Name: fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum
Uploaded: 2022-08-03T15:00:00
Description: Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Ce travail a été soutenu par AMED sous le numéro de subvention JP22gm6110025 (à Y.N.) et par le numéro de subvention JSPS KAKENHI 22H02762 (à Y.N.).

REMARQUE : Consultez le tableau des matériaux pour plus de détails sur tous les matériaux, réactifs et équipements utilisés dans ce protocole.
1. Synthèse de sonde
<ol><li>Extraction d’ARN<ol><li>Placez trois Cladonema medusae vivants cultivés dans de l’eau de mer artificielle (ASW) dans un tube de 1,5 mL à l’aide d’une pipette de transfert de 3,1 mL avec l’embout coupé, et retirez autant d’ASW que possible. NOTE: ASW est pr...

<ol>
	<li>Lecl&#232;re, L., R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+cnidarian+muscles:+Function,+anatomy,+development+and+regeneration.">Diversity of cnidarian muscles: Function, anatomy, development and regeneration.</a> Frontiers in Cell and Developmental Biology. 4, 157 (2017).</li><li>Bosch, T. C. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Back+to+the+basics:+Cnidarians+start+to+fire.">Back to the basics: Cnidarians start to fire.</a> Trends in Neurosciences. 40 (2), 92-105 (2017).</li><li>Gold, D. A., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+dynamics+in+Cnidaria:+Are+there+unifying+principles.">Stem cell dynamics in Cnidaria: Are there unifying principles.</a> Development Genes and Evolution. 223 (1-2), 53-66 (2013).</li><li>Technau, U., Steele, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+crossroads+in+developmental+biology:+Cnidaria.">Evolutionary crossroads in developmental biology: Cnidaria.</a> Development. 138 (8), 1447-1458 (2011).</li><li>Lecl&#232;re, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternally+localized+germ+plasm+mRNAs+and+germ+cell/stem+cell+formation+in+the+cnidarian+Clytia.">Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the cnidarian Clytia.</a> Developmental Biology. 364 (2), 236-248 (2012).</li><li>Bradshaw, B., Thompson, K., Frank, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+mechanisms+underlie+oral+vs+aboral+regeneration+in+the+cnidarian+Hydractinia+echinata.">Distinct mechanisms underlie oral vs aboral regeneration in the cnidarian Hydractinia echinata.</a> eLife. 4, 05506 (2015).</li><li>Sinigaglia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pattern+regulation+in+a+regenerating+jellyfish.">Pattern regulation in a regenerating jellyfish.</a> eLife. 9, 54868 (2020).</li><li>David, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interstitial+stem+cells+in+Hydra:+Multipotency+and+decision-making.">Interstitial stem cells in Hydra: Multipotency and decision-making.</a> The International Journal of Developmental Biology. 56 (6-7-8), 489-497 (2012).</li><li>R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nematostella+vectensis,+an+emerging+model+for+deciphering+the+molecular+and+cellular+mechanisms+underlying+whole-body+regeneration.">Nematostella vectensis, an emerging model for deciphering the molecular and cellular mechanisms underlying whole-body regeneration.</a> Cells. 10 (10), 2692 (2021).</li><li>Houliston, E., Momose, T., Manuel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clytia+hemisphaerica:+A+jellyfish+cousin+joins+the+laboratory.">Clytia hemisphaerica: A jellyfish cousin joins the laboratory.</a> Trends in Genetics. 26 (4), 159-167 (2010).</li><li>Peron, S., Houliston, E., Lecl&#232;re, L., Boutet, A., Shierwater, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Marine+Jellyfish+Model,+Clytia+hemisphaerica.">The Marine Jellyfish Model, Clytia hemisphaerica.</a> Handbook of Marine Model Organisms in Experimental Biology. , 129-147 (2021).</li><li>Denker, E., Manuel, M., Lecl&#232;re, L., Le Guyader, H., Rabet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ordered+progression+of+nematogenesis+from+stem+cells+through+differentiation+stages+in+the+tentacle+bulb+of+Clytia+hemisphaerica+(Hydrozoa,+Cnidaria).">Ordered progression of nematogenesis from stem cells through differentiation stages in the tentacle bulb of Clytia hemisphaerica (Hydrozoa, Cnidaria).</a> Developmental Biology. 315 (1), 99-113 (2008).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regeneration+potential+of+jellyfish:+Cellular+mechanisms+and+molecular+insights.">Regeneration potential of jellyfish: Cellular mechanisms and molecular insights.</a> Genes. 12 (5), 758 (2021).</li><li>Suga, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flexibly+deployed+Pax+genes+in+eye+development+at+the+early+evolution+of+animals+demonstrated+by+studies+on+a+hydrozoan+jellyfish.">Flexibly deployed Pax genes in eye development at the early evolution of animals demonstrated by studies on a hydrozoan jellyfish.</a> Proceedings of the National Academy of Sciences. 107 (32), 14263-14268 (2010).</li><li>Fujiki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Branching+pattern+and+morphogenesis+of+medusa+tentacles+in+the+jellyfish+Cladonema+pacificum+(Hydrozoa,+Cnidaria).">Branching pattern and morphogenesis of medusa tentacles in the jellyfish Cladonema pacificum (Hydrozoa, Cnidaria).</a> Zoological Letters. 5 (12), 13 (2019).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+controls+body+size+growth,+tentacle+morphogenesis,+and+regeneration+in+hydrozoan+jellyfish+Cladonema+pacificum.">Cell proliferation controls body size growth, tentacle morphogenesis, and regeneration in hydrozoan jellyfish Cladonema pacificum.</a> PeerJ. 7, 7579 (2019).</li><li>Hou, S., Zhu, J., Shibata, S., Nakamoto, A., Kumano, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repetitive+accumulation+of+interstitial+cells+generates+the+branched+structure+of+Cladonema+medusa+tentacles.">Repetitive accumulation of interstitial cells generates the branched structure of Cladonema medusa tentacles.</a> Development. 148 (23), (2021).</li><li>Salic, A., Mitchison, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+method+for+fast+and+sensitive+detection+of+DNA+synthesis+in+vivo.">A chemical method for fast and sensitive detection of DNA synthesis in vivo.</a> Proceedings of the National Academy of Sciences of the United States of America. 105 (7), 2415-2420 (2008).</li><li>Angerer, L. M., Angerer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+poly+A+++RNA+in+sea+urchin+eggs+and+embryos+by+quantitative+in+situ+hybridization.">Detection of poly A + RNA in sea urchin eggs and embryos by quantitative in situ hybridization.</a> Nucleic Acids Research. 9 (12), 2819-2840 (1981).</li><li>Rakotomamonjy, J., Guemez-Gamboa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purkinje+cell+survival+in+organotypic+cerebellar+slice+cultures.">Purkinje cell survival in organotypic cerebellar slice cultures.</a> Journal of Visualized Experiments. (154), e60353 (2019).</li><li>Tanaka, E. M., Reddien, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+basis+for+animal+regeneration.">The cellular basis for animal regeneration.</a> Developmental Cell. 21 (1), 172-185 (2011).</li><li>Penzo-M&#233;ndez, A. I., Stanger, B. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ-size+regulation+in+mammals.">Organ-size regulation in mammals.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), 019240 (2015).</li><li>Sinigaglia, C., Thiel, D., Hejnol, A., Houliston, E., Lecl&#232;re, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+safer,+urea-based+in+situ+hybridization+method+improves+detection+of+gene+expression+in+diverse+animal+species.">A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species.</a> Developmental Biology. 434 (1), 15-23 (2018).</li><li>King, R. S., Newmark, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+protocol+for+enhanced+detection+of+gene+expression+in+the+planarian+Schmidtea+mediterranea.">In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea.</a> BMC Developmental Biology. 13 (1), 8 (2013).</li><li>Flici, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+evolutionarily+conserved+SoxB-Hdac2+crosstalk+regulates+neurogenesis+in+a+cnidarian.">An evolutionarily conserved SoxB-Hdac2 crosstalk regulates neurogenesis in a cnidarian.</a> Cell Reports. 18 (6), 1395-1409 (2017).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axial+Hox+code+controls+tissue+segmentation+and+body+patterning+in+Nematostella+vectensis.">An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.</a> Science. 361 (6409), 1377-1380 (2018).</li><li>Govindasamy, N., Murthy, S., Ghanekar, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Slow-cycling+stem+cells+in+hydra+contribute+to+head+regeneration.">Slow-cycling stem cells in hydra contribute to head regeneration.</a> Biology Open. 3 (12), 1236-1244 (2014).</li><li>Passamaneck, Y. J., Martindale, M. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+is+necessary+for+the+regeneration+of+oral+structures+in+the+anthozoan+cnidarian+Nematostella+vectensis.">Cell proliferation is necessary for the regeneration of oral structures in the anthozoan cnidarian Nematostella vectensis.</a> BMC Developmental Biology. 12 (1), 34 (2012).</li><li>Gold, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+developmental+disparity+in+the+tentacles+of+the+moon+jellyfish+Aurelia+sp.1.">Structural and developmental disparity in the tentacles of the moon jellyfish Aurelia sp.1.</a> PLoS One. 10 (8), 0134741 (2015).</li><li>Gold, D. A., Nakanishi, N., Hensley, N. M., Hartenstein, V., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+tracking+supports+secondary+gastrulation+in+the+moon+jellyfish+Aurelia.">Cell tracking supports secondary gastrulation in the moon jellyfish Aurelia.</a> Development Genes and Evolution. 226 (6), 383-387 (2016).</li><li>Cheng, L. -. C., Alvarado, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-mount+BrdU+staining+with+fluorescence+in+situ+hybridization+in+planarians.">Whole-mount BrdU staining with fluorescence in situ hybridization in planarians.</a> Planarian Regeneration. 1774, 423-434 (2018).</li></ol>

Les cellules proliférantes et les cellules souches sont des sources cellulaires importantes dans divers processus tels que la morphogenèse, la croissance et la régénération21,22. Cet article décrit une méthode de co-coloration du marqueur de cellules souches Nanos1 par marquage FISH et EdU chez Cladonema medusae. Des travaux antérieurs utilisant le marquage EdU ou BrdU ont suggéré que les cellules prolifératives se localisent aux bulb...

Cnidaria est considéré comme un phylum métazoaire à ramification basale contenant des animaux dotés de nerfs et de muscles, les plaçant dans une position unique pour comprendre l’évolution du développement et de la physiologie des animaux 1,2. Les cnidaires sont classés en deux groupes principaux: les anthozoaires (par exemple, les anémones de mer et les coraux) ne possèdent que des larves de planula et des stades de polypes sessiles, tandis que les méduses (membres des hydrozoaires, des staurozoaires, des scyphozoaires et des cubozoa) prennent généralement la forme de méduses nageant librement, ou méduses, ainsi que de larves et de polypes planula. Les Cnidaires présentent généralement une capacité de régénération élevée, et leurs mécanismes cellulaires sous-jacents, en particulier leur possession de cellules souches adultes et de cellules prolifératives, ont attiré beaucoup d’attention 3,4. Initialement identifiées dans Hydra, les cellules souches hydrozoaires sont situées dans les espaces interstitiels entre les cellules épithéliales ectodermiques et sont communément appelées cellules interstitielles ou cellules i3.
Les cellules i hydrozoaires partagent des caractéristiques communes qui comprennent la multipotence, l’expression de marqueurs de cellules souches largement conservés (par exemple, Nanos, Piwi, Vasa) et le potentiel de migration 3,5,6,7,8. En tant que cellules souches fonctionnelles, les i-cellules sont largement impliquées dans le développement, la physiologie et les réponses environnementales des animaux hydrozoaires, ce qui atteste de leur capacité de régénération élevée et de leur plasticité3. Alors que les cellules souches, similaires aux cellules i, n’ont pas été identifiées en dehors des hydrozoaires, même chez l’espèce modèle établie Nematostella, les cellules prolifératives sont toujours impliquées dans le maintien et la régénération du tissu somatique, ainsi que dans la lignée germinale9. Comme les études sur le développement et la régénération des cnidaires ont été principalement menées sur des animaux de type polype tels que Hydra, Hydractinia et Nematostella, la dynamique cellulaire et les fonctions des cellules souches chez les espèces de méduses restent largement ignorées.
La méduse hydrozoaire Clytia hemisphaerica , une espèce de méduse cosmopolite avec différents habitats à travers le monde, y compris la mer Méditerranée et l’Amérique du Nord, a été utilisée comme animal modèle expérimental dans plusieurs études développementales et évolutives10. Avec sa petite taille, sa manipulation facile et ses œufs volumineux, Clytia convient à l’entretien en laboratoire, ainsi qu’à l’introduction d’outils génétiques tels que les méthodes de transgénèse et d’élimination11 récemment établies, ouvrant la voie à une analyse détaillée des mécanismes cellulaires et moléculaires sous-jacents à la biologie des méduses. Dans le tentacule de Clytia medusa, les cellules i sont localisées dans la région proximale, appelée bulbe, et les progéniteurs tels que les nématoblastes migrent vers l’extrémité distale tout en se différenciant en types cellulaires distincts, y compris les nématocytes12.
Lors de la régénération du Clytia manubrium, l’organe buccal des méduses, les cellules Nanos1+ i présentes dans les gonades migrent vers la région où le manubrium est perdu en réponse à des dommages et participent à la régénération du manubrium7. Ces résultats soutiennent l’idée que les cellules i de Clytia se comportent également comme des cellules souches fonctionnelles impliquées dans la morphogenèse et la régénération. Cependant, étant donné que les propriétés des cellules i diffèrent parmi les animaux représentatifs de type polype tels que Hydra et Hydractinia3, il est possible que les caractéristiques et les fonctions des cellules souches soient diversifiées parmi les espèces de méduses. De plus, à l’exception de Clytia, les techniques expérimentales ont été limitées pour les autres méduses, et la dynamique détaillée des cellules prolifératives et des cellules souches est inconnue13.
La méduse hydrozoaire Cladonema pacificum est un organisme modèle émergent qui peut être conservé dans un environnement de laboratoire sans pompe à eau ni système de filtration. Le Cladonema medusa a des tentacules ramifiés, une caractéristique commune dans la famille des Cladonematidae, et un organe photorécepteur appelé ocelle sur la couche ectodermique près du bulbe14. Le processus de ramification du tentacule se produit à un nouveau site de ramification qui apparaît le long du côté adaxial du tentacule. Au fil du temps, les tentacules continuent de s’allonger et de se ramifier, les branches les plus anciennes étant poussées vers la pointe15. De plus, les tentacules du cladonème peuvent se régénérer quelques jours après l’amputation. Des études récentes ont suggéré le rôle des cellules proliférantes et des cellules souches dans la ramification et la régénération des tentacules chez Cladonema16,17. Cependant, alors que l’hybridation in situ conventionnelle (ISH) a été utilisée pour visualiser l’expression génique dans Cladonema, en raison de sa faible résolution, il est actuellement difficile d’observer en détail la dynamique des cellules souches au niveau cellulaire.
Cet article décrit une méthode de visualisation de cellules souches dans Cladonema par FISH et de co-coloration avec EdU, un marqueur de prolifération cellulaire18. Nous visualisons le modèle d’expression de Nanos1, un marqueur de cellules souches 5,17, par FISH, qui permet l’identification de la distribution des cellules souches au niveau de la cellule unique. De plus, la co-coloration de l’expression de Nanos1 avec le marquage EdU permet de distinguer les cellules souches qui prolifèrent activement. Cette méthode de surveillance des cellules souches et des cellules prolifératives peut être appliquée à un large éventail de domaines d’investigation, y compris la ramification des tentacules, l’homéostasie tissulaire et la régénération des organes chez Cladonema, et une approche similaire peut être appliquée à d’autres espèces de méduses.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-Mercaptoethanol&#160;</td>
			<td>Wako</td>
			<td>137-06862</td>
			<td></td>
		</tr>
		<tr>
			<td>3.1 mL transfer pipette</td>
			<td>Thermo Scientific</td>
			<td>233-20S</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-4-chloro-3-indolyl-&#946;-D-galactopyranoside (X-Gal)</td>
			<td>Wako</td>
			<td>029-15043</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-DIG-POD</td>
			<td>Roche</td>
			<td>11207733910</td>
			<td></td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-AAGAGACACAGTCATTATCAAGC 
			GA-3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-CGACGTGTCCAATTTTACGTGCT -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- AAAAGAGCAGCGGCCAGAAAGA 
			AGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- GCGGGTCGCATACTTGTTGGTA 
			CTGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye</td>
			<td>Invitrogen&#160;</td>
			<td>C10337</td>
			<td>EdU kit</td>
		</tr>
		<tr>
			<td>Coroline off</td>
			<td>GEX Co. ltd</td>
			<td>N/A</td>
			<td>chlorine neutralizer</td>
		</tr>
		<tr>
			<td>DIG Nucleic Acid Detection Kit Blocking Reagent</td>
			<td>Roche</td>
			<td>11175041910</td>
			<td>blocking buffer&#160;</td>
		</tr>
		<tr>
			<td>DIG RNA labeling mix&#160;</td>
			<td>Roche</td>
			<td>11277073910</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>Promega</td>
			<td>P117B</td>
			<td></td>
		</tr>
		<tr>
			<td>ECOS competent cell DH5&#945;</td>
			<td>NIPPON GENE</td>
			<td>316-06233</td>
			<td>competent cell</td>
		</tr>
		<tr>
			<td>Fast gene Gel/PCR Extraction kit</td>
			<td>Fast gene</td>
			<td>FG-91302</td>
			<td>gel extraction kit</td>
		</tr>
		<tr>
			<td>Fast gene plasmid mini kit</td>
			<td>Fast gene</td>
			<td>FG-90502</td>
			<td>plasmid miniprep</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Wako&#160;</td>
			<td>068-00426</td>
			<td></td>
		</tr>
		<tr>
			<td>Heparin sodium salt from porcine</td>
			<td>SIGMA-ALDRICH&#160;</td>
			<td>H3393-10KU</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl-&#946;-D(-)-thiogalactopyranoside (IPTG)</td>
			<td>Wako</td>
			<td>096-05143</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar</td>
			<td>Invitrogen</td>
			<td>22700-025</td>
			<td>agar plate</td>
		</tr>
		<tr>
			<td>LB Broth Base</td>
			<td>Invitrogen</td>
			<td>12780-052</td>
			<td>LB medium</td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Wako</td>
			<td>134-00495</td>
			<td></td>
		</tr>
		<tr>
			<td>mini Quick spin RNA columns</td>
			<td>Roche</td>
			<td>11814427001</td>
			<td>clean-up column</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Wako&#160;</td>
			<td>191-01665</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop OneC Microvolume UV-Vis Spectrophotometer with Wi-Fi</td>
			<td>Thermo Scientific</td>
			<td>ND-ONEC-W</td>
			<td>spectrophotometer</td>
		</tr>
		<tr>
			<td>Polyoxyethlene (20) Sorbitan Monolaurate (Tween-20)</td>
			<td>Wako&#160;</td>
			<td>166-21115</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerMasher 2</td>
			<td>nippi&#160;</td>
			<td>891300</td>
			<td>homogenizer</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Nacarai Tesque&#160;</td>
			<td>29442-14</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor</td>
			<td>TaKaRa</td>
			<td>2313A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen&#160;</td>
			<td>74004</td>
			<td>total RNA isolation kit</td>
		</tr>
		<tr>
			<td>RQ1 RNase-Free Dnase</td>
			<td>Promega</td>
			<td>M6101</td>
			<td></td>
		</tr>
		<tr>
			<td>Saline Sodium Citrate Buffer 20x powder (20x SSC)</td>
			<td>TaKaRa</td>
			<td>T9172</td>
			<td></td>
		</tr>
		<tr>
			<td>SEA LIFE</td>
			<td>Marin Tech</td>
			<td>N/A</td>
			<td>mixture of mineral salts</td>
		</tr>
		<tr>
			<td>T3 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>11031163001</td>
			<td></td>
		</tr>
		<tr>
			<td>T7 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>10881767001</td>
			<td></td>
		</tr>
		<tr>
			<td>TAITEC HB-100</td>
			<td>TAITEC</td>
			<td>0040534-000</td>
			<td>Hybridization incuvator</td>
		</tr>
		<tr>
			<td>TaKaRa Ex Taq&#160;</td>
			<td>TaKaRa</td>
			<td>RR001A</td>
			<td>Taq DNA polymerase</td>
		</tr>
		<tr>
			<td>TaKaRa PrimeScript 2 1st strand cDNA Synthesis Kit</td>
			<td>TaKaRa</td>
			<td>6210A</td>
			<td>cDNA synthesis kit</td>
		</tr>
		<tr>
			<td>Target Clone</td>
			<td>TOYOBO&#160;</td>
			<td>TAK101</td>
			<td>pTA2 Vector</td>
		</tr>
		<tr>
			<td>tRNA</td>
			<td>Roche</td>
			<td>10109541001</td>
			<td></td>
		</tr>
		<tr>
			<td>TSA Plus Cyanine 5</td>
			<td>AKOYA Biosciences</td>
			<td>NEL745001KT</td>
			<td>tyramide signal amplification (TSA) technique</td>
		</tr>
		<tr>
			<td>Zeiss LSM 880</td>
			<td>ZEISS</td>
			<td>N/A</td>
			<td>laser scanning confocal microscope</td>
		</tr>
	</tbody>
</table>

fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum

Les cnidaires, y compris les anémones de mer, les coraux et les méduses, présentent une morphologie et des modes de vie variés qui se manifestent par des polypes sessiles et des méduses nageant librement. Comme l’illustrent les modèles établis tels que Hydra et Nematostella, les cellules souches et/ou les cellules prolifératives contribuent au développement et à la régénération des polypes cnidaires. Cependant, les mécanismes cellulaires sous-jacents chez la plupart des méduses, en particulier au stade de la méduse, sont largement flous et, par conséquent, le développement d’une méthode robuste pour identifier des types cellulaires spécifiques est essentiel. Cet article décrit un protocole pour visualiser les cellules proliférantes de type souche chez la méduse hydrozoaire Cladonema pacificum. Cladonema medusae possède des tentacules ramifiés qui se développent continuellement et maintiennent une capacité de régénération tout au long de leur stade adulte, fournissant une plate-forme unique pour étudier les mécanismes cellulaires orchestrés par la prolifération et / ou les cellules souches. L’hybridation in situ fluorescente à montage entier (FISH) à l’aide d’un marqueur de cellules souches permet la détection de cellules de type souches, tandis que le marquage par impulsions avec la 5-éthynyl-2'-désoxyuridine (EdU), un marqueur de phase S, permet l’identification des cellules proliférantes. En combinant à la fois l’étiquetage FISH et EdU, nous pouvons détecter la prolifération active de cellules souches sur des animaux fixes, et cette technique peut être largement appliquée à d’autres animaux, y compris des espèces de méduses non modèles.

Les tentacules du cladonème ont été utilisés comme modèle pour étudier les processus cellulaires de morphogenèse et de régénération15,16,17. La structure du tentacule est composée d’un tube épithélial où des cellules de type souche, ou cellules i, sont situées dans la région proximale, appelée bulbe tentacule, et de nouvelles branches sont ajoutées séquentiellement à l’arrière de la région dist...

Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Ici, nous décrivons un protocole pour visualiser les cellules proliférantes de type souche dans la méduse Cladonema. L’hybridation in situ fluorescente à montage entier avec un marqueur de cellules souches permet la détection de cellules souches, et le marquage de la 5-éthynyl-2'-désoxyuridine permet l’identification des cellules proliférantes. Ensemble, des cellules souches proliférant activement peuvent être détectées.

Hybridation fluorescente in situ et marquage de la 5-éthynyl-2'-désoxyuridine pour les cellules souches de la méduse hydrozoaire Cladonema pacificum

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and ...

La co-coloration de l’expression de Nanos1 avec le marquage EdU permet de distinguer les cellules souches qui prolifèrent activement. Nous pouvons identifier la distribution des cellules souches au niveau de la cellule unique chez la méduse Cladonema. Nous pouvons visualiser des cellules souches et des cellules proliférantes dans le même échantillon de méduses, ce qui permet de détecter des cellules souches proliférantes et non proliférantes, ce qui permet de comprendre l’hétérogénéité des cellules souches.Biologie du développement et études de régénération utilisant des modèles animaux incluant des cellules souches. La méduse hydrozoaire Cladonema pacificum est un organisme modèle émergent qui peut être conservé dans un environnement de laboratoire sans aucun système spécialisé. Cladonema medusae a des tentacules ramifiés.La ramification se produit à un nouveau site le long du côté adaxial du tentacule. Au fil du temps, les tentacules continuent de s’allonger et de se ramifier, les branches plus anciennes étant poussées vers la pointe. Les tentacules peuvent également se régénérer quelques jours après l’amputation.La petite taille, la facilité de manipulation et la présence de cellules souches adultes ou de cellules souches font de Cladonema un bon système pour étudier le rôle des cellules souches dans différents processus. Pour commencer, placez Cladonema medusae dans des tubes de 1,5 millilitre à l’aide d’une pipette de transfert de 3,5 millilitres et ajoutez ASW jusqu’à un volume total de 500 microlitres. Ajouter 7,5 microlitres de solution mère d’EdU 10 millimolaires et incuber les échantillons pendant une heure à 22 degrés Celsius.Attendez une heure et retirez autant d’ASW contenant EdU que possible. Après avoir anesthésié les méduses, incuber pendant cinq minutes. Fixer les méduses pendant la nuit à quatre degrés Celsius avec 4% de paraformaldéhyde dans ASW.Pour le traitement par protéinase et la post-fixation, retirer le paraformaldéhyde et laver les échantillons avec du PBS contenant 0,1% Tween 20 trois fois pendant 10 minutes chacun. Retirez le PBST et ajoutez le tampon d’hybridation. Incuber les échantillons dans le tampon d’hybridation pendant 15 minutes à température ambiante.Supprimez le tampon d’hybridation et ajoutez le nouveau tampon d’hybridation. Pré-hybrider à 55 degrés Celsius pendant au moins deux heures dans un incubateur d’hybridation. Retirez le tampon d’hybridation et incuber avec le tampon d’hybridation contenant les sondes.Hybrider à 55 degrés Celsius pendant 18 à 24 heures dans un incubateur d’hybridation. Ensuite, procédez au retrait de la sonde. Commencez par retirer le tampon d’hybridation contenant les sondes, puis ajoutez un tampon de lavage.Lavez les échantillons avec un tampon de lavage deux fois pendant 15 minutes à 55 degrés Celsius. Retirez le tampon de lavage un et ajoutez le tampon de lavage deux. Lavez les échantillons avec un tampon de lavage deux fois pendant 15 minutes à 55 degrés Celsius.Retirez le tampon de lavage deux, puis ajoutez 2X SSC. Lavez les échantillons avec 2X SSC deux fois pendant 15 minutes à 55 degrés Celsius. Retirez 2X SSC, puis ajoutez PBST préchauffé.Lavez les échantillons pendant 15 minutes avec du PBST à température ambiante. Pour l’incubation d’anticorps anti-DIG, commencez par supprimer le PBST, puis ajoutez un tampon bloquant à 1%. Incuber les échantillons pendant au moins une heure à température ambiante tout en agitant lentement sur une bascule.Après le blocage, supprimez le tampon 1%blocking. Ajouter la solution anti-DIG-POD et incuber les échantillons pendant la nuit à quatre degrés Celsius. Pour détecter la sonde marquée DIG, retirez la solution anti-DIG-POD et ajoutez le tampon Tris sodium chlorure Tween.Laver les échantillons avec le tampon Tris sodium chlorure Tween trois fois pendant 10 minutes à température ambiante. Diluer la solution mère de tyramide conjuguée à colorant fluorescent dans le tampon de diluant d’amplification pour obtenir la solution active de tyramide Cy5. Retirer autant de tampon Tris sodium chlorure Tween que possible, puis ajouter la solution active de Cy5 tyramide.Incuber les échantillons pendant 10 minutes dans l’obscurité. Lavez les échantillons avec du PBST trois fois pendant 10 minutes dans l’obscurité. Pour préparer le cocktail de détection EdU, mélangez les composants.Retirez PBST, puis ajoutez le cocktail de détection EdU. Incuber l’échantillon dans l’obscurité pendant 30 minutes. Laver avec PBST trois fois pendant 10 minutes dans l’obscurité.Pour la coloration de l’ADN, diluer Hoechst dans du PBST pour préparer la solution de Hoechst. Retirez le PBST, puis ajoutez la solution Hoechst. Incuber les échantillons pendant 30 minutes dans l’obscurité.Lavez les échantillons avec du PBST trois à quatre fois pendant 10 minutes dans l’obscurité. Ensuite, pour le montage, transférez les méduses sur la banque sur le verre coulissant à l’aide d’une pipette de transfert avec la pointe coupée. Placez délicatement un bordereau sur la méduse avec une pince et scellez le côté du couvercle avec du vernis à ongles transparent.Le co-marquage de l’expression de Nanos1 et des cellules positives EdU a révélé le modèle spatial des cellules souches et des cellules prolifératives dans le tentacule. Les cellules EdU positives étaient plus largement réparties dans le bulbe tentacule, tandis que les cellules positives Nanos1 accumulées plus localement au bulbe tentacule et au nouveau site de ramification, suggèrent que des distributions distinctes de cellules souches et de cellules proliférantes sont détectées en fonction du moment du développement et des différents stades. Le comarquage d’EdU et de Nanos1 a été observé dans 19,79% des cellules, ce qui suggère que ces cellules constituent une population de cellules souches en prolifération active.Curieusement, 14,46% des cellules se sont avérées EdU positives Nanos1 négatives au milieu du bulbe et au nouveau site de ramification, suggérant la présence de cellules prolifératives non souches. En revanche, 26,32 % des cellules ont été observées comme étant Nanos1 positives à la base du bulbe et au nouveau site de ramification, ce qui indique la présence d’une population de cellules souches à cycle lent ou au repos, dont aucune n’est détectée par le marquage des impulsions EdU. Le marquage par impulsions EdU avec un temps d’incubation court permet de détecter uniquement des cellules prolifératives parmi les cellules souches et les cellules non souches.Lors de la modification du temps d’incubation de l’EdU et de la combinaison d’expériences de poursuite à long terme, les cellules souches à cycle lent ou d’autres types de cellules, y compris la descendance et les cellules différenciées, peuvent être marquées.

fluorescent-situ-hybridization-5-ethynyl-2-deoxyuridine-labeling-for

Research

JoVE Journal

Developmental Biology

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development. The Xenopuslaevis embryo is very useful for studying organogenesis because their large size makes them very suitable for identifying organs at the earliest steps in organogenesis. At this time, the primary method used for identifying a specific organ or primordium is whole mount in situ hybridization with labeled antisense RNA probes specific to a gene that is expressed in the organ of interest. In addition, it is relatively easy to manipulate genes or signaling pathways in Xenopus and in situ hybridization allows one to then assay for changes in the presence or morphology of a target organ. Whole mount in situ hybridization is a multi-day protocol with many steps involved. Here we provide a simplified protocol with reduced numbers of steps and reagents used that works well for routine assays. In situ hybridization robots have greatly facilitated the process and we detail how and when we utilize that technology in the process. Once an in situ hybridization is complete, capturing the best image of the result can be frustrating. We provide advice on how to optimize imaging of in situ hybridization results. Although the protocol describes assessing organogenesis in Xenopus laevis, the same basic protocol can almost certainly be adapted to Xenopus tropicalis and other model systems.

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

The Xenopus laevis embryo continues to be exceptionally useful in the study of early development due to its large size and ease of manipulation. A simplified protocol for whole mount in situ hybridization protocol is provided that can be used in the identification of specific organs in this model system.

Comprendre organogenèse précoce aide d&#39;un simplifié<em&gt; In Situ</em&gt; Protocole hybridation in<em&gt; Xenopus</em

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development.  The Xenopuslaevis embryo ...

Recherche

Biologie du développement

Application of the DNA-Specific Stain Methyl Green in the Fluorescent Labeling of Embryos

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored until recently. In this article, we illustrate the method for preparing a methyl green aqueous stock solution, that when diluted can be used as a very convenient fluorescent nuclear label for fixed cells and tissues. Easy procedures to label whole zebrafish and chick embryos are detailed, and examples of images obtained shown. Methyl green is maximally excited by red light, at 633 nm, and emits with a relatively sharp spectrum that peaks at 677 nm. It is very inexpensive, non-toxic, highly stable in solution and very resistant to photobleaching when bound to DNA. Its red emission allows for unaltered high resolution scanning confocal imaging of nuclei in thick specimens. Finally, this methyl green staining protocol is compatible with other cell staining procedures, such as antibody labeling, or actin filaments labeling with fluorophore-conjugated phalloidin.

A method for fluorescent staining of fixed biological material with the specific DNA label methyl green is described. Methyl green is used in a diluted aqueous solution and is very resistant to photobleaching. Its far-red emission allows for deep specimen imaging, making it particularly adequate for whole embryos.

Application de la tache verte de méthyle DNA-spécifique dans le Marquage fluorescent d&#39;embryons

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored ...

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are expressed in spatial relation to each other in situ. Multi-target chromogenic whole-mount in situ hybridization (MC-WISH) greatly facilitates the instant comparison of gene expression patterns, as it allows distinctive visualization of different mRNA species in contrasting colors in the same sample specimen. This provides the possibility to relate gene expression domains topographically to each other with high accuracy and to define unique and overlapping expression sites. In the presented protocol, we describe a MC-WISH procedure for comparing mRNA expression patterns of different genes in Drosophila embryos. Up to three RNA probes, each specific for another gene and labeled by a different hapten, are simultaneously hybridized to the embryo samples and subsequently detected by alkaline phosphatase-based colorimetric immunohistochemistry. The described procedure is detailed here for Drosophila, but works equally well with zebrafish embryos.

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

We describe a multi-target chromogenic whole-mount in situ hybridization (MC-WISH) procedure in intact Drosophila embryos allowing simultaneous and specific detection of three different mRNA distribution patterns by contrasting color precipitates.

Multi-cible chromogénique totalité montage<em&gt; In Situ</em&gt; Hybridation pour la comparaison des gènes domaines d&#39;expression dans<em&gt; Drosophila</em&gt; Embryons

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

Dissection et immunofluorescence souillant de champignon corps et photorécepteur de neurones dans le cerveau adulte Drosophila melanogaster

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and optical transparency. In particular, the zebrafish embryo has become an important organism to study vertebrate kidney organogenesis as well as multiciliated cell (MCC) development. To visualize MCCs in the embryonic zebrafish kidney, we have developed a combined protocol of whole-mount fluorescent in situ hybridization (FISH) and whole mount immunofluorescence (IF) that enables high resolution imaging. This manuscript describes our technique for co-localizing RNA transcripts and protein as a tool to better understand the regulation of developmental programs through the expression of various lineage factors.

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

Cilia development is vital to proper organogenesis. This protocol describes an optimized method to label and visualize ciliated cells of the zebrafish.

Visualisation des cellules multiciliées dans le poisson-zèbre à travers un protocole combiné de toute monture Fluorescent In Situ hybridation et Immunofluorescence

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and ...

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain and protect cellular identities. The conversion of germ cells into specific neurons in the nematode Caenorhabditis elegans (C. elegans) is a powerful tool for performing genetic screens in order to dissect regulatory pathways that safeguard established cell identities. Reprogramming of germ cells to a specific type of neurons termed ASE requires transgenic animals that allow broad over-expression of the Zn-finger transcription factor (TF) CHE-1. Endogenous CHE-1 is expressed exclusively in two head neurons and is required to specify the glutamatergic ASE neurons fate, which can easily be visualized by the gcy-5prom::gfp reporter. A trans gene containing the heat-shock promoter-driven che-1 gene expression construct allows broad mis-expression of CHE-1 in the entire animal upon heat-shock treatment. The combination of RNAi against the chromatin-regulating factor LIN-53 and heat-shock-induced che-1 over-expression leads to reprogramming of germ cell into ASE neuron-like cells. We describe here the specific RNAi procedure and appropriate conditions for heat-shock treatment of transgenic animals in order to successfully induce germ cell to neuron conversion.

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

This protocol describes how to study cellular processes during cell fate conversion in Caenorhabditis elegans in vivo. Using transgenic animals, allowing heat-shock promoter-driven overexpression of the neuron fate-inducing transcription factor CHE-1 and RNAi-mediated depletion of the chromatin-regulating factor LIN-53 germ cell to neuron reprogramming can be observed in vivo.

Application de RNAi et Expression du facteur de Transcription induite par la chaleur-choc pour reprogrammer les cellules germinales de neurones chez c. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain ...

Wholemount In Situ Hybridization for Astyanax Embryos

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of genes. Prior research into this emerging model system capitalized on comprehensive genome-wide investigations that have identified numerous quantitative trait loci (QTL) associated with various cave-associated phenotypes. However, the ability to connect genes of interest to the heritable basis for phenotypic change remains a significant challenge. One technique that can facilitate deeper understanding of the role of development in troglomorphic evolution is whole-mount in situ hybridization. This technique can be implemented to directly compare gene expression between cave- and surface-dwelling forms, nominate candidate genes underlying established QTL, identify genes of interest from next-generation sequencing studies, or develop other discovery-based approaches. In this report, we present a simple protocol, supported by a flexible checklist, that can be widely adapted for use well beyond the presented study system. It is hoped that this protocol can serve as a broad resource for the Astyanax community and beyond.

Wholemount In Situ Hybridization for Astyanax Embryos

This protocol enables visualization of gene expression in embryonic Astyanax cavefish. This approach has been developed with the goal of maximizing gene expression signal, while minimizing non-specific background staining.

Wholemount, hybridation In Situ pour Astyanax embryons

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

Dans Vitro génération du Somite dérivés de Human induit Pluripotent Stem cellules

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Genotyping and Quantification of In Situ Hybridization Staining in Zebrafish

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in developmental biology for decades. Traditionally, most gene expression studies relied on visual evaluation of the ISH signal, a method that is prone to bias, particularly in cases where sample identities are known a priori. We have previously reported on a method to circumvent this bias and provide a more accurate quantification of ISH signals. Here, we present a simple guide to apply this method to quantify the expression levels of genes of interest in ISH-stained embryos and correlate that with their corresponding genotypes. The method is particularly useful to quantify spatially restricted gene expression signals in samples of mixed genotypes and it provides an unbiased and accurate alternative to the traditional visual scoring methods.

Gene editing technologies have enabled researchers to generate zebrafish mutants to investigate gene function with relative ease. Here, we provide a guide to perform parallel embryo genotyping and quantification of in situ hybridization signals in zebrafish. This unbiased approach provides greater accuracy in phenotypical analyses based on in situ hybridization.

Génotypage et quantification de l'hybridation in situ Taining in Zebrafish

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in ...

Whole-Mount In Situ Hybridization in Zebrafish Embryos and Tube Formation Assay in iPSC-ECs to Study the Role of Endoglin in Vascular Development

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in zebrafish during different developmental stages. To investigate the role of endoglin(eng) in vessel formation during the development of hereditary hemorrhagic telangiectasia&#160;(HHT), morpholino-mediated targeted knockdown of eng in zebrafish are used to study its temporal expression and associated functions. Here, whole-mount in situ RNA hybridization (WISH) is employed for the analysis of eng and its downstream genes in zebrafish embryos. Also, tube formation assays are performed in HHT patient-derived induced pluripotent stem cell-differentiated&#160;endothelial cells (iPSC-ECs; with eng mutations). A specific signal amplifying system using the whole amount In Situ Hybridization &#8211; WISH provides higher resolution and lower background results compared to traditional methods. To obtain a better signal, the post-fixation time is adjusted to 30 min after probe hybridization. Because fluorescence staining is not sensitive in zebrafish embryos, it is replaced with diaminobezidine (DAB) staining here. In this protocol, HHT&#160;patient-derived iPSC lines containing an eng mutation are differentiated into endothelial cells. After coating a plate with basement membrane matrix for 30 min at 37 &#176;C, iPSC-ECs are seeded as a monolayer into wells and kept at 37 &#176;C for 3 h. Then, the tube length and number of branches are calculated using microscopic images. Thus, with this improved WISH protocol, it is shown that reduced eng expression affects endothelial progenitor formation in zebrafish embryos. This is further confirmed by tube formation assays using iPSC-ECs derived from a patient with HHT. These assays confirm the role for eng in early vascular development.

Presented here is a protocol for whole-mount in situ RNA hybridization analysis in zebrafish and tube formation assay in patient-derived induced pluripotent stem cell-derived endothelial cells to study the role of endoglin in vascular formation.

Hybridation in situ à monture entière chez les embryons de poissons zèbres et l’essai de formation de tubes dans iPSC-ECs pour étudier le rôle de l’Endoglin dans le développement vasculaire

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in ...