Name: fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum
Uploaded: 2022-08-03T15:00:00
Description: Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Dette arbejde blev støttet af AMED under tilskudsnummer JP22gm6110025 (til Y.N.) og af JSPS KAKENHI Grant Number 22H02762 (til Y.N.).

BEMÆRK: Se materialetabellen for detaljer relateret til alle materialer, reagenser og udstyr, der anvendes i denne protokol.
1. Sonde syntese
<ol><li>RNA-ekstraktion<ol><li>Placer tre levende Cladonema medusae, der dyrkes i kunstigt havvand (ASW) i et 1,5 ml rør ved hjælp af en 3,1 ml overførselspipette med spidsen afskåret, og fjern så meget ASW som muligt. BEMÆRK: ASW fremstilles ved at opløse en blanding af mineralsalte i ledningsvand ...

<ol>
	<li>Lecl&#232;re, L., R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+cnidarian+muscles:+Function,+anatomy,+development+and+regeneration.">Diversity of cnidarian muscles: Function, anatomy, development and regeneration.</a> Frontiers in Cell and Developmental Biology. 4, 157 (2017).</li><li>Bosch, T. C. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Back+to+the+basics:+Cnidarians+start+to+fire.">Back to the basics: Cnidarians start to fire.</a> Trends in Neurosciences. 40 (2), 92-105 (2017).</li><li>Gold, D. A., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+dynamics+in+Cnidaria:+Are+there+unifying+principles.">Stem cell dynamics in Cnidaria: Are there unifying principles.</a> Development Genes and Evolution. 223 (1-2), 53-66 (2013).</li><li>Technau, U., Steele, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+crossroads+in+developmental+biology:+Cnidaria.">Evolutionary crossroads in developmental biology: Cnidaria.</a> Development. 138 (8), 1447-1458 (2011).</li><li>Lecl&#232;re, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternally+localized+germ+plasm+mRNAs+and+germ+cell/stem+cell+formation+in+the+cnidarian+Clytia.">Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the cnidarian Clytia.</a> Developmental Biology. 364 (2), 236-248 (2012).</li><li>Bradshaw, B., Thompson, K., Frank, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+mechanisms+underlie+oral+vs+aboral+regeneration+in+the+cnidarian+Hydractinia+echinata.">Distinct mechanisms underlie oral vs aboral regeneration in the cnidarian Hydractinia echinata.</a> eLife. 4, 05506 (2015).</li><li>Sinigaglia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pattern+regulation+in+a+regenerating+jellyfish.">Pattern regulation in a regenerating jellyfish.</a> eLife. 9, 54868 (2020).</li><li>David, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interstitial+stem+cells+in+Hydra:+Multipotency+and+decision-making.">Interstitial stem cells in Hydra: Multipotency and decision-making.</a> The International Journal of Developmental Biology. 56 (6-7-8), 489-497 (2012).</li><li>R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nematostella+vectensis,+an+emerging+model+for+deciphering+the+molecular+and+cellular+mechanisms+underlying+whole-body+regeneration.">Nematostella vectensis, an emerging model for deciphering the molecular and cellular mechanisms underlying whole-body regeneration.</a> Cells. 10 (10), 2692 (2021).</li><li>Houliston, E., Momose, T., Manuel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clytia+hemisphaerica:+A+jellyfish+cousin+joins+the+laboratory.">Clytia hemisphaerica: A jellyfish cousin joins the laboratory.</a> Trends in Genetics. 26 (4), 159-167 (2010).</li><li>Peron, S., Houliston, E., Lecl&#232;re, L., Boutet, A., Shierwater, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Marine+Jellyfish+Model,+Clytia+hemisphaerica.">The Marine Jellyfish Model, Clytia hemisphaerica.</a> Handbook of Marine Model Organisms in Experimental Biology. , 129-147 (2021).</li><li>Denker, E., Manuel, M., Lecl&#232;re, L., Le Guyader, H., Rabet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ordered+progression+of+nematogenesis+from+stem+cells+through+differentiation+stages+in+the+tentacle+bulb+of+Clytia+hemisphaerica+(Hydrozoa,+Cnidaria).">Ordered progression of nematogenesis from stem cells through differentiation stages in the tentacle bulb of Clytia hemisphaerica (Hydrozoa, Cnidaria).</a> Developmental Biology. 315 (1), 99-113 (2008).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regeneration+potential+of+jellyfish:+Cellular+mechanisms+and+molecular+insights.">Regeneration potential of jellyfish: Cellular mechanisms and molecular insights.</a> Genes. 12 (5), 758 (2021).</li><li>Suga, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flexibly+deployed+Pax+genes+in+eye+development+at+the+early+evolution+of+animals+demonstrated+by+studies+on+a+hydrozoan+jellyfish.">Flexibly deployed Pax genes in eye development at the early evolution of animals demonstrated by studies on a hydrozoan jellyfish.</a> Proceedings of the National Academy of Sciences. 107 (32), 14263-14268 (2010).</li><li>Fujiki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Branching+pattern+and+morphogenesis+of+medusa+tentacles+in+the+jellyfish+Cladonema+pacificum+(Hydrozoa,+Cnidaria).">Branching pattern and morphogenesis of medusa tentacles in the jellyfish Cladonema pacificum (Hydrozoa, Cnidaria).</a> Zoological Letters. 5 (12), 13 (2019).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+controls+body+size+growth,+tentacle+morphogenesis,+and+regeneration+in+hydrozoan+jellyfish+Cladonema+pacificum.">Cell proliferation controls body size growth, tentacle morphogenesis, and regeneration in hydrozoan jellyfish Cladonema pacificum.</a> PeerJ. 7, 7579 (2019).</li><li>Hou, S., Zhu, J., Shibata, S., Nakamoto, A., Kumano, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repetitive+accumulation+of+interstitial+cells+generates+the+branched+structure+of+Cladonema+medusa+tentacles.">Repetitive accumulation of interstitial cells generates the branched structure of Cladonema medusa tentacles.</a> Development. 148 (23), (2021).</li><li>Salic, A., Mitchison, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+method+for+fast+and+sensitive+detection+of+DNA+synthesis+in+vivo.">A chemical method for fast and sensitive detection of DNA synthesis in vivo.</a> Proceedings of the National Academy of Sciences of the United States of America. 105 (7), 2415-2420 (2008).</li><li>Angerer, L. M., Angerer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+poly+A+++RNA+in+sea+urchin+eggs+and+embryos+by+quantitative+in+situ+hybridization.">Detection of poly A + RNA in sea urchin eggs and embryos by quantitative in situ hybridization.</a> Nucleic Acids Research. 9 (12), 2819-2840 (1981).</li><li>Rakotomamonjy, J., Guemez-Gamboa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purkinje+cell+survival+in+organotypic+cerebellar+slice+cultures.">Purkinje cell survival in organotypic cerebellar slice cultures.</a> Journal of Visualized Experiments. (154), e60353 (2019).</li><li>Tanaka, E. M., Reddien, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+basis+for+animal+regeneration.">The cellular basis for animal regeneration.</a> Developmental Cell. 21 (1), 172-185 (2011).</li><li>Penzo-M&#233;ndez, A. I., Stanger, B. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ-size+regulation+in+mammals.">Organ-size regulation in mammals.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), 019240 (2015).</li><li>Sinigaglia, C., Thiel, D., Hejnol, A., Houliston, E., Lecl&#232;re, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+safer,+urea-based+in+situ+hybridization+method+improves+detection+of+gene+expression+in+diverse+animal+species.">A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species.</a> Developmental Biology. 434 (1), 15-23 (2018).</li><li>King, R. S., Newmark, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+protocol+for+enhanced+detection+of+gene+expression+in+the+planarian+Schmidtea+mediterranea.">In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea.</a> BMC Developmental Biology. 13 (1), 8 (2013).</li><li>Flici, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+evolutionarily+conserved+SoxB-Hdac2+crosstalk+regulates+neurogenesis+in+a+cnidarian.">An evolutionarily conserved SoxB-Hdac2 crosstalk regulates neurogenesis in a cnidarian.</a> Cell Reports. 18 (6), 1395-1409 (2017).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axial+Hox+code+controls+tissue+segmentation+and+body+patterning+in+Nematostella+vectensis.">An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.</a> Science. 361 (6409), 1377-1380 (2018).</li><li>Govindasamy, N., Murthy, S., Ghanekar, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Slow-cycling+stem+cells+in+hydra+contribute+to+head+regeneration.">Slow-cycling stem cells in hydra contribute to head regeneration.</a> Biology Open. 3 (12), 1236-1244 (2014).</li><li>Passamaneck, Y. J., Martindale, M. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+is+necessary+for+the+regeneration+of+oral+structures+in+the+anthozoan+cnidarian+Nematostella+vectensis.">Cell proliferation is necessary for the regeneration of oral structures in the anthozoan cnidarian Nematostella vectensis.</a> BMC Developmental Biology. 12 (1), 34 (2012).</li><li>Gold, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+developmental+disparity+in+the+tentacles+of+the+moon+jellyfish+Aurelia+sp.1.">Structural and developmental disparity in the tentacles of the moon jellyfish Aurelia sp.1.</a> PLoS One. 10 (8), 0134741 (2015).</li><li>Gold, D. A., Nakanishi, N., Hensley, N. M., Hartenstein, V., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+tracking+supports+secondary+gastrulation+in+the+moon+jellyfish+Aurelia.">Cell tracking supports secondary gastrulation in the moon jellyfish Aurelia.</a> Development Genes and Evolution. 226 (6), 383-387 (2016).</li><li>Cheng, L. -. C., Alvarado, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-mount+BrdU+staining+with+fluorescence+in+situ+hybridization+in+planarians.">Whole-mount BrdU staining with fluorescence in situ hybridization in planarians.</a> Planarian Regeneration. 1774, 423-434 (2018).</li></ol>

Formerende celler og stamceller er vigtige cellulære kilder i forskellige processer såsom morfogenese, vækst og regenerering21,22. Dette papir beskriver en metode til co-farvning af stamcellemarkøren Nanos1 ved FISH og EdU-mærkning i Cladonema medusae. Tidligere arbejde ved hjælp af EdU- eller BrdU-mærkning har antydet, at proliferative celler lokaliserer til tentakelpærerne16,17,</sup...

Cnidaria betragtes som en basalt forgrenet metazoan phylum indeholdende dyr med nerver og muskler, hvilket placerer dem i en unik position til at forstå udviklingen af dyreudvikling og fysiologi 1,2. Cnidarians er kategoriseret i to hovedgrupper: Anthozoa (fx havanemoner og koraller) har kun planula larver og sessile polyp stadier, mens Medusozoa (medlemmer af Hydrozoa, Staurozoa, Scyphozoa og Cubozoa) typisk har form af fritsvømmende medusae eller vandmænd samt planula larver og polypper. Cnidarians udviser almindeligvis høj regenerativ kapacitet, og deres underliggende cellulære mekanismer, især deres besiddelse af voksne stamceller og proliferative celler, har tiltrukket sig stor opmærksomhed 3,4. Oprindeligt identificeret i Hydra er hydrozoanstamceller placeret i de interstitielle rum mellem ektodermale epitelceller og kaldes almindeligvis interstitielle celler eller i-celler3.
Hydrozoan i-celler deler fælles egenskaber, der inkluderer multipotens, ekspression af bredt bevarede stamcellemarkører (f.eks. Nanos, Piwi, Vasa) og migrationspotentiale 3,5,6,7,8. Som funktionelle stamceller er i-celler i vid udstrækning involveret i hydrozodyrs udvikling, fysiologi og miljørespons, hvilket vidner om deres høje regenerative kapacitet og plasticitet3. Mens stamceller, der ligner i-celler, ikke er blevet identificeret uden for hydrozoer, selv i den etablerede modelart Nematostella, er proliferative celler stadig involveret i vedligeholdelse og regenerering af somatisk væv samt kimlinjen9. Da undersøgelser i cnidarian udvikling og regenerering overvejende er blevet udført på polyp-type dyr som Hydra, Hydractinia og Nematostella, forbliver den cellulære dynamik og funktioner af stamceller i vandmænd stort set uadresseret.
Hydrozoan vandmænd Clytia hemisphaerica , en kosmopolitisk vandmandsart med forskellige levesteder rundt om i verden, herunder Middelhavet og Nordamerika, er blevet brugt som et eksperimentelt modeldyr i flere udviklings- og evolutionære undersøgelser10. Med sin lille størrelse, lette håndtering og store æg er Clytia velegnet til laboratorievedligeholdelse samt til introduktion af genetiske værktøjer som de nyligt etablerede transgenese- og knockout-metoder11, hvilket åbner mulighed for detaljeret analyse af de cellulære og molekylære mekanismer, der ligger til grund for vandmandsbiologi. I Clytia medusa tentakel er i-celler lokaliseret i den proksimale region, kaldet pæren, og forfædre som nematoblaster migrerer til den distale spids, mens de differentierer sig i forskellige celletyper, herunder nematocytter12.
Under regenerering af Clytia manubrium migrerer det orale organ af vandmænd, Nanos1+ i-celler, der er til stede i gonaderne, til det område, hvor manubrium går tabt som reaktion på skader og deltager i regenerering af manubrium7. Disse fund understøtter ideen om, at i-celler i Clytia også opfører sig som funktionelle stamceller, der er involveret i morfogenese og regenerering. I betragtning af at i-cellernes egenskaber adskiller sig blandt repræsentative polyp-type dyr som Hydra og Hydractinia3, er det imidlertid muligt, at stamcellernes egenskaber og funktioner er diversificeret blandt vandmændarter. Med undtagelse af Clytia er eksperimentelle teknikker desuden blevet begrænset for andre vandmænd, og den detaljerede dynamik i proliferative celler og stamceller er ukendt13.
Hydrozoan vandmænd Cladonema pacificum er en ny modelorganisme, der kan opbevares i et laboratoriemiljø uden vandpumpe eller filtreringssystem. Cladonema medusa har forgrenede tentakler, et fælles kendetegn i Cladonematidae-familien, og et fotoreceptororgan kaldet ocellus på det ektodermale lag nær pæren14. Tentakelforgreningsprocessen sker på et nyt forgreningssted, der vises langs den adaksiale side af tentaklen. Over tid fortsætter tentaklerne med at forlænge og forgrene sig, hvor de ældre grene skubbes ud mod spidsen15. Derudover kan Cladonema tentakler regenerere inden for få dage efter amputation. Nylige undersøgelser har antydet rollen som prolifererende celler og stamlignende celler i tentakelforgrening og regenerering i Cladonema16,17. Men mens konventionel in situ hybridisering (ISH) er blevet brugt til at visualisere genekspression i Cladonema, på grund af dens lave opløsning, er det i øjeblikket vanskeligt at observere stamcelledynamik på celleniveau i detaljer.
Dette papir beskriver en metode til visualisering af stamlignende celler i Cladonema af FISH og co-farvning med EdU, en markør for celleproliferation18. Vi visualiserer ekspressionsmønsteret for Nanos1, en stamcellemarkør 5,17, af FISH, som gør det muligt at identificere stamlignende cellefordeling på enkeltcelleniveau. Derudover gør co-farvning af Nanos1-ekspression med EdU-mærkning det muligt at skelne aktivt prolifererende stamlignende celler. Denne metode til overvågning af både stamceller og proliferative celler kan anvendes på en lang række undersøgelsesområder, herunder tenakelforgrening, vævshomeostase og organregenerering i Cladonema, og en lignende tilgang kan anvendes på andre vandmændarter.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-Mercaptoethanol&#160;</td>
			<td>Wako</td>
			<td>137-06862</td>
			<td></td>
		</tr>
		<tr>
			<td>3.1 mL transfer pipette</td>
			<td>Thermo Scientific</td>
			<td>233-20S</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-4-chloro-3-indolyl-&#946;-D-galactopyranoside (X-Gal)</td>
			<td>Wako</td>
			<td>029-15043</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-DIG-POD</td>
			<td>Roche</td>
			<td>11207733910</td>
			<td></td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-AAGAGACACAGTCATTATCAAGC 
			GA-3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-CGACGTGTCCAATTTTACGTGCT -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- AAAAGAGCAGCGGCCAGAAAGA 
			AGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- GCGGGTCGCATACTTGTTGGTA 
			CTGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye</td>
			<td>Invitrogen&#160;</td>
			<td>C10337</td>
			<td>EdU kit</td>
		</tr>
		<tr>
			<td>Coroline off</td>
			<td>GEX Co. ltd</td>
			<td>N/A</td>
			<td>chlorine neutralizer</td>
		</tr>
		<tr>
			<td>DIG Nucleic Acid Detection Kit Blocking Reagent</td>
			<td>Roche</td>
			<td>11175041910</td>
			<td>blocking buffer&#160;</td>
		</tr>
		<tr>
			<td>DIG RNA labeling mix&#160;</td>
			<td>Roche</td>
			<td>11277073910</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>Promega</td>
			<td>P117B</td>
			<td></td>
		</tr>
		<tr>
			<td>ECOS competent cell DH5&#945;</td>
			<td>NIPPON GENE</td>
			<td>316-06233</td>
			<td>competent cell</td>
		</tr>
		<tr>
			<td>Fast gene Gel/PCR Extraction kit</td>
			<td>Fast gene</td>
			<td>FG-91302</td>
			<td>gel extraction kit</td>
		</tr>
		<tr>
			<td>Fast gene plasmid mini kit</td>
			<td>Fast gene</td>
			<td>FG-90502</td>
			<td>plasmid miniprep</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Wako&#160;</td>
			<td>068-00426</td>
			<td></td>
		</tr>
		<tr>
			<td>Heparin sodium salt from porcine</td>
			<td>SIGMA-ALDRICH&#160;</td>
			<td>H3393-10KU</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl-&#946;-D(-)-thiogalactopyranoside (IPTG)</td>
			<td>Wako</td>
			<td>096-05143</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar</td>
			<td>Invitrogen</td>
			<td>22700-025</td>
			<td>agar plate</td>
		</tr>
		<tr>
			<td>LB Broth Base</td>
			<td>Invitrogen</td>
			<td>12780-052</td>
			<td>LB medium</td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Wako</td>
			<td>134-00495</td>
			<td></td>
		</tr>
		<tr>
			<td>mini Quick spin RNA columns</td>
			<td>Roche</td>
			<td>11814427001</td>
			<td>clean-up column</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Wako&#160;</td>
			<td>191-01665</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop OneC Microvolume UV-Vis Spectrophotometer with Wi-Fi</td>
			<td>Thermo Scientific</td>
			<td>ND-ONEC-W</td>
			<td>spectrophotometer</td>
		</tr>
		<tr>
			<td>Polyoxyethlene (20) Sorbitan Monolaurate (Tween-20)</td>
			<td>Wako&#160;</td>
			<td>166-21115</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerMasher 2</td>
			<td>nippi&#160;</td>
			<td>891300</td>
			<td>homogenizer</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Nacarai Tesque&#160;</td>
			<td>29442-14</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor</td>
			<td>TaKaRa</td>
			<td>2313A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen&#160;</td>
			<td>74004</td>
			<td>total RNA isolation kit</td>
		</tr>
		<tr>
			<td>RQ1 RNase-Free Dnase</td>
			<td>Promega</td>
			<td>M6101</td>
			<td></td>
		</tr>
		<tr>
			<td>Saline Sodium Citrate Buffer 20x powder (20x SSC)</td>
			<td>TaKaRa</td>
			<td>T9172</td>
			<td></td>
		</tr>
		<tr>
			<td>SEA LIFE</td>
			<td>Marin Tech</td>
			<td>N/A</td>
			<td>mixture of mineral salts</td>
		</tr>
		<tr>
			<td>T3 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>11031163001</td>
			<td></td>
		</tr>
		<tr>
			<td>T7 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>10881767001</td>
			<td></td>
		</tr>
		<tr>
			<td>TAITEC HB-100</td>
			<td>TAITEC</td>
			<td>0040534-000</td>
			<td>Hybridization incuvator</td>
		</tr>
		<tr>
			<td>TaKaRa Ex Taq&#160;</td>
			<td>TaKaRa</td>
			<td>RR001A</td>
			<td>Taq DNA polymerase</td>
		</tr>
		<tr>
			<td>TaKaRa PrimeScript 2 1st strand cDNA Synthesis Kit</td>
			<td>TaKaRa</td>
			<td>6210A</td>
			<td>cDNA synthesis kit</td>
		</tr>
		<tr>
			<td>Target Clone</td>
			<td>TOYOBO&#160;</td>
			<td>TAK101</td>
			<td>pTA2 Vector</td>
		</tr>
		<tr>
			<td>tRNA</td>
			<td>Roche</td>
			<td>10109541001</td>
			<td></td>
		</tr>
		<tr>
			<td>TSA Plus Cyanine 5</td>
			<td>AKOYA Biosciences</td>
			<td>NEL745001KT</td>
			<td>tyramide signal amplification (TSA) technique</td>
		</tr>
		<tr>
			<td>Zeiss LSM 880</td>
			<td>ZEISS</td>
			<td>N/A</td>
			<td>laser scanning confocal microscope</td>
		</tr>
	</tbody>
</table>

fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum

Cnidarians, herunder havanemoner, koraller og vandmænd, udviser forskellig morfologi og livsstil, der manifesteres i sessile polypper og frisvømmende medusae. Som eksemplificeret i etablerede modeller som Hydra og Nematostella bidrager stamceller og / eller proliferative celler til udvikling og regenerering af cnidarian polypper. Imidlertid er de underliggende cellulære mekanismer i de fleste vandmænd, især på medusa-stadiet, stort set uklare, og det er derfor kritisk at udvikle en robust metode til identifikation af specifikke celletyper. Dette papir beskriver en protokol til visualisering af stammelignende prolifererende celler i hydrozoan vandmænd Cladonema pacificum. Cladonema medusae besidder forgrenede tentakler, der kontinuerligt vokser og opretholder regenerativ kapacitet i hele deres voksne fase, hvilket giver en unik platform til at studere de cellulære mekanismer, der er orkestreret af prolifererende og / eller stamlignende celler. Helmonteret fluorescerende in situ-hybridisering (FISH) ved hjælp af en stamcellemarkør muliggør påvisning af stamlignende celler, mens pulsmærkning med 5-ethynyl-2'-deoxyuridin (EdU), en S-fasemarkør, muliggør identifikation af prolifererende celler. Ved at kombinere både FISH- og EdU-mærkning kan vi detektere aktivt prolifererende stamceller på faste dyr, og denne teknik kan anvendes bredt på andre dyr, herunder ikke-model vandmændarter.

Cladonema tentakler er blevet brugt som model til at studere de cellulære processer af morfogenese og regenerering15,16,17. Tentakelstrukturen består af et epitelrør, hvor stamlignende celler eller i-celler er placeret i det proksimale område, kaldet tentakelpæren, og nye grene tilføjes sekventielt på bagsiden af pærens distale område langs adaxialsiden (figur 3A)...

Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Her beskriver vi en protokol til visualisering af stammelignende prolifererende celler i vandmændene Cladonema. Helmonteret fluorescerende in situ-hybridisering med en stamcellemarkør muliggør påvisning af stamlignende celler, og 5-ethynyl-2'-deoxyuridinmærkning muliggør identifikation af prolifererende celler. Sammen kan aktivt prolifererende stamlignende celler detekteres.

Fluorescerende in situ hybridisering og 5-ethynyl-2'-deoxyuridin mærkning for stamlignende celler i hydrozoan vandmænd Cladonema pacificum

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and ...

Co-farvning af Nanos1-ekspression med EdU-mærkning gør det muligt at skelne aktivt prolifererende stamlignende celler. Vi kan identificere stamlignende celler fordeling på enkeltcelleniveau i vandmændene Cladonema. Vi kan visualisere stamlignende celler og prolifererende celler i den samme vandmandsprøve, hvilket gør det muligt at detektere prolifererende og ikke-prolifererende stamlignende celler, hvilket fører til forståelse af stamcelle heterogenitet.Udviklingsbiologi og regenereringsundersøgelser ved hjælp af dyremodeller, der inkluderer stamceller. Hydrozoan vandmænd Cladonema pacificum er en ny modelorganisme, der kan opbevares i et laboratoriemiljø uden noget specialiseret system. Cladonema medusae har forgrenede tentakler.Forgreningen sker på et nyt sted langs den adaksiale side af tentakelen. Over tid fortsætter tentaklerne med at forlænge og forgrene sig, med ældre grene, der skubbes ud mod spidsen. Tentaklerne kan også regenerere inden for få dage efter amputation.Lille størrelse, nem håndtering og tilstedeværelsen af voksne stamceller eller stamlignende celler gør Cladonema til et godt system til at undersøge stamcellernes rolle i forskellige processer. Til at begynde med skal du placere Cladonema medusae i 1,5 milliliter rør ved hjælp af en 3,5 ml overførselspipette og tilsæt ASW op til et samlet volumen på 500 mikroliter. Tilsæt 7,5 mikroliter 10 millimolar EdU-stamopløsning og inkuber prøverne i en time ved 22 grader Celsius.Vent i en time, og fjern så meget ASW, der indeholder EdU som muligt. Efter bedøvelse af medusaen inkuberes i fem minutter. Fix medusae natten over ved fire grader Celsius med 4% paraformaldehyd i ASW.Til proteinasebehandling og efterfiksering fjernes paraformaldehyd, og prøverne vaskes med PBS indeholdende 0,1% Tween 20 tre gange i 10 minutter hver. Fjern PBST, og tilføj hybridiseringsbufferen. Inkuber prøverne i hybridiseringsbufferen i 15 minutter ved stuetemperatur.Fjern hybridiseringsbufferen, og tilføj den friske hybridiseringsbuffer. Forhybridiser ved 55 grader Celsius i mindst to timer i en hybridiseringsinkubator. Fjern hybridiseringsbufferen, og inkuber med hybridiseringsbufferen, der indeholder sonderne.Hybridiser ved 55 grader Celsius i 18 til 24 timer i en hybridiseringsinkubator. Fortsæt derefter med fjernelse af sonde. Start med at fjerne hybridiseringsbufferen, der indeholder sonder, og tilføj derefter vaskebufferen.Prøverne vaskes med vaskebuffer to gange i 15 minutter ved 55 grader Celsius. Fjern vaskebuffer en og tilføj vaskebuffer to. Prøverne vaskes med vaskebuffer to gange i 15 minutter ved 55 grader Celsius.Fjern vaskebuffer to, og tilføj derefter 2X SSC. Prøverne vaskes med 2X SSC to gange i 15 minutter ved 55 grader Celsius. Fjern 2X SSC, og tilføj derefter forvarmet PBST.Prøverne vaskes i 15 minutter med PBST ved stuetemperatur. For anti-DIG-antistofinkubation skal du starte med at fjerne PBST og derefter tilføje 1% blokerende buffer. Inkuber prøverne i mindst en time ved stuetemperatur, mens de rystes langsomt på en vippe.Efter blokering skal du fjerne 1% blokeringsbufferen. Tilsæt anti-DIG-POD-opløsning og inkuber prøverne natten over ved fire grader Celsius. For at detektere den DIG-mærkede sonde skal du fjerne anti-DIG-POD-opløsningen og tilføje trisnatriumchlorid Tween-buffer.Prøverne vaskes med trisnatriumchlorid Tween-buffer tre gange i 10 minutter ved stuetemperatur. Fortynd fluorescerende farvestof konjugeret tyramidstamopløsning i amplifikationsfortyndingsbufferen for at fremstille den aktive Cy5-tyramidopløsning. Fjern så meget trisnatriumchlorid Tween-buffer som muligt, og tilsæt derefter den aktive Cy5-tyramidopløsning.Inkuber prøverne i 10 minutter i mørke. Prøverne vaskes med PBST tre gange i 10 minutter i mørke. For at forberede EdU-detektionscocktailen blandes komponenterne.Fjern PBST, og tilføj derefter EdU-detektionscocktailen. Inkuber prøven i mørke i 30 minutter. Vask med PBST tre gange i 10 minutter i mørke.Til DNA-farvning fortyndes Hoechst i PBST for at fremstille Hoechst-opløsningen. Fjern PBST, og tilføj derefter Hoechst-opløsningen. Inkuber prøverne i 30 minutter i mørke.Prøverne vaskes med PBST tre til fire gange i 10 minutter i mørke. Derefter til montering overføres medusae til banken på glideglasset ved hjælp af en overførselspipette med spidsen afskåret. Placer forsigtigt en dækslip på medusae med tang og forsegl siden af dækslippen med klar neglelak.Co-mærkning af Nanos1-ekspression og EdU-positive celler afslørede det rumlige mønster af stamlignende celler og proliferative celler i tentakelen. EdU-positive celler blev mere udbredt i hele tentakelpæren, mens Nanos1-positive celler akkumulerede mere lokalt ved tentakelpæren og det nye forgreningssted, hvilket tyder på, at forskellige fordelinger af stamlignende celler og prolifererende celler detekteres afhængigt af udviklingstidspunktet og forskellige stadier. Co-mærkning af EdU og Nanos1 blev observeret i 19,79% af cellerne, hvilket tyder på, at disse celler er en aktivt prolifererende stamcellepopulation.Spændende nok viste 14,46% af cellerne sig at være EdU-positive Nanos1-negative midt i pæren og på det nye forgreningssted, hvilket tyder på tilstedeværelsen af ikke-stamlignende proliferative celler. I modsætning hertil blev 26,32% af cellerne observeret at være EdU-negative Nanos1-positive i bunden af pæren og på det nye forgreningssted, hvilket indikerer tilstedeværelsen af en stamcellepopulation, der enten er langsom cykling eller hvilende, hvoraf ingen er detekteret ved EdU-pulsmærkning. EdU-pulsmærkning med kort inkubationstid giver mulighed for påvisning af kun proliferative celler blandt stamlignende celler og ikke-stamlignende celler.Når inkubationstiden for EdU ændres og kombineres langvarige jagteksperimenter, kan langsomt cyklende stamceller eller andre celletyper, herunder afkom og differentierede celler, markeres.

fluorescent-situ-hybridization-5-ethynyl-2-deoxyuridine-labeling-for

Research

JoVE Journal

Developmental Biology

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development. The Xenopuslaevis embryo is very useful for studying organogenesis because their large size makes them very suitable for identifying organs at the earliest steps in organogenesis. At this time, the primary method used for identifying a specific organ or primordium is whole mount in situ hybridization with labeled antisense RNA probes specific to a gene that is expressed in the organ of interest. In addition, it is relatively easy to manipulate genes or signaling pathways in Xenopus and in situ hybridization allows one to then assay for changes in the presence or morphology of a target organ. Whole mount in situ hybridization is a multi-day protocol with many steps involved. Here we provide a simplified protocol with reduced numbers of steps and reagents used that works well for routine assays. In situ hybridization robots have greatly facilitated the process and we detail how and when we utilize that technology in the process. Once an in situ hybridization is complete, capturing the best image of the result can be frustrating. We provide advice on how to optimize imaging of in situ hybridization results. Although the protocol describes assessing organogenesis in Xenopus laevis, the same basic protocol can almost certainly be adapted to Xenopus tropicalis and other model systems.

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

The Xenopus laevis embryo continues to be exceptionally useful in the study of early development due to its large size and ease of manipulation. A simplified protocol for whole mount in situ hybridization protocol is provided that can be used in the identification of specific organs in this model system.

Forståelse Tidlig Organogenesis efter en forenklet<em&gt; In Situ</em&gt; Hybridization protokol<em&gt; Xenopus</em

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development.  The Xenopuslaevis embryo ...

Application of the DNA-Specific Stain Methyl Green in the Fluorescent Labeling of Embryos

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored until recently. In this article, we illustrate the method for preparing a methyl green aqueous stock solution, that when diluted can be used as a very convenient fluorescent nuclear label for fixed cells and tissues. Easy procedures to label whole zebrafish and chick embryos are detailed, and examples of images obtained shown. Methyl green is maximally excited by red light, at 633 nm, and emits with a relatively sharp spectrum that peaks at 677 nm. It is very inexpensive, non-toxic, highly stable in solution and very resistant to photobleaching when bound to DNA. Its red emission allows for unaltered high resolution scanning confocal imaging of nuclei in thick specimens. Finally, this methyl green staining protocol is compatible with other cell staining procedures, such as antibody labeling, or actin filaments labeling with fluorophore-conjugated phalloidin.

A method for fluorescent staining of fixed biological material with the specific DNA label methyl green is described. Methyl green is used in a diluted aqueous solution and is very resistant to photobleaching. Its far-red emission allows for deep specimen imaging, making it particularly adequate for whole embryos.

Anvendelse af DNA-specifik farvning Methyl Green i Fluorescent Labeling af embryoner

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored ...

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are expressed in spatial relation to each other in situ. Multi-target chromogenic whole-mount in situ hybridization (MC-WISH) greatly facilitates the instant comparison of gene expression patterns, as it allows distinctive visualization of different mRNA species in contrasting colors in the same sample specimen. This provides the possibility to relate gene expression domains topographically to each other with high accuracy and to define unique and overlapping expression sites. In the presented protocol, we describe a MC-WISH procedure for comparing mRNA expression patterns of different genes in Drosophila embryos. Up to three RNA probes, each specific for another gene and labeled by a different hapten, are simultaneously hybridized to the embryo samples and subsequently detected by alkaline phosphatase-based colorimetric immunohistochemistry. The described procedure is detailed here for Drosophila, but works equally well with zebrafish embryos.

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

We describe a multi-target chromogenic whole-mount in situ hybridization (MC-WISH) procedure in intact Drosophila embryos allowing simultaneous and specific detection of three different mRNA distribution patterns by contrasting color precipitates.

Multi-target Chromogenic Whole-mount<em&gt; In Situ</em&gt; Hybridisering til sammenligning genekspression domæner i<em&gt; Drosophila</em&gt; Embryoner

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

Dissektion og immunfluorescent farvning af champignon krop og fotoreceptor neuroner i voksen Drosophila melanogaster hjerner

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and optical transparency. In particular, the zebrafish embryo has become an important organism to study vertebrate kidney organogenesis as well as multiciliated cell (MCC) development. To visualize MCCs in the embryonic zebrafish kidney, we have developed a combined protocol of whole-mount fluorescent in situ hybridization (FISH) and whole mount immunofluorescence (IF) that enables high resolution imaging. This manuscript describes our technique for co-localizing RNA transcripts and protein as a tool to better understand the regulation of developmental programs through the expression of various lineage factors.

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

Cilia development is vital to proper organogenesis. This protocol describes an optimized method to label and visualize ciliated cells of the zebrafish.

Visualisere Multiciliated celler i zebrafisk gennem en kombineret protokol af hele Mount fluorescerende In Situ hybridisering og immunfluorescens

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and ...

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain and protect cellular identities. The conversion of germ cells into specific neurons in the nematode Caenorhabditis elegans (C. elegans) is a powerful tool for performing genetic screens in order to dissect regulatory pathways that safeguard established cell identities. Reprogramming of germ cells to a specific type of neurons termed ASE requires transgenic animals that allow broad over-expression of the Zn-finger transcription factor (TF) CHE-1. Endogenous CHE-1 is expressed exclusively in two head neurons and is required to specify the glutamatergic ASE neurons fate, which can easily be visualized by the gcy-5prom::gfp reporter. A trans gene containing the heat-shock promoter-driven che-1 gene expression construct allows broad mis-expression of CHE-1 in the entire animal upon heat-shock treatment. The combination of RNAi against the chromatin-regulating factor LIN-53 and heat-shock-induced che-1 over-expression leads to reprogramming of germ cell into ASE neuron-like cells. We describe here the specific RNAi procedure and appropriate conditions for heat-shock treatment of transgenic animals in order to successfully induce germ cell to neuron conversion.

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

This protocol describes how to study cellular processes during cell fate conversion in Caenorhabditis elegans in vivo. Using transgenic animals, allowing heat-shock promoter-driven overexpression of the neuron fate-inducing transcription factor CHE-1 and RNAi-mediated depletion of the chromatin-regulating factor LIN-53 germ cell to neuron reprogramming can be observed in vivo.

Anvendelse af RNAi og Heat-shock-induceret transskription faktor udtryk til at omprogrammere kønsceller til neuroner i C. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain ...

Wholemount In Situ Hybridization for Astyanax Embryos

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of genes. Prior research into this emerging model system capitalized on comprehensive genome-wide investigations that have identified numerous quantitative trait loci (QTL) associated with various cave-associated phenotypes. However, the ability to connect genes of interest to the heritable basis for phenotypic change remains a significant challenge. One technique that can facilitate deeper understanding of the role of development in troglomorphic evolution is whole-mount in situ hybridization. This technique can be implemented to directly compare gene expression between cave- and surface-dwelling forms, nominate candidate genes underlying established QTL, identify genes of interest from next-generation sequencing studies, or develop other discovery-based approaches. In this report, we present a simple protocol, supported by a flexible checklist, that can be widely adapted for use well beyond the presented study system. It is hoped that this protocol can serve as a broad resource for the Astyanax community and beyond.

Wholemount In Situ Hybridization for Astyanax Embryos

This protocol enables visualization of gene expression in embryonic Astyanax cavefish. This approach has been developed with the goal of maximizing gene expression signal, while minimizing non-specific background staining.

Wholemount i Situ hybridisering til Astyanax embryoner

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

I Vitro Generation af Somite derivater fra menneskelige induceret celler pluripotente stamceller

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Genotyping and Quantification of In Situ Hybridization Staining in Zebrafish

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in developmental biology for decades. Traditionally, most gene expression studies relied on visual evaluation of the ISH signal, a method that is prone to bias, particularly in cases where sample identities are known a priori. We have previously reported on a method to circumvent this bias and provide a more accurate quantification of ISH signals. Here, we present a simple guide to apply this method to quantify the expression levels of genes of interest in ISH-stained embryos and correlate that with their corresponding genotypes. The method is particularly useful to quantify spatially restricted gene expression signals in samples of mixed genotypes and it provides an unbiased and accurate alternative to the traditional visual scoring methods.

Gene editing technologies have enabled researchers to generate zebrafish mutants to investigate gene function with relative ease. Here, we provide a guide to perform parallel embryo genotyping and quantification of in situ hybridization signals in zebrafish. This unbiased approach provides greater accuracy in phenotypical analyses based on in situ hybridization.

Genoyping og kvantificering af In Situ Hybridization Farvning i Zebrafisk

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in ...

Whole-Mount In Situ Hybridization in Zebrafish Embryos and Tube Formation Assay in iPSC-ECs to Study the Role of Endoglin in Vascular Development

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in zebrafish during different developmental stages. To investigate the role of endoglin(eng) in vessel formation during the development of hereditary hemorrhagic telangiectasia&#160;(HHT), morpholino-mediated targeted knockdown of eng in zebrafish are used to study its temporal expression and associated functions. Here, whole-mount in situ RNA hybridization (WISH) is employed for the analysis of eng and its downstream genes in zebrafish embryos. Also, tube formation assays are performed in HHT patient-derived induced pluripotent stem cell-differentiated&#160;endothelial cells (iPSC-ECs; with eng mutations). A specific signal amplifying system using the whole amount In Situ Hybridization &#8211; WISH provides higher resolution and lower background results compared to traditional methods. To obtain a better signal, the post-fixation time is adjusted to 30 min after probe hybridization. Because fluorescence staining is not sensitive in zebrafish embryos, it is replaced with diaminobezidine (DAB) staining here. In this protocol, HHT&#160;patient-derived iPSC lines containing an eng mutation are differentiated into endothelial cells. After coating a plate with basement membrane matrix for 30 min at 37 &#176;C, iPSC-ECs are seeded as a monolayer into wells and kept at 37 &#176;C for 3 h. Then, the tube length and number of branches are calculated using microscopic images. Thus, with this improved WISH protocol, it is shown that reduced eng expression affects endothelial progenitor formation in zebrafish embryos. This is further confirmed by tube formation assays using iPSC-ECs derived from a patient with HHT. These assays confirm the role for eng in early vascular development.

Presented here is a protocol for whole-mount in situ RNA hybridization analysis in zebrafish and tube formation assay in patient-derived induced pluripotent stem cell-derived endothelial cells to study the role of endoglin in vascular formation.

Whole-Mount In Situ Hybridization i Zebrafish Embryoner og Tube Formation Assay i iPSC-ECs at studere den rolle, Endoglin i vaskulær udvikling

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in ...