>
			<td>12260</td>
			<td></td>
		</tr>
		<tr>
			<td>Purmorphamine</td>
			<td>Tocris</td>
			<td>4551/10</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Invitrogen</td>
			<td>A1113802</td>
			<td></td>
		</tr>
		<tr>
			<td>ROCK inhibitor Y-27632 
			dihydrochloride&#160;</td>
			<td>Tocris</td>
			<td>1254</td>
			<td></td>
		</tr>
		<tr>
			<td>SB 431542</td>
			<td>Tocris</td>
			<td>1614/10</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin .05% EDTA&#160;</td>
			<td>Invitrogen</td>
			<td>25300062</td>
			<td></td>
		</tr>
		<tr>
			<td>XAV 939</td>
			<td>Tocris</td>
			<td>3748/10</td>
			<td></td>
		</tr>
	</tbody>
</table>

lentiviral mediated delivery of shrnas to hescs and npcs using low-cost cationic polymer polyethylenimine (pei)

현재의 프로토콜은 인간 배아 줄기 세포 (hESCs)뿐만 아니라 hESCs로부터 유래 된 신경 전구 세포 (NPCs) 모두에 짧은 헤어핀 RNA (shRNAs)를 고효율로 전달하기위한 렌티바이러스 입자의 사용을 기술한다. 렌티바이러스 입자는 저가의 양이온성 폴리머 폴리에틸렌이민(PEI)을 사용하여 패키징 플라스미드(pAX 및 pMD2.G)와 함께 진입 벡터(운반 shRNAs)를 사용하여 HEK293T 세포를 공동형질감염시킴으로써 생성되었다. 바이러스 입자는 초원심분리를 사용하여 농축되었고, 이는 5 x 107 이상의 평균 역가를 초래하였다. hESCs 및 NPCs 둘 다 퓨로마이신 선택 및 hESC에서의 안정한 발현뿐만 아니라 NPC에서의 일시적인 GFP 발현에 의해 나타난 바와 같이, 이러한 렌티바이러스 입자를 사용하여 높은 효율로 감염될 수 있었다. 더욱이, 웨스턴 블롯 분석은 shRNAs에 의해 표적화된 유전자의 발현에서 유의한 감소를 보여주었다. 또한, 세포는 CNS의 다른 계보로의 후속 분화에 의해 입증 된 바와 같이 분화 잠재력뿐만 아니라 다능성을 유지했습니다. 현재 프로토콜은 shRNA의 전달을 다룬다; 그러나, 과발현 연구를 위해 cDNA의 자궁외 발현에 대해 동일한 접근법이 사용될 수 있다.

유전자 전달 후, hESCs의 높은 생존력은 필연적으로 요구된다. hESCs의 전기천공에 따른 세포 사멸을 감소시키기 위한 프로토콜의 노력 및 최적화에도 불구하고, 낮은 형질감염 효율(20)과 함께 이들 세포의 전기천공 후에도 50% 이상의 세포 사멸이 여전히 관찰된다. 렌티바이러스 매개 유전자 전달은 유전자 전달의 높은 효율을 가져올 뿐만 아니라 형질도입 후 높은 수준의 세포 생?...

Watch this Scientific Journal Video about Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI at JoVE.com

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine PEI

저가의 양이온성 고분자 폴리에틸렌이민(PEI)을 사용하여 H9 인간 배아줄기세포(hESCs)에서 shRNA의 안정적인 발현을 위한 렌티바이러스 입자를 생산하고 H9 유래 신경전구세포(NPC)를 고효율로 일시적으로 형질도입했습니다.

저비용 양이온성 고분자 폴리에틸렌이민(PEI)을 사용하여 hESC 및 NPC에 대한 shRNA의 렌티바이러스 매개 전달

The current protocol describes the use of lentiviral particles for the delivery of short hairpin RNAs (shRNAs) to both human embryonic stem cells (hESCs) ...

HEK293T 세포의 형질감염은 90% 컨플루언시에서 수행되어야 한다. 또한, 렌티바이러스 벡터 여과를 위한 0.45-미크론 저단백 결합 필터의 사용과 초원심분리를 위한 수크로오스 쿠션의 사용이 필수적이다. HEK293T 세포를 트랜스펙션을 위해 시딩하기 전에 세포가 90%confluency에 도달할 때까지 5% 이산화탄소 및 21% 산소의 분위기로 가습된 인큐베이터에서 섭씨 37도에서 10%FBS 및 1X 페니실린 스트렙토마이신을 함유하는 DMEM 배지에서 배양함으로써 시작하십시오.여섯 개의 세포를 100밀리미터 조직 배양 플레이트에서 10밀리리터의 완전한 성장 배지에 네 번 10번 시드하고, 5% 이산화탄소 및 21%산소의 대기를 갖는 가습 조직 배양 배양기에서 밤새 성장시킨다. 각 형질감염에 대해, 텍스트 원고에 기재된 바와 같이 입력 및 패키징 플라스미드의 비율에 따라 1.5밀리리터 원심분리 튜브의 무혈청 DMEM 배지 1밀리리터에 플라스미드 DNA 스톡을 밀리리터당 1밀리그램씩 희석한다. 튜브를 10초 동안 볼텍스하고 실온에서 30초 동안 10, 000배 G에서 회전시켜 수집한다.그런 다음 폴리머 폴리에틸렌 이민 또는 PEI의 밀리리터 원액 당 70 마이크로 리터의 1 밀리그램을 튜브에 첨가하십시오. 다시 와류하고 튜브를 간단히 회전시킵니다. 리포펙타민계 횡단의 경우, 키트에 공급된 45 마이크로리터의 시약 P를 함유하는 무혈청 DMEM 배지 500 마이크로리터에 벡터를 희석한다.이어서, 500 마이크로리터의 동일한 매질을 사용하여 70 마이크로리터의 시약 L을 희석한다. 두 튜브를 실온에서 다섯 분 동안 인큐베이션한다. 그런 다음 두 튜브의 내용물을 결합하고 복잡한 형성을 허용하기 위해 실온에서 20 분 동안 인큐베이션하십시오.다음으로, DNA PEI 또는 DNA 리포펙타민 복합체 1밀리리터를 세포를 함유하는 플레이트에 적하하고, 5%이산화탄소 및 21% 산소의 분위기로 섭씨 37도에서 6시간 동안 인큐베이션한다. 인큐베이션 후, 배지를 10 밀리리터의 신선한 완전 성장 배지로 교체하고 플레이트를 인큐베이터로 되돌립니다. 형질감염 이틀 후, 바이러스 함유 배지를 수집하고 세포를 10 밀리리터의 신선한 완전한 성장 배지로 오버레이한다.다시, 형질감염의 사흘 후에, 바이러스 함유 배지를 수집하고 이틀 시점에서 수집된 배지와 결합시킨다. 바이러스 상층액을 섭씨 4도에서 10분 동안 2, 000배 G에서 원심분리하여 세포 파편을 펠릿화한다. 0.45-마이크론 공극 크기 저단백질 결합 필터를 사용하여 상층액을 여과하고, 초원심분리가 준비될 때까지 섭씨 4도에서 보관한다.초원심분리 튜브의 유지 컵을 70% 에탄올로 10분 동안 세척하여 멸균합니다. 공기를 말리고, 닫고, 컵을 섭씨 네 도에 놓습니다. 렌티바이러스 입자가 포함된 여과된 배지에 36밀리리터를 멸균 초원심분리 튜브에 첨가합니다.PBS로 준비된 네 밀리리터의 멸균 20%수크로오스 용액으로 멸균 스트리펫 다섯 밀리리터를 채우고 렌티바이러스 벡터 또는 LVS가 들어있는 튜브의 바닥에 분배한다. 자당 용액이 매체와 혼합되어서는 안되며 튜브 바닥에 구배를 만듭니다. 무혈청 DMEM 배지를 사용하여 모든 초원심분리 튜브의 균형을 맞추고, 튜브를 컵을 고정하는 차가운 초원심분리 튜브에 넣고, 뚜껑을 닫습니다.튜브를 섭씨 네 도에서 두 시간 동안 125, 000 배 G로 돌립니다. 스핀 후, 펠렛을 방해하지 않고 표백제가 들어있는 용기에 튜브의 내용물을 뒤집어 조심스럽게 상층액을 버립니다. 펠릿이 보이면 표시하십시오.초원심분리 튜브를 50 밀리리터 멸균 튜브에 넣고 펠릿 상단에 200 마이크로 리터의 멸균 DPBS를 첨가하십시오. 튜브를 하룻밤 사이에 섭씨 네 도에 놓습니다. 다음날, 탁상용 원심분리기에서 13, 000배 G로 방사하기 전에 튜브의 내용물을 상하로 피펫팅하여 부드럽게 혼합하여 이물질을 펠릿화한다.상청액을 새로운 튜브로 옮기고 바이러스 제제를 분취합니다. 마지막으로 튜브를 영하 80도에 보관하십시오. 형질감염 후, HEK293T 세포에서 풍부한 GFP 발현이 관찰되었다.바이러스 단백질의 발현은 단일 세포가 융합되는 HEK293T 세포의 동기화 형성을 초래했다. 감염 후, GFP의 현저한 발현은 또한 바이러스-감염된 신경 전구 세포에서 관찰되었다. 저가 PEI와 리포펙타민 3000 시약 사이의 LVS 역가 측정은 바이러스 역가에서 유의한 차이를 나타내지 않았다.PLK 0.1-기반 벡터에 대한 바이러스 역가가 여기에 제시되어 있다. 렌티바이러스 형질감염된 세포는 형질도입되지 않은 세포와 비교하여 80% 이상의 세포 생존율을 보인 반면, 어떤 세포도 처리에서 살아남지 못했다. 웨스턴 블롯 분석은 빈 벡터 백본으로 형질도입된 세포에서 L-2-하이드록시글루타레이트 탈수소효소의 풍부한 발현을 보여주었다.그러나, 짧은 헤어핀 RNA를 운반하는 벡터로 형질도입된 세포에서는 발현이 관찰되지 않았다. 이 기술의 주요 장점은 진입 및 포장 벡터를 사용하여 HEK293T 세포를 공동 형질감염시킴으로써 렌티바이러스 입자를 생산하기 위해 저가의 양이온성 중합체 폴리에틸렌이민을 사용하는 것이다.

Research

JoVE Journal

Biology

Lentiviral Mediated Delivery of shRNAs to hESCs and NPCs Using Low-cost Cationic Polymer Polyethylenimine (PEI)

Labeling hESCs and hMSCs with Iron Oxide Nanoparticles for Non-Invasive in vivo Tracking with MR Imaging

이런 산화물로 hESCs과 hMSCs을 라벨링하는 MR 영상과 생체내 추적 비침습에 대한 Nanoparticles

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative ...

연구

생물학

From MEFs to Matrigel I: Passaging hESCs in the Presence of MEFs

MEFs부터를 Matrigel하기 : MEFs의 면전에서 Passaging hESCs를

This video demonstrates how to grow human embryonic stem cells (hESCs) on mouse embryonic fibroblast (MEF) feeder cells.
...

From MEFs to Matrigel 2: Splitting hESCs from MEFs onto Matrigel

Matrigel에 MEFs에서 분리 hESCs : MEFs에서 Matrigel 2

This video demonstrates how to grow human embryonic stem cells (hESCs) on mouse embryonic fibroblast (MEF) feeder cells, how to passage hESCs from MEF ...

From MEFs to Matrigel 3: Passaging hESCs from Matrigel onto Matrigel

MEFs에서 Matrigel 3 : Matrigel에 Matrigel에서 Passaging hESCs

This video demonstrates how to maintain the growth of human embryonic stem cells (hESCs) in feeder cell-free conditions and how to continuously passage ...

Lentiviral-mediated Knockdown During Ex Vivo Erythropoiesis of Human Hematopoietic Stem Cells

Lentiviral-mediated Knockdown During Ex Vivo Erythropoiesis of Human Hematopoietic Stem Cells

Lentiviral - 중재 최저 동안 예 VIVO</em인간 조혈 줄기 세포의> 적혈구 조혈

Erythropoiesis is a commonly used model system to study cell differentiation. During erythropoiesis, pluripotent adult human hematopoietic stem cells ...

Generation of Human Induced Pluripotent Stem Cells from Peripheral Blood Using the STEMCCA Lentiviral Vector

STEMCCA Lentiviral 벡터를 사용하여 말초 혈에서 인간 유도 만능 줄기 세포의 생성

Through the ectopic expression of four transcription factors, Oct4, Klf4, Sox2 and cMyc, human somatic cells can be converted to a pluripotent state, ...

Long-term Silencing of Intersectin-1s in Mouse Lungs by Repeated Delivery of a Specific siRNA via Cationic Liposomes. Evaluation of Knockdown Effects by Electron Microscopy

양이온 성 리포좀을 통해 특정의 siRNA 반복 전달하여 마우스 폐 Intersectin-1의 장기 침묵. 전자 현미경에 의한 넉다운 효과의 평가

Previous  studies showed that knockdown of ITSN-1s (KDITSN), an endocytic  protein involved in regulating lung vascular permeability and endothelial cells ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

화학적 매개 종간의 상호 작용을 검출하는 공 배양을 사용하여

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Generation of Myospheres From hESCs by Epigenetic Reprogramming

성적인 프로그램을 다시 만들에 의해 인간 배아 줄기 세포에서 Myospheres의 생성

Generation of a homogeneous and abundant population of skeletal muscle cells from human embryonic stem cells (hESCs) is a requirement for cell-based ...

Phosphopeptide Analysis of Rodent Epididymal Spermatozoa

설치류 부고환 정자의 포스 포 분석

Spermatozoa are quite unique amongst cell types. Although produced in the testis, both nuclear gene transcription and translation are switched off once ...