Name: fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum
Uploaded: 2022-08-03T15:00:00
Description: Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Diese Arbeit wurde von AMED unter der Fördernummer JP22gm6110025 (an Y.N.) und von der JSPS KAKENHI Grant Number 22H02762 (an Y.N.) unterstützt.

HINWEIS: Details zu allen Materialien, Reagenzien und Geräten, die in diesem Protokoll verwendet werden, finden Sie in der Materialtabelle .
1. Sondensynthese
<ol><li>RNA-Extraktion<ol><li>Legen Sie drei lebende Cladonema-Medusen , die in künstlichem Meerwasser (ASW) kultiviert werden, in ein 1,5-ml-Röhrchen mit einer 3,1-ml-Transferpipette mit abgeschnittener Spitze und entfernen Sie so viel ASW wie möglich. HINWEIS: ASW wird hergestellt, in...

<ol>
	<li>Lecl&#232;re, L., R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+cnidarian+muscles:+Function,+anatomy,+development+and+regeneration.">Diversity of cnidarian muscles: Function, anatomy, development and regeneration.</a> Frontiers in Cell and Developmental Biology. 4, 157 (2017).</li><li>Bosch, T. C. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Back+to+the+basics:+Cnidarians+start+to+fire.">Back to the basics: Cnidarians start to fire.</a> Trends in Neurosciences. 40 (2), 92-105 (2017).</li><li>Gold, D. A., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+dynamics+in+Cnidaria:+Are+there+unifying+principles.">Stem cell dynamics in Cnidaria: Are there unifying principles.</a> Development Genes and Evolution. 223 (1-2), 53-66 (2013).</li><li>Technau, U., Steele, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+crossroads+in+developmental+biology:+Cnidaria.">Evolutionary crossroads in developmental biology: Cnidaria.</a> Development. 138 (8), 1447-1458 (2011).</li><li>Lecl&#232;re, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternally+localized+germ+plasm+mRNAs+and+germ+cell/stem+cell+formation+in+the+cnidarian+Clytia.">Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the cnidarian Clytia.</a> Developmental Biology. 364 (2), 236-248 (2012).</li><li>Bradshaw, B., Thompson, K., Frank, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+mechanisms+underlie+oral+vs+aboral+regeneration+in+the+cnidarian+Hydractinia+echinata.">Distinct mechanisms underlie oral vs aboral regeneration in the cnidarian Hydractinia echinata.</a> eLife. 4, 05506 (2015).</li><li>Sinigaglia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pattern+regulation+in+a+regenerating+jellyfish.">Pattern regulation in a regenerating jellyfish.</a> eLife. 9, 54868 (2020).</li><li>David, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interstitial+stem+cells+in+Hydra:+Multipotency+and+decision-making.">Interstitial stem cells in Hydra: Multipotency and decision-making.</a> The International Journal of Developmental Biology. 56 (6-7-8), 489-497 (2012).</li><li>R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nematostella+vectensis,+an+emerging+model+for+deciphering+the+molecular+and+cellular+mechanisms+underlying+whole-body+regeneration.">Nematostella vectensis, an emerging model for deciphering the molecular and cellular mechanisms underlying whole-body regeneration.</a> Cells. 10 (10), 2692 (2021).</li><li>Houliston, E., Momose, T., Manuel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clytia+hemisphaerica:+A+jellyfish+cousin+joins+the+laboratory.">Clytia hemisphaerica: A jellyfish cousin joins the laboratory.</a> Trends in Genetics. 26 (4), 159-167 (2010).</li><li>Peron, S., Houliston, E., Lecl&#232;re, L., Boutet, A., Shierwater, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Marine+Jellyfish+Model,+Clytia+hemisphaerica.">The Marine Jellyfish Model, Clytia hemisphaerica.</a> Handbook of Marine Model Organisms in Experimental Biology. , 129-147 (2021).</li><li>Denker, E., Manuel, M., Lecl&#232;re, L., Le Guyader, H., Rabet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ordered+progression+of+nematogenesis+from+stem+cells+through+differentiation+stages+in+the+tentacle+bulb+of+Clytia+hemisphaerica+(Hydrozoa,+Cnidaria).">Ordered progression of nematogenesis from stem cells through differentiation stages in the tentacle bulb of Clytia hemisphaerica (Hydrozoa, Cnidaria).</a> Developmental Biology. 315 (1), 99-113 (2008).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regeneration+potential+of+jellyfish:+Cellular+mechanisms+and+molecular+insights.">Regeneration potential of jellyfish: Cellular mechanisms and molecular insights.</a> Genes. 12 (5), 758 (2021).</li><li>Suga, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flexibly+deployed+Pax+genes+in+eye+development+at+the+early+evolution+of+animals+demonstrated+by+studies+on+a+hydrozoan+jellyfish.">Flexibly deployed Pax genes in eye development at the early evolution of animals demonstrated by studies on a hydrozoan jellyfish.</a> Proceedings of the National Academy of Sciences. 107 (32), 14263-14268 (2010).</li><li>Fujiki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Branching+pattern+and+morphogenesis+of+medusa+tentacles+in+the+jellyfish+Cladonema+pacificum+(Hydrozoa,+Cnidaria).">Branching pattern and morphogenesis of medusa tentacles in the jellyfish Cladonema pacificum (Hydrozoa, Cnidaria).</a> Zoological Letters. 5 (12), 13 (2019).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+controls+body+size+growth,+tentacle+morphogenesis,+and+regeneration+in+hydrozoan+jellyfish+Cladonema+pacificum.">Cell proliferation controls body size growth, tentacle morphogenesis, and regeneration in hydrozoan jellyfish Cladonema pacificum.</a> PeerJ. 7, 7579 (2019).</li><li>Hou, S., Zhu, J., Shibata, S., Nakamoto, A., Kumano, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repetitive+accumulation+of+interstitial+cells+generates+the+branched+structure+of+Cladonema+medusa+tentacles.">Repetitive accumulation of interstitial cells generates the branched structure of Cladonema medusa tentacles.</a> Development. 148 (23), (2021).</li><li>Salic, A., Mitchison, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+method+for+fast+and+sensitive+detection+of+DNA+synthesis+in+vivo.">A chemical method for fast and sensitive detection of DNA synthesis in vivo.</a> Proceedings of the National Academy of Sciences of the United States of America. 105 (7), 2415-2420 (2008).</li><li>Angerer, L. M., Angerer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+poly+A+++RNA+in+sea+urchin+eggs+and+embryos+by+quantitative+in+situ+hybridization.">Detection of poly A + RNA in sea urchin eggs and embryos by quantitative in situ hybridization.</a> Nucleic Acids Research. 9 (12), 2819-2840 (1981).</li><li>Rakotomamonjy, J., Guemez-Gamboa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purkinje+cell+survival+in+organotypic+cerebellar+slice+cultures.">Purkinje cell survival in organotypic cerebellar slice cultures.</a> Journal of Visualized Experiments. (154), e60353 (2019).</li><li>Tanaka, E. M., Reddien, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+basis+for+animal+regeneration.">The cellular basis for animal regeneration.</a> Developmental Cell. 21 (1), 172-185 (2011).</li><li>Penzo-M&#233;ndez, A. I., Stanger, B. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ-size+regulation+in+mammals.">Organ-size regulation in mammals.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), 019240 (2015).</li><li>Sinigaglia, C., Thiel, D., Hejnol, A., Houliston, E., Lecl&#232;re, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+safer,+urea-based+in+situ+hybridization+method+improves+detection+of+gene+expression+in+diverse+animal+species.">A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species.</a> Developmental Biology. 434 (1), 15-23 (2018).</li><li>King, R. S., Newmark, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+protocol+for+enhanced+detection+of+gene+expression+in+the+planarian+Schmidtea+mediterranea.">In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea.</a> BMC Developmental Biology. 13 (1), 8 (2013).</li><li>Flici, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+evolutionarily+conserved+SoxB-Hdac2+crosstalk+regulates+neurogenesis+in+a+cnidarian.">An evolutionarily conserved SoxB-Hdac2 crosstalk regulates neurogenesis in a cnidarian.</a> Cell Reports. 18 (6), 1395-1409 (2017).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axial+Hox+code+controls+tissue+segmentation+and+body+patterning+in+Nematostella+vectensis.">An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.</a> Science. 361 (6409), 1377-1380 (2018).</li><li>Govindasamy, N., Murthy, S., Ghanekar, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Slow-cycling+stem+cells+in+hydra+contribute+to+head+regeneration.">Slow-cycling stem cells in hydra contribute to head regeneration.</a> Biology Open. 3 (12), 1236-1244 (2014).</li><li>Passamaneck, Y. J., Martindale, M. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+is+necessary+for+the+regeneration+of+oral+structures+in+the+anthozoan+cnidarian+Nematostella+vectensis.">Cell proliferation is necessary for the regeneration of oral structures in the anthozoan cnidarian Nematostella vectensis.</a> BMC Developmental Biology. 12 (1), 34 (2012).</li><li>Gold, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+developmental+disparity+in+the+tentacles+of+the+moon+jellyfish+Aurelia+sp.1.">Structural and developmental disparity in the tentacles of the moon jellyfish Aurelia sp.1.</a> PLoS One. 10 (8), 0134741 (2015).</li><li>Gold, D. A., Nakanishi, N., Hensley, N. M., Hartenstein, V., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+tracking+supports+secondary+gastrulation+in+the+moon+jellyfish+Aurelia.">Cell tracking supports secondary gastrulation in the moon jellyfish Aurelia.</a> Development Genes and Evolution. 226 (6), 383-387 (2016).</li><li>Cheng, L. -. C., Alvarado, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-mount+BrdU+staining+with+fluorescence+in+situ+hybridization+in+planarians.">Whole-mount BrdU staining with fluorescence in situ hybridization in planarians.</a> Planarian Regeneration. 1774, 423-434 (2018).</li></ol>

Proliferierende Zellen und Stammzellen sind wichtige zelluläre Quellen in verschiedenen Prozessen wie Morphogenese, Wachstum und Regeneration21,22. Dieser Artikel beschreibt eine Methode zur Co-Färbung des Stammzellmarkers Nanos1 durch FISH- und EdU-Markierung in Cladonema medusae. Frühere Arbeiten mit EdU- oder BrdU-Markierung haben vorgeschlagen, dass proliferative Zellen in den Tentakelkolben16,17 lokalisieren,...

Cnidaria gilt als basal verzweigter Metazoenstamm, der Tiere mit Nerven und Muskeln enthält, was sie in eine einzigartige Position für das Verständnis der Evolution der Tierentwicklung und -physiologie versetzt 1,2. Nesseltiere werden in zwei Hauptgruppen eingeteilt: Anthozoen (z. B. Seeanemonen und Korallen) besitzen nur Planulalarven und sessilile Polypenstadien, während Medusozoa (Mitglieder von Hydrozoa, Staurozoa, Scyphozoa und Cubozoa) typischerweise die Form von frei schwimmenden Medusen oder Quallen sowie Planulalarven und Polypen annehmen. Nesseltiere weisen häufig eine hohe Regenerationsfähigkeit auf, und ihre zugrunde liegenden zellulären Mechanismen, insbesondere ihr Besitz von adulten Stammzellen und proliferativen Zellen, haben viel Aufmerksamkeit erregt 3,4. Ursprünglich in Hydra identifiziert, befinden sich hydrozoische Stammzellen in den interstitiellen Räumen zwischen ektodermalen Epithelzellen und werden allgemein als interstitielle Zellen oder i-Zellen bezeichnet3.
Hydrozoen-i-Zellen haben gemeinsame Merkmale, darunter Multipotenz, die Expression weit konservierter Stammzellmarker (z. B. Nanos, Piwi, Vasa) und Migrationspotenzial 3,5,6,7,8. Als funktionelle Stammzellen sind i-Zellen umfassend an der Entwicklung, Physiologie und Umweltreaktion von Hydrozoentieren beteiligt, was von ihrer hohen Regenerationsfähigkeit und Plastizität zeugt3. Während Stammzellen, ähnlich wie i-Zellen, außerhalb von Hydrozoen selbst bei der etablierten Modellart Nematostella nicht identifiziert wurden, sind proliferative Zellen immer noch an der Erhaltung und Regeneration von somatischem Gewebe sowie der Keimbahnbeteiligt 9. Da Studien zur Entwicklung und Regeneration von Nesseltieren überwiegend an polypartigen Tieren wie Hydra, Hydractinia und Nematostella durchgeführt wurden, bleiben die zelluläre Dynamik und Funktionen von Stammzellen in Quallenarten weitgehend unberücksichtigt.
Die Hydrozoenqualle Clytia hemisphaerica , eine kosmopolitische Quallenart mit verschiedenen Lebensräumen auf der ganzen Welt, einschließlich des Mittelmeers und Nordamerikas, wurde als experimentelles Modelltier in mehreren Entwicklungs- und Evolutionsstudien verwendet10. Mit seiner geringen Größe, einfachen Handhabung und großen Eiern eignet sich Clytia sowohl für die Laborpflege als auch für die Einführung genetischer Werkzeuge wie der kürzlich etablierten Transgenese- und Knockout-Methoden11, was die Möglichkeit einer detaillierten Analyse der zellulären und molekularen Mechanismen eröffnet, die der Quallenbiologie zugrunde liegen. Im Clytia medusa-Tentakel sind i-Zellen in der proximalen Region, der sogenannten Zwiebel, lokalisiert, und Vorläuferzellen wie Nematoblasten wandern zur distalen Spitze, während sie sich in verschiedene Zelltypen differenzieren, einschließlich Nematozyten12.
Während der Regeneration des Clytia manubrium, dem oralen Organ der Quallen, wandern Nanos1+ i-Zellen, die in den Gonaden vorhanden sind, in die Region, in der das Manubrium als Reaktion auf Schäden verloren geht, und nehmen an der Regeneration des Manubriums teil7. Diese Ergebnisse unterstützen die Idee, dass sich i-Zellen in Clytia auch als funktionelle Stammzellen verhalten, die an der Morphogenese und Regeneration beteiligt sind. Da sich die Eigenschaften von i-Zellen jedoch bei repräsentativen Tieren vom Polyp-Typ wie Hydra und Hydractinia3 unterscheiden, ist es möglich, dass die Eigenschaften und Funktionen von Stammzellen zwischen Quallenarten diversifiziert sind. Darüber hinaus waren mit Ausnahme von Clytia experimentelle Techniken für andere Quallen begrenzt, und die detaillierte Dynamik proliferativer Zellen und Stammzellen ist unbekannt13.
Die Hydrozoenqualle Cladonema pacificum ist ein aufstrebender Modellorganismus, der in einer Laborumgebung ohne Wasserpumpe oder Filtersystem gehalten werden kann. Die Cladonema medusa hat verzweigte Tentakel, ein häufiges Merkmal in der Cladonematidae-Familie, und ein Photorezeptororgan namens Ocellus auf der ektodermalen Schicht in der Nähe der Zwiebel14. Der Tentakelverzweigungsprozess findet an einer neuen Verzweigungsstelle statt, die entlang der adaxialen Seite des Tentakels erscheint. Im Laufe der Zeit verlängern sich die Tentakel weiter und verzweigen sich, wobei die älteren Zweige in Richtung der Spitze15 herausgeschoben werden. Darüber hinaus können sich Cladonema-Tentakel innerhalb weniger Tage nach Amputation regenerieren. Neuere Studien haben die Rolle von proliferierenden Zellen und stammähnlichen Zellen bei der Tentakelverzweigung und Regeneration bei Cladonema16,17 vorgeschlagen. Während jedoch die konventionelle In-situ-Hybridisierung (ISH) verwendet wurde, um die Genexpression in Cladonema sichtbar zu machen, ist es aufgrund ihrer geringen Auflösung derzeit schwierig, die Stammzelldynamik auf zellulärer Ebene im Detail zu beobachten.
Dieser Artikel beschreibt eine Methode zur Visualisierung stammartiger Zellen in Cladonema durch FISH und Co-Färbung mit EdU, einem Marker der Zellproliferation18. Wir visualisieren das Expressionsmuster von Nanos1, einem Stammzellmarker 5,17, mittels FISH, das die Identifizierung einer stammartigen Zellverteilung auf Einzelzellebene ermöglicht. Darüber hinaus ermöglicht die Co-Färbung der Nanos1-Expression mit EdU-Markierung, aktiv proliferierende stammartige Zellen zu unterscheiden. Diese Methode zur Überwachung sowohl stammähnlicher Zellen als auch proliferativer Zellen kann auf eine Vielzahl von Untersuchungsbereichen angewendet werden, einschließlich Tentakelverzweigung, Gewebehomöostase und Organregeneration bei Cladonema, und ein ähnlicher Ansatz kann auf andere Quallenarten angewendet werden.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-Mercaptoethanol&#160;</td>
			<td>Wako</td>
			<td>137-06862</td>
			<td></td>
		</tr>
		<tr>
			<td>3.1 mL transfer pipette</td>
			<td>Thermo Scientific</td>
			<td>233-20S</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-4-chloro-3-indolyl-&#946;-D-galactopyranoside (X-Gal)</td>
			<td>Wako</td>
			<td>029-15043</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-DIG-POD</td>
			<td>Roche</td>
			<td>11207733910</td>
			<td></td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-AAGAGACACAGTCATTATCAAGC 
			GA-3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-CGACGTGTCCAATTTTACGTGCT -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- AAAAGAGCAGCGGCCAGAAAGA 
			AGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- GCGGGTCGCATACTTGTTGGTA 
			CTGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye</td>
			<td>Invitrogen&#160;</td>
			<td>C10337</td>
			<td>EdU kit</td>
		</tr>
		<tr>
			<td>Coroline off</td>
			<td>GEX Co. ltd</td>
			<td>N/A</td>
			<td>chlorine neutralizer</td>
		</tr>
		<tr>
			<td>DIG Nucleic Acid Detection Kit Blocking Reagent</td>
			<td>Roche</td>
			<td>11175041910</td>
			<td>blocking buffer&#160;</td>
		</tr>
		<tr>
			<td>DIG RNA labeling mix&#160;</td>
			<td>Roche</td>
			<td>11277073910</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>Promega</td>
			<td>P117B</td>
			<td></td>
		</tr>
		<tr>
			<td>ECOS competent cell DH5&#945;</td>
			<td>NIPPON GENE</td>
			<td>316-06233</td>
			<td>competent cell</td>
		</tr>
		<tr>
			<td>Fast gene Gel/PCR Extraction kit</td>
			<td>Fast gene</td>
			<td>FG-91302</td>
			<td>gel extraction kit</td>
		</tr>
		<tr>
			<td>Fast gene plasmid mini kit</td>
			<td>Fast gene</td>
			<td>FG-90502</td>
			<td>plasmid miniprep</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Wako&#160;</td>
			<td>068-00426</td>
			<td></td>
		</tr>
		<tr>
			<td>Heparin sodium salt from porcine</td>
			<td>SIGMA-ALDRICH&#160;</td>
			<td>H3393-10KU</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl-&#946;-D(-)-thiogalactopyranoside (IPTG)</td>
			<td>Wako</td>
			<td>096-05143</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar</td>
			<td>Invitrogen</td>
			<td>22700-025</td>
			<td>agar plate</td>
		</tr>
		<tr>
			<td>LB Broth Base</td>
			<td>Invitrogen</td>
			<td>12780-052</td>
			<td>LB medium</td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Wako</td>
			<td>134-00495</td>
			<td></td>
		</tr>
		<tr>
			<td>mini Quick spin RNA columns</td>
			<td>Roche</td>
			<td>11814427001</td>
			<td>clean-up column</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Wako&#160;</td>
			<td>191-01665</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop OneC Microvolume UV-Vis Spectrophotometer with Wi-Fi</td>
			<td>Thermo Scientific</td>
			<td>ND-ONEC-W</td>
			<td>spectrophotometer</td>
		</tr>
		<tr>
			<td>Polyoxyethlene (20) Sorbitan Monolaurate (Tween-20)</td>
			<td>Wako&#160;</td>
			<td>166-21115</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerMasher 2</td>
			<td>nippi&#160;</td>
			<td>891300</td>
			<td>homogenizer</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Nacarai Tesque&#160;</td>
			<td>29442-14</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor</td>
			<td>TaKaRa</td>
			<td>2313A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen&#160;</td>
			<td>74004</td>
			<td>total RNA isolation kit</td>
		</tr>
		<tr>
			<td>RQ1 RNase-Free Dnase</td>
			<td>Promega</td>
			<td>M6101</td>
			<td></td>
		</tr>
		<tr>
			<td>Saline Sodium Citrate Buffer 20x powder (20x SSC)</td>
			<td>TaKaRa</td>
			<td>T9172</td>
			<td></td>
		</tr>
		<tr>
			<td>SEA LIFE</td>
			<td>Marin Tech</td>
			<td>N/A</td>
			<td>mixture of mineral salts</td>
		</tr>
		<tr>
			<td>T3 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>11031163001</td>
			<td></td>
		</tr>
		<tr>
			<td>T7 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>10881767001</td>
			<td></td>
		</tr>
		<tr>
			<td>TAITEC HB-100</td>
			<td>TAITEC</td>
			<td>0040534-000</td>
			<td>Hybridization incuvator</td>
		</tr>
		<tr>
			<td>TaKaRa Ex Taq&#160;</td>
			<td>TaKaRa</td>
			<td>RR001A</td>
			<td>Taq DNA polymerase</td>
		</tr>
		<tr>
			<td>TaKaRa PrimeScript 2 1st strand cDNA Synthesis Kit</td>
			<td>TaKaRa</td>
			<td>6210A</td>
			<td>cDNA synthesis kit</td>
		</tr>
		<tr>
			<td>Target Clone</td>
			<td>TOYOBO&#160;</td>
			<td>TAK101</td>
			<td>pTA2 Vector</td>
		</tr>
		<tr>
			<td>tRNA</td>
			<td>Roche</td>
			<td>10109541001</td>
			<td></td>
		</tr>
		<tr>
			<td>TSA Plus Cyanine 5</td>
			<td>AKOYA Biosciences</td>
			<td>NEL745001KT</td>
			<td>tyramide signal amplification (TSA) technique</td>
		</tr>
		<tr>
			<td>Zeiss LSM 880</td>
			<td>ZEISS</td>
			<td>N/A</td>
			<td>laser scanning confocal microscope</td>
		</tr>
	</tbody>
</table>

fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum

Nesseltiere, einschließlich Seeanemonen, Korallen und Quallen, zeigen vielfältige Morphologie und Lebensstile, die sich in sitzenden Polypen und frei schwimmenden Medusen manifestieren. Wie etablierte Modelle wie Hydra und Nematostella zeigen, tragen Stammzellen und/oder proliferative Zellen zur Entwicklung und Regeneration von Nesseltierpolypen bei. Die zugrunde liegenden zellulären Mechanismen in den meisten Quallen, insbesondere im Medusa-Stadium, sind jedoch weitgehend unklar, und daher ist die Entwicklung einer robusten Methode zur Identifizierung spezifischer Zelltypen von entscheidender Bedeutung. Dieser Artikel beschreibt ein Protokoll zur Visualisierung stammartig proliferierender Zellen in der Hydrozoenqualle Cladonema pacificum. Cladonema medusae besitzen verzweigte Tentakel, die während ihres gesamten Erwachsenenstadiums kontinuierlich wachsen und die Regenerationsfähigkeit aufrechterhalten und eine einzigartige Plattform bieten, um die zellulären Mechanismen zu untersuchen, die von proliferierenden und / oder stammartigen Zellen orchestriert werden. Die Whole-mount-Fluoreszenz-in-situ-Hybridisierung (FISH) unter Verwendung eines Stammzellmarkers ermöglicht den Nachweis stammähnlicher Zellen, während die Pulsmarkierung mit 5-Ethynyl-2'-Desoxyuridin (EdU), einem S-Phasenmarker, die Identifizierung proliferierender Zellen ermöglicht. Durch die Kombination von FISH- und EdU-Markierung können wir aktiv proliferierende stammartige Zellen an festen Tieren nachweisen, und diese Technik kann breit auf andere Tiere angewendet werden, einschließlich Nicht-Modell-Quallenarten.

Cladonema-Tentakel wurden als Modell verwendet, um die zellulären Prozesse der Morphogenese und Regeneration zu untersuchen15,16,17. Die Tentakelstruktur besteht aus einer Epithelröhre, in der sich stammartige Zellen oder i-Zellen im proximalen Bereich befinden, der als Tentakelkolben bezeichnet wird, und neue Zweige werden sequentiell an der Rückseite der distalen Region der Birne entlang der adaxialen Seite hinzuge...

Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Hier beschreiben wir ein Protokoll zur Visualisierung stammartig wuchernder Zellen in der Qualle Cladonema. Die Whole-mount-Fluoreszenz-in-situ-Hybridisierung mit einem Stammzellmarker ermöglicht den Nachweis stammähnlicher Zellen, und die 5-Ethynyl-2'-Desoxyuridin-Markierung ermöglicht die Identifizierung proliferierender Zellen. Zusammen können aktiv wuchernde stammartige Zellen nachgewiesen werden.

Fluoreszierende In situ Hybridisierung und 5-Ethynyl-2'-Desoxyuridin-Markierung für stammähnliche Zellen in der Hydrozoenqualle Cladonema pacificum

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and ...

Die Co-Färbung der Nanos1-Expression mit der EdU-Markierung ermöglicht es, aktiv proliferierende stammartige Zellen zu unterscheiden. Wir können die stammartige Zellverteilung auf Einzelzellebene in der Qualle Cladonema identifizieren. Wir können stammähnliche Zellen und proliferierende Zellen in derselben Quallenprobe visualisieren, was den Nachweis von proliferierenden und nicht proliferierenden stammartigen Zellen ermöglicht, was zum Verständnis der Stammzellheterogenität führt.Entwicklungsbiologie und Regenerationsstudien mit Tiermodellen, die Stammzellen enthalten. Die Hydrozoenqualle Cladonema pacificum ist ein aufstrebender Modellorganismus, der in einer Laborumgebung ohne spezialisiertes System gehalten werden kann. Cladonema medusae haben verzweigte Tentakel.Die Verzweigung erfolgt an einer neuen Stelle entlang der adaxialen Seite des Tentakels. Im Laufe der Zeit verlängern sich die Tentakel weiter und verzweigen sich, wobei ältere Äste zur Spitze herausgeschoben werden. Die Tentakel können sich auch innerhalb weniger Tage nach der Amputation regenerieren.Die geringe Größe, die einfache Handhabung und das Vorhandensein von adulten Stammzellen oder stammähnlichen Zellen machen Cladonema zu einem guten System, um die Rolle von Stammzellen in verschiedenen Prozessen zu untersuchen. Legen Sie zunächst Cladonema medusae mit einer 3,5-Milliliter-Transferpipette in 1,5-Milliliter-Röhrchen und fügen Sie ASW zu einem Gesamtvolumen von 500 Mikrolitern hinzu. Fügen Sie 7,5 Mikroliter 10 Millimolar EdU-Stammlösung hinzu und inkubieren Sie die Proben für eine Stunde bei 22 Grad Celsius.Warten Sie eine Stunde und entfernen Sie so viel ASW mit EdU wie möglich. Nach der Betäubung der Medusen fünf Minuten inkubieren. Die Medusen über Nacht bei vier Grad Celsius mit 4% Paraformaldehyd in ASW fixieren.Für die Proteinasebehandlung und Postfixierung entfernen Sie das Paraformaldehyd und waschen Sie die Proben mit PBS, das 0,1% Tween 20 enthält, dreimal für jeweils 10 Minuten. Entfernen Sie das PBST und fügen Sie den Hybridisierungspuffer hinzu. Inkubieren Sie die Proben im Hybridisierungspuffer für 15 Minuten bei Raumtemperatur.Entfernen Sie den Hybridisierungspuffer und fügen Sie den neuen Hybridisierungspuffer hinzu. Vorhybridisieren Sie bei 55 Grad Celsius für mindestens zwei Stunden in einem Hybridisierungsinkubator. Entfernen Sie den Hybridisierungspuffer und inkubieren Sie mit dem Hybridisierungspuffer, der die Sonden enthält.Hybridisieren Sie bei 55 Grad Celsius für 18 bis 24 Stunden in einem Hybridisierungsinkubator. Fahren Sie als Nächstes mit dem Entfernen der Sonde fort. Beginnen Sie mit dem Entfernen des Hybridisierungspuffers, der Sonden enthält, und fügen Sie dann einen Waschpuffer hinzu.Waschen Sie die Proben zweimal mit Waschpuffer für 15 Minuten bei 55 Grad Celsius. Waschpuffer eins entfernen und Waschpuffer zwei hinzufügen. Waschen Sie die Proben mit Waschpuffer zweimal für 15 Minuten bei 55 Grad Celsius.Waschpuffer zwei entfernen und dann 2X SSC hinzufügen. Waschen Sie die Proben zweimal mit 2X SSC für 15 Minuten bei 55 Grad Celsius. Entfernen Sie 2X SSC und fügen Sie dann vorgewärmtes PBST hinzu.Waschen Sie die Proben 15 Minuten lang mit PBST bei Raumtemperatur. Für die Inkubation von Anti-DIG-Antikörpern entfernen Sie zunächst PBST und fügen Sie dann 1% blockierenden Puffer hinzu. Inkubieren Sie die Proben für mindestens eine Stunde bei Raumtemperatur, während Sie langsam auf einer Wippe schütteln.Entfernen Sie nach dem Blockieren den 1%-Blockierpuffer. Fügen Sie Anti-DIG-POD-Lösung hinzu und inkubieren Sie die Proben über Nacht bei vier Grad Celsius. Um die DIG-markierte Sonde zu erkennen, entfernen Sie die Anti-DIG-POD-Lösung und fügen Sie Tris-Natriumchlorid-Tween-Puffer hinzu.Waschen Sie die Proben dreimal für 10 Minuten bei Raumtemperatur mit Tris-Natriumchlorid-Tween-Puffer. Verdünnte fluoreszierende Farbstoff-konjugierte Tyramid-Stammlösung im Amplifikationsverdünnungspuffer, um die aktive Cy5-Tyramidlösung herzustellen. Entfernen Sie so viel Tris-Natriumchlorid-Tween-Puffer wie möglich und fügen Sie dann die aktive Cy5-Tyramidlösung hinzu.Inkubieren Sie die Proben für 10 Minuten im Dunkeln. Waschen Sie die Proben dreimal mit PBST für 10 Minuten im Dunkeln. Um den EdU-Detektionscocktail vorzubereiten, mischen Sie die Komponenten.Entfernen Sie PBST und fügen Sie dann den EdU-Erkennungscocktail hinzu. Inkubieren Sie die Probe 30 Minuten lang im Dunkeln. Mit PBST dreimal für 10 Minuten im Dunkeln waschen.Für die DNA-Färbung Hoechst in PBST verdünnen, um die Hoechst-Lösung herzustellen. Entfernen Sie die PBST-Lösung, und fügen Sie dann die Hoechst-Lösung hinzu. Inkubieren Sie die Proben für 30 Minuten im Dunkeln.Waschen Sie die Proben drei- bis viermal mit PBST für 10 Minuten im Dunkeln. Als nächstes für die Montage die Medusen mit einer Transferpipette mit abgeschnittener Spitze auf die Bank auf dem Diaglas übertragen. Legen Sie vorsichtig ein Deckglas mit einer Pinzette auf die Medusen und verschließen Sie die Seite des Deckglases mit klarem Nagellack.Die Co-Markierung von Nanos1-Expression und EdU-positiven Zellen zeigte das räumliche Muster von stammartigen Zellen und proliferativen Zellen im Tentakel. EdU-positive Zellen waren weiter über den Tentakelkolben verteilt, während Nanos1-positive Zellen, die sich lokaler an der Tentakelbirne und der neuen Verzweigungsstelle ansammelten, darauf hindeuten, dass unterschiedliche Verteilungen von stammartigen Zellen und proliferierenden Zellen je nach Entwicklungszeitpunkt und verschiedenen Stadien nachgewiesen werden. Die Co-Markierung von EdU und Nanos1 wurde in 19,79% der Zellen beobachtet, was darauf hindeutet, dass diese Zellen eine aktiv proliferierende Stammzellpopulation sind.Interessanterweise wurden 14,46% der Zellen in der Mitte der Birne und an der neuen Verzweigungsstelle als EdU-positive Nanos1-negative Zellen gefunden, was auf das Vorhandensein von nicht-stammartigen proliferativen Zellen hindeutet. Im Gegensatz dazu wurde beobachtet, dass 26,32% der Zellen an der Basis der Birne und an der neuen Verzweigungsstelle EdU-negativ Nanos1-positiv waren, was auf das Vorhandensein einer Stammzellpopulation hinweist, die entweder langsam zyklisch oder ruhend ist, von denen keine durch EdU-Pulsmarkierung erkannt wird. Die EdU-Pulsmarkierung mit kurzer Inkubationszeit ermöglicht den Nachweis nur proliferativer Zellen zwischen stammähnlichen Zellen und nicht-stammähnlichen Zellen.Wenn man die Inkubationszeit für EdU ändert und Langzeitjagdexperimente kombiniert, können langsam zyklische Stammzellen oder andere Zelltypen einschließlich Nachkommen und differenzierte Zellen markiert werden.

fluorescent-situ-hybridization-5-ethynyl-2-deoxyuridine-labeling-for

Research

JoVE Journal

Developmental Biology

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development. The Xenopuslaevis embryo is very useful for studying organogenesis because their large size makes them very suitable for identifying organs at the earliest steps in organogenesis. At this time, the primary method used for identifying a specific organ or primordium is whole mount in situ hybridization with labeled antisense RNA probes specific to a gene that is expressed in the organ of interest. In addition, it is relatively easy to manipulate genes or signaling pathways in Xenopus and in situ hybridization allows one to then assay for changes in the presence or morphology of a target organ. Whole mount in situ hybridization is a multi-day protocol with many steps involved. Here we provide a simplified protocol with reduced numbers of steps and reagents used that works well for routine assays. In situ hybridization robots have greatly facilitated the process and we detail how and when we utilize that technology in the process. Once an in situ hybridization is complete, capturing the best image of the result can be frustrating. We provide advice on how to optimize imaging of in situ hybridization results. Although the protocol describes assessing organogenesis in Xenopus laevis, the same basic protocol can almost certainly be adapted to Xenopus tropicalis and other model systems.

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

The Xenopus laevis embryo continues to be exceptionally useful in the study of early development due to its large size and ease of manipulation. A simplified protocol for whole mount in situ hybridization protocol is provided that can be used in the identification of specific organs in this model system.

Das Verständnis frühen Organogenese das vereinfachte<em&gt; In-situ-</em&gt; Hybridisierung Protokoll<em&gt; Xenopus</em

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development.  The Xenopuslaevis embryo ...

Forschung

Entwicklungsbiologie

Application of the DNA-Specific Stain Methyl Green in the Fluorescent Labeling of Embryos

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored until recently. In this article, we illustrate the method for preparing a methyl green aqueous stock solution, that when diluted can be used as a very convenient fluorescent nuclear label for fixed cells and tissues. Easy procedures to label whole zebrafish and chick embryos are detailed, and examples of images obtained shown. Methyl green is maximally excited by red light, at 633 nm, and emits with a relatively sharp spectrum that peaks at 677 nm. It is very inexpensive, non-toxic, highly stable in solution and very resistant to photobleaching when bound to DNA. Its red emission allows for unaltered high resolution scanning confocal imaging of nuclei in thick specimens. Finally, this methyl green staining protocol is compatible with other cell staining procedures, such as antibody labeling, or actin filaments labeling with fluorophore-conjugated phalloidin.

A method for fluorescent staining of fixed biological material with the specific DNA label methyl green is described. Methyl green is used in a diluted aqueous solution and is very resistant to photobleaching. Its far-red emission allows for deep specimen imaging, making it particularly adequate for whole embryos.

Anwendung der DNA-spezifisches Färbemittel, Methyl Green in der Fluoreszenzmarkierung von Embryos

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored ...

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are expressed in spatial relation to each other in situ. Multi-target chromogenic whole-mount in situ hybridization (MC-WISH) greatly facilitates the instant comparison of gene expression patterns, as it allows distinctive visualization of different mRNA species in contrasting colors in the same sample specimen. This provides the possibility to relate gene expression domains topographically to each other with high accuracy and to define unique and overlapping expression sites. In the presented protocol, we describe a MC-WISH procedure for comparing mRNA expression patterns of different genes in Drosophila embryos. Up to three RNA probes, each specific for another gene and labeled by a different hapten, are simultaneously hybridized to the embryo samples and subsequently detected by alkaline phosphatase-based colorimetric immunohistochemistry. The described procedure is detailed here for Drosophila, but works equally well with zebrafish embryos.

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

We describe a multi-target chromogenic whole-mount in situ hybridization (MC-WISH) procedure in intact Drosophila embryos allowing simultaneous and specific detection of three different mRNA distribution patterns by contrasting color precipitates.

Multi-Target-Chromogenic Whole-mount<em&gt; In-situ-</em&gt; Hybridisierung zum Vergleich Genexpression Domains in<em&gt; Drosophila</em&gt; Embryos

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

Dissektion, Immunofluorescent Färbung der Pilz Körper und Photorezeptor Neuronen im Gehirn Erwachsener Taufliege melanogaster

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and optical transparency. In particular, the zebrafish embryo has become an important organism to study vertebrate kidney organogenesis as well as multiciliated cell (MCC) development. To visualize MCCs in the embryonic zebrafish kidney, we have developed a combined protocol of whole-mount fluorescent in situ hybridization (FISH) and whole mount immunofluorescence (IF) that enables high resolution imaging. This manuscript describes our technique for co-localizing RNA transcripts and protein as a tool to better understand the regulation of developmental programs through the expression of various lineage factors.

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

Cilia development is vital to proper organogenesis. This protocol describes an optimized method to label and visualize ciliated cells of the zebrafish.

Visualisierung von Multiciliated Zellen in der Zebrabärbling durch ein kombiniertes Protokoll der ganze Berg Leuchtstofflampen In Situ Hybridisierung und Immunfluoreszenz

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and ...

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain and protect cellular identities. The conversion of germ cells into specific neurons in the nematode Caenorhabditis elegans (C. elegans) is a powerful tool for performing genetic screens in order to dissect regulatory pathways that safeguard established cell identities. Reprogramming of germ cells to a specific type of neurons termed ASE requires transgenic animals that allow broad over-expression of the Zn-finger transcription factor (TF) CHE-1. Endogenous CHE-1 is expressed exclusively in two head neurons and is required to specify the glutamatergic ASE neurons fate, which can easily be visualized by the gcy-5prom::gfp reporter. A trans gene containing the heat-shock promoter-driven che-1 gene expression construct allows broad mis-expression of CHE-1 in the entire animal upon heat-shock treatment. The combination of RNAi against the chromatin-regulating factor LIN-53 and heat-shock-induced che-1 over-expression leads to reprogramming of germ cell into ASE neuron-like cells. We describe here the specific RNAi procedure and appropriate conditions for heat-shock treatment of transgenic animals in order to successfully induce germ cell to neuron conversion.

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

This protocol describes how to study cellular processes during cell fate conversion in Caenorhabditis elegans in vivo. Using transgenic animals, allowing heat-shock promoter-driven overexpression of the neuron fate-inducing transcription factor CHE-1 and RNAi-mediated depletion of the chromatin-regulating factor LIN-53 germ cell to neuron reprogramming can be observed in vivo.

Anwendung von RNAi und Hitze-Schock-induzierte Transkription Faktor Ausdruck zu programmieren Keimzellen Neuronen in C. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain ...

Wholemount In Situ Hybridization for Astyanax Embryos

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of genes. Prior research into this emerging model system capitalized on comprehensive genome-wide investigations that have identified numerous quantitative trait loci (QTL) associated with various cave-associated phenotypes. However, the ability to connect genes of interest to the heritable basis for phenotypic change remains a significant challenge. One technique that can facilitate deeper understanding of the role of development in troglomorphic evolution is whole-mount in situ hybridization. This technique can be implemented to directly compare gene expression between cave- and surface-dwelling forms, nominate candidate genes underlying established QTL, identify genes of interest from next-generation sequencing studies, or develop other discovery-based approaches. In this report, we present a simple protocol, supported by a flexible checklist, that can be widely adapted for use well beyond the presented study system. It is hoped that this protocol can serve as a broad resource for the Astyanax community and beyond.

Wholemount In Situ Hybridization for Astyanax Embryos

This protocol enables visualization of gene expression in embryonic Astyanax cavefish. This approach has been developed with the goal of maximizing gene expression signal, while minimizing non-specific background staining.

Wholemount In Situ Hybridisierung für Astyanax Embryonen

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

In vitro-Generation der Somiten Derivate aus menschlichen induzierten Zellen pluripotenten Stammzellen

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Genotyping and Quantification of In Situ Hybridization Staining in Zebrafish

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in developmental biology for decades. Traditionally, most gene expression studies relied on visual evaluation of the ISH signal, a method that is prone to bias, particularly in cases where sample identities are known a priori. We have previously reported on a method to circumvent this bias and provide a more accurate quantification of ISH signals. Here, we present a simple guide to apply this method to quantify the expression levels of genes of interest in ISH-stained embryos and correlate that with their corresponding genotypes. The method is particularly useful to quantify spatially restricted gene expression signals in samples of mixed genotypes and it provides an unbiased and accurate alternative to the traditional visual scoring methods.

Gene editing technologies have enabled researchers to generate zebrafish mutants to investigate gene function with relative ease. Here, we provide a guide to perform parallel embryo genotyping and quantification of in situ hybridization signals in zebrafish. This unbiased approach provides greater accuracy in phenotypical analyses based on in situ hybridization.

Genotypisierung und Quantifizierung der In-Situ-Hybridisierungsfärbung in Zebrafischen

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in ...

Whole-Mount In Situ Hybridization in Zebrafish Embryos and Tube Formation Assay in iPSC-ECs to Study the Role of Endoglin in Vascular Development

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in zebrafish during different developmental stages. To investigate the role of endoglin(eng) in vessel formation during the development of hereditary hemorrhagic telangiectasia&#160;(HHT), morpholino-mediated targeted knockdown of eng in zebrafish are used to study its temporal expression and associated functions. Here, whole-mount in situ RNA hybridization (WISH) is employed for the analysis of eng and its downstream genes in zebrafish embryos. Also, tube formation assays are performed in HHT patient-derived induced pluripotent stem cell-differentiated&#160;endothelial cells (iPSC-ECs; with eng mutations). A specific signal amplifying system using the whole amount In Situ Hybridization &#8211; WISH provides higher resolution and lower background results compared to traditional methods. To obtain a better signal, the post-fixation time is adjusted to 30 min after probe hybridization. Because fluorescence staining is not sensitive in zebrafish embryos, it is replaced with diaminobezidine (DAB) staining here. In this protocol, HHT&#160;patient-derived iPSC lines containing an eng mutation are differentiated into endothelial cells. After coating a plate with basement membrane matrix for 30 min at 37 &#176;C, iPSC-ECs are seeded as a monolayer into wells and kept at 37 &#176;C for 3 h. Then, the tube length and number of branches are calculated using microscopic images. Thus, with this improved WISH protocol, it is shown that reduced eng expression affects endothelial progenitor formation in zebrafish embryos. This is further confirmed by tube formation assays using iPSC-ECs derived from a patient with HHT. These assays confirm the role for eng in early vascular development.

Presented here is a protocol for whole-mount in situ RNA hybridization analysis in zebrafish and tube formation assay in patient-derived induced pluripotent stem cell-derived endothelial cells to study the role of endoglin in vascular formation.

Ganz-Mount-In-Situ-Hybridisierung in Zebrafisch-Embryonen und Tube-Formations-Assay in iPSC-ECs zur Untersuchung der Rolle von Endoglin in der Gefäßentwicklung

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in ...