Name: fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum
Uploaded: 2022-08-03T15:00:00
Description: Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

עבודה זו נתמכה על ידי AMED תחת מענק מספר JP22gm6110025 (ל- Y.N.) ועל ידי מענק JSPS KAKENHI מספר 22H02762 (ל- Y.N.).

הערה: עיין בטבלת החומרים לקבלת פרטים הקשורים לכל החומרים, הריאגנטים והציוד המשמשים בפרוטוקול זה.
1. סינתזת בדיקה
<ol><li>מיצוי RNA<ol><li>הניחו שלוש מדוזות Cladonema חיות שגודלו במי ים מלאכותיים (ASW) בצינור של 1.5 מ"ל באמצעות פיפטה של 3.1 מ"ל עם קצה מנותק, והסירו כמה שי...

<ol>
	<li>Lecl&#232;re, L., R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+cnidarian+muscles:+Function,+anatomy,+development+and+regeneration.">Diversity of cnidarian muscles: Function, anatomy, development and regeneration.</a> Frontiers in Cell and Developmental Biology. 4, 157 (2017).</li><li>Bosch, T. C. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Back+to+the+basics:+Cnidarians+start+to+fire.">Back to the basics: Cnidarians start to fire.</a> Trends in Neurosciences. 40 (2), 92-105 (2017).</li><li>Gold, D. A., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+dynamics+in+Cnidaria:+Are+there+unifying+principles.">Stem cell dynamics in Cnidaria: Are there unifying principles.</a> Development Genes and Evolution. 223 (1-2), 53-66 (2013).</li><li>Technau, U., Steele, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+crossroads+in+developmental+biology:+Cnidaria.">Evolutionary crossroads in developmental biology: Cnidaria.</a> Development. 138 (8), 1447-1458 (2011).</li><li>Lecl&#232;re, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternally+localized+germ+plasm+mRNAs+and+germ+cell/stem+cell+formation+in+the+cnidarian+Clytia.">Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the cnidarian Clytia.</a> Developmental Biology. 364 (2), 236-248 (2012).</li><li>Bradshaw, B., Thompson, K., Frank, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+mechanisms+underlie+oral+vs+aboral+regeneration+in+the+cnidarian+Hydractinia+echinata.">Distinct mechanisms underlie oral vs aboral regeneration in the cnidarian Hydractinia echinata.</a> eLife. 4, 05506 (2015).</li><li>Sinigaglia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pattern+regulation+in+a+regenerating+jellyfish.">Pattern regulation in a regenerating jellyfish.</a> eLife. 9, 54868 (2020).</li><li>David, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interstitial+stem+cells+in+Hydra:+Multipotency+and+decision-making.">Interstitial stem cells in Hydra: Multipotency and decision-making.</a> The International Journal of Developmental Biology. 56 (6-7-8), 489-497 (2012).</li><li>R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nematostella+vectensis,+an+emerging+model+for+deciphering+the+molecular+and+cellular+mechanisms+underlying+whole-body+regeneration.">Nematostella vectensis, an emerging model for deciphering the molecular and cellular mechanisms underlying whole-body regeneration.</a> Cells. 10 (10), 2692 (2021).</li><li>Houliston, E., Momose, T., Manuel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clytia+hemisphaerica:+A+jellyfish+cousin+joins+the+laboratory.">Clytia hemisphaerica: A jellyfish cousin joins the laboratory.</a> Trends in Genetics. 26 (4), 159-167 (2010).</li><li>Peron, S., Houliston, E., Lecl&#232;re, L., Boutet, A., Shierwater, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Marine+Jellyfish+Model,+Clytia+hemisphaerica.">The Marine Jellyfish Model, Clytia hemisphaerica.</a> Handbook of Marine Model Organisms in Experimental Biology. , 129-147 (2021).</li><li>Denker, E., Manuel, M., Lecl&#232;re, L., Le Guyader, H., Rabet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ordered+progression+of+nematogenesis+from+stem+cells+through+differentiation+stages+in+the+tentacle+bulb+of+Clytia+hemisphaerica+(Hydrozoa,+Cnidaria).">Ordered progression of nematogenesis from stem cells through differentiation stages in the tentacle bulb of Clytia hemisphaerica (Hydrozoa, Cnidaria).</a> Developmental Biology. 315 (1), 99-113 (2008).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regeneration+potential+of+jellyfish:+Cellular+mechanisms+and+molecular+insights.">Regeneration potential of jellyfish: Cellular mechanisms and molecular insights.</a> Genes. 12 (5), 758 (2021).</li><li>Suga, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flexibly+deployed+Pax+genes+in+eye+development+at+the+early+evolution+of+animals+demonstrated+by+studies+on+a+hydrozoan+jellyfish.">Flexibly deployed Pax genes in eye development at the early evolution of animals demonstrated by studies on a hydrozoan jellyfish.</a> Proceedings of the National Academy of Sciences. 107 (32), 14263-14268 (2010).</li><li>Fujiki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Branching+pattern+and+morphogenesis+of+medusa+tentacles+in+the+jellyfish+Cladonema+pacificum+(Hydrozoa,+Cnidaria).">Branching pattern and morphogenesis of medusa tentacles in the jellyfish Cladonema pacificum (Hydrozoa, Cnidaria).</a> Zoological Letters. 5 (12), 13 (2019).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+controls+body+size+growth,+tentacle+morphogenesis,+and+regeneration+in+hydrozoan+jellyfish+Cladonema+pacificum.">Cell proliferation controls body size growth, tentacle morphogenesis, and regeneration in hydrozoan jellyfish Cladonema pacificum.</a> PeerJ. 7, 7579 (2019).</li><li>Hou, S., Zhu, J., Shibata, S., Nakamoto, A., Kumano, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repetitive+accumulation+of+interstitial+cells+generates+the+branched+structure+of+Cladonema+medusa+tentacles.">Repetitive accumulation of interstitial cells generates the branched structure of Cladonema medusa tentacles.</a> Development. 148 (23), (2021).</li><li>Salic, A., Mitchison, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+method+for+fast+and+sensitive+detection+of+DNA+synthesis+in+vivo.">A chemical method for fast and sensitive detection of DNA synthesis in vivo.</a> Proceedings of the National Academy of Sciences of the United States of America. 105 (7), 2415-2420 (2008).</li><li>Angerer, L. M., Angerer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+poly+A+++RNA+in+sea+urchin+eggs+and+embryos+by+quantitative+in+situ+hybridization.">Detection of poly A + RNA in sea urchin eggs and embryos by quantitative in situ hybridization.</a> Nucleic Acids Research. 9 (12), 2819-2840 (1981).</li><li>Rakotomamonjy, J., Guemez-Gamboa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purkinje+cell+survival+in+organotypic+cerebellar+slice+cultures.">Purkinje cell survival in organotypic cerebellar slice cultures.</a> Journal of Visualized Experiments. (154), e60353 (2019).</li><li>Tanaka, E. M., Reddien, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+basis+for+animal+regeneration.">The cellular basis for animal regeneration.</a> Developmental Cell. 21 (1), 172-185 (2011).</li><li>Penzo-M&#233;ndez, A. I., Stanger, B. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ-size+regulation+in+mammals.">Organ-size regulation in mammals.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), 019240 (2015).</li><li>Sinigaglia, C., Thiel, D., Hejnol, A., Houliston, E., Lecl&#232;re, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+safer,+urea-based+in+situ+hybridization+method+improves+detection+of+gene+expression+in+diverse+animal+species.">A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species.</a> Developmental Biology. 434 (1), 15-23 (2018).</li><li>King, R. S., Newmark, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+protocol+for+enhanced+detection+of+gene+expression+in+the+planarian+Schmidtea+mediterranea.">In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea.</a> BMC Developmental Biology. 13 (1), 8 (2013).</li><li>Flici, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+evolutionarily+conserved+SoxB-Hdac2+crosstalk+regulates+neurogenesis+in+a+cnidarian.">An evolutionarily conserved SoxB-Hdac2 crosstalk regulates neurogenesis in a cnidarian.</a> Cell Reports. 18 (6), 1395-1409 (2017).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axial+Hox+code+controls+tissue+segmentation+and+body+patterning+in+Nematostella+vectensis.">An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.</a> Science. 361 (6409), 1377-1380 (2018).</li><li>Govindasamy, N., Murthy, S., Ghanekar, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Slow-cycling+stem+cells+in+hydra+contribute+to+head+regeneration.">Slow-cycling stem cells in hydra contribute to head regeneration.</a> Biology Open. 3 (12), 1236-1244 (2014).</li><li>Passamaneck, Y. J., Martindale, M. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+is+necessary+for+the+regeneration+of+oral+structures+in+the+anthozoan+cnidarian+Nematostella+vectensis.">Cell proliferation is necessary for the regeneration of oral structures in the anthozoan cnidarian Nematostella vectensis.</a> BMC Developmental Biology. 12 (1), 34 (2012).</li><li>Gold, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+developmental+disparity+in+the+tentacles+of+the+moon+jellyfish+Aurelia+sp.1.">Structural and developmental disparity in the tentacles of the moon jellyfish Aurelia sp.1.</a> PLoS One. 10 (8), 0134741 (2015).</li><li>Gold, D. A., Nakanishi, N., Hensley, N. M., Hartenstein, V., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+tracking+supports+secondary+gastrulation+in+the+moon+jellyfish+Aurelia.">Cell tracking supports secondary gastrulation in the moon jellyfish Aurelia.</a> Development Genes and Evolution. 226 (6), 383-387 (2016).</li><li>Cheng, L. -. C., Alvarado, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-mount+BrdU+staining+with+fluorescence+in+situ+hybridization+in+planarians.">Whole-mount BrdU staining with fluorescence in situ hybridization in planarians.</a> Planarian Regeneration. 1774, 423-434 (2018).</li></ol>

תאים מתרבים ותאי גזע הם מקורות תאיים חשובים בתהליכים שונים כגון מורפוגנזה, גדילה והתחדשות21,22. מאמר זה מתאר שיטה להכתמה משותפת של סמן תאי הגזע Nanos1 על ידי תיוג FISH ו- EdU ב- Cladonema medusae. עבודות קודמות שהשתמשו בתיוג EdU או BrdU הציעו כי תאים מתרבים מתמקמים לנור?...

Cnidaria נחשב לגוף מטזואני מסתעף בסיסי המכיל בעלי חיים עם עצבים ושרירים, מה שמציב אותם בעמדה ייחודית להבנת האבולוציה של התפתחות בעלי חייםופיזיולוגיה 1,2. קנידרים מסווגים לשתי קבוצות עיקריות: אנתוזואה (למשל, שושנות ים ואלמוגים) הם בעלי זחלי פלנולה בלבד ושלבי פוליפ ססיליים, בעוד שמדוסוזואה (חברי הידרוזואה, סטאורוזואה, סקיפוזואה וקובוזואה) לובשים בדרך כלל צורה של מדוזה בשחייה חופשית, או מדוזות, כמו גם זחלי פלנולה ופוליפים. קנידריאנים מפגינים בדרך כלל יכולת התחדשות גבוהה, והמנגנונים התאיים הבסיסיים שלהם, במיוחד החזקתם בתאי גזע בוגרים ובתאים מתרבים, משכו תשומת לב רבה 3,4. תאי גזע הידרוזואניים, שזוהו לראשונה בהידרה, ממוקמים בחללים הבין-תאיים שבין תאי אפיתל אקטודרמליים והם מכונים בדרך כלל תאים אינטרסטיציאליים או תאי i3.
תאי i הידרוזואניים חולקים מאפיינים משותפים הכוללים ריבוי פוטנציות, ביטוי של סמני תאי גזע שהשתמרו באופן נרחב (למשל, נאנוס, פיווי, ואסה), ופוטנציאל נדידה 3,5,6,7,8. כתאי גזע פונקציונליים, תאי i מעורבים באופן נרחב בהתפתחות, בפיזיולוגיה ובתגובות הסביבתיות של בעלי חיים הידרוזואניים, מה שמעיד על יכולת ההתחדשות הגבוהה שלהםופלסטיותם 3. בעוד שתאי גזע, בדומה לתאי i, לא זוהו מחוץ להידרוזואנים, אפילו במין המודל המבוסס Nematostella, תאים מתרבים עדיין מעורבים בתחזוקה והתחדשות של רקמות סומטיות, כמו גם בקו הנבט9. מכיוון שמחקרים בהתפתחות והתחדשות של מדוזות נערכו בעיקר על בעלי חיים מסוג פוליפ כמו הידרה, הידרקטיניה ונמטוסטלה, הדינמיקה התאית והתפקודים של תאי גזע במיני מדוזות נותרו ברובם ללא שינוי.
המדוזה ההידרוזואנית Clytia hemisphaerica , מין מדוזה קוסמופוליטית עם בתי גידול שונים ברחבי העולם, כולל הים התיכון וצפון אמריקה, שימשה כחיית מודל ניסיונית במספר מחקרים התפתחותיים ואבולוציוניים10. עם גודלה הקטן, הטיפול הקל והביציות הגדולות שלה, Clytia מתאימה לתחזוקת מעבדה, כמו גם להכנסת כלים גנטיים כגון שיטות הטרנסגנזה והנוקאאוטשנקבעו לאחרונה 11, מה שפותח את ההזדמנות לניתוח מפורט של המנגנונים התאיים והמולקולריים העומדים בבסיס הביולוגיה של המדוזות. בזרועות הציד Clytia medusa , תאי i ממוקמים באזור הפרוקסימלי, הנקרא הנורה, ואבות אבים כגון נמטובלסטים נודדים לקצה הדיסטלי תוך התמיינות לסוגי תאים שונים, כולל נמטוציטים12.
במהלך התחדשות של Clytia manubrium, איבר הפה של מדוזות, Nanos1 + i-תאים הנמצאים בגונדות נודדים לאזור שבו manubrium הוא איבד בתגובה לנזק ולהשתתף התחדשות של manubrium7. ממצאים אלה תומכים ברעיון שתאי i בקליטיה מתנהגים גם כתאי גזע פונקציונליים המעורבים במורפוגנזה ובהתחדשות. עם זאת, בהתחשב בכך המאפיינים של תאי i שונים בין בעלי חיים מייצגים מסוג פוליפ כגון הידרה ו Hydractinia3, ייתכן כי המאפיינים והפונקציות של תאי גזע מגוונים בין מיני מדוזות. יתר על כן, למעט קליטיה, טכניקות ניסיוניות הוגבלו עבור מדוזות אחרות, והדינמיקה המפורטת של תאים מתרבים ותאי גזע אינה ידועה13.
המדוזה ההידרוזואנית Cladonema pacificum היא אורגניזם מודל מתפתח שניתן לשמור בסביבת מעבדה ללא משאבת מים או מערכת סינון. למדוזה Cladonema יש זרועות ציד מסועפות, מאפיין נפוץ במשפחת Cladonematidae, ואיבר פוטורצפטור הנקרא ocellus בשכבה האקטודרמלית ליד הנורה14. תהליך הסתעפות זרועות הציד מתרחש באתר הסתעפות חדש המופיע לאורך הצד האדאקסיאלי של זרוע הציד. עם הזמן, זרועות הציד ממשיכות להתארך ולהסתעף, כאשר הענפים הישנים נדחקים החוצה לכיוון קצה15. בנוסף, זרועות הקלדונמה יכולות להתחדש תוך מספר ימים לאחר קטיעה. מחקרים אחרונים הציעו את תפקידם של תאים מתרבים ותאים דמויי גזע בהסתעפות זרועות ציד והתחדשות בקלדונמה16,17. עם זאת, בעוד הכלאה קונבנציונלית באתרה (ISH) נוצלה כדי לדמיין ביטוי גנים בקלדונמה, בשל הרזולוציה הנמוכה שלה, כיום קשה לצפות בדינמיקה של תאי גזע ברמה התאית בפירוט.
מאמר זה מתאר שיטה להדמיית תאים דמויי גזע בקלדונמה על ידי FISH וצביעה משותפת עם EdU, סמן של התפשטות תאים18. אנו מדמיינים את תבנית הביטוי של Nanos1, סמן תאי גזע 5,17, על ידי FISH, המאפשרת זיהוי של התפלגות תאים דמויי גזע ברמת התא הבודד. בנוסף, הצביעה המשותפת של ביטוי Nanos1 עם תיוג EdU מאפשרת להבחין בין תאים דמויי גזע המתרבים באופן פעיל. שיטה זו לניטור תאים דמויי גזע ותאים מתרבים יכולה להיות מיושמת על מגוון רחב של אזורי חקירה, כולל הסתעפות זרועות ציד, הומאוסטזיס רקמות והתחדשות איברים בקלדונמה, וגישה דומה יכולה להיות מיושמת על מיני מדוזות אחרים.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-Mercaptoethanol&#160;</td>
			<td>Wako</td>
			<td>137-06862</td>
			<td></td>
		</tr>
		<tr>
			<td>3.1 mL transfer pipette</td>
			<td>Thermo Scientific</td>
			<td>233-20S</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-4-chloro-3-indolyl-&#946;-D-galactopyranoside (X-Gal)</td>
			<td>Wako</td>
			<td>029-15043</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-DIG-POD</td>
			<td>Roche</td>
			<td>11207733910</td>
			<td></td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-AAGAGACACAGTCATTATCAAGC 
			GA-3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-CGACGTGTCCAATTTTACGTGCT -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- AAAAGAGCAGCGGCCAGAAAGA 
			AGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- GCGGGTCGCATACTTGTTGGTA 
			CTGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye</td>
			<td>Invitrogen&#160;</td>
			<td>C10337</td>
			<td>EdU kit</td>
		</tr>
		<tr>
			<td>Coroline off</td>
			<td>GEX Co. ltd</td>
			<td>N/A</td>
			<td>chlorine neutralizer</td>
		</tr>
		<tr>
			<td>DIG Nucleic Acid Detection Kit Blocking Reagent</td>
			<td>Roche</td>
			<td>11175041910</td>
			<td>blocking buffer&#160;</td>
		</tr>
		<tr>
			<td>DIG RNA labeling mix&#160;</td>
			<td>Roche</td>
			<td>11277073910</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>Promega</td>
			<td>P117B</td>
			<td></td>
		</tr>
		<tr>
			<td>ECOS competent cell DH5&#945;</td>
			<td>NIPPON GENE</td>
			<td>316-06233</td>
			<td>competent cell</td>
		</tr>
		<tr>
			<td>Fast gene Gel/PCR Extraction kit</td>
			<td>Fast gene</td>
			<td>FG-91302</td>
			<td>gel extraction kit</td>
		</tr>
		<tr>
			<td>Fast gene plasmid mini kit</td>
			<td>Fast gene</td>
			<td>FG-90502</td>
			<td>plasmid miniprep</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Wako&#160;</td>
			<td>068-00426</td>
			<td></td>
		</tr>
		<tr>
			<td>Heparin sodium salt from porcine</td>
			<td>SIGMA-ALDRICH&#160;</td>
			<td>H3393-10KU</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl-&#946;-D(-)-thiogalactopyranoside (IPTG)</td>
			<td>Wako</td>
			<td>096-05143</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar</td>
			<td>Invitrogen</td>
			<td>22700-025</td>
			<td>agar plate</td>
		</tr>
		<tr>
			<td>LB Broth Base</td>
			<td>Invitrogen</td>
			<td>12780-052</td>
			<td>LB medium</td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Wako</td>
			<td>134-00495</td>
			<td></td>
		</tr>
		<tr>
			<td>mini Quick spin RNA columns</td>
			<td>Roche</td>
			<td>11814427001</td>
			<td>clean-up column</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Wako&#160;</td>
			<td>191-01665</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop OneC Microvolume UV-Vis Spectrophotometer with Wi-Fi</td>
			<td>Thermo Scientific</td>
			<td>ND-ONEC-W</td>
			<td>spectrophotometer</td>
		</tr>
		<tr>
			<td>Polyoxyethlene (20) Sorbitan Monolaurate (Tween-20)</td>
			<td>Wako&#160;</td>
			<td>166-21115</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerMasher 2</td>
			<td>nippi&#160;</td>
			<td>891300</td>
			<td>homogenizer</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Nacarai Tesque&#160;</td>
			<td>29442-14</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor</td>
			<td>TaKaRa</td>
			<td>2313A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen&#160;</td>
			<td>74004</td>
			<td>total RNA isolation kit</td>
		</tr>
		<tr>
			<td>RQ1 RNase-Free Dnase</td>
			<td>Promega</td>
			<td>M6101</td>
			<td></td>
		</tr>
		<tr>
			<td>Saline Sodium Citrate Buffer 20x powder (20x SSC)</td>
			<td>TaKaRa</td>
			<td>T9172</td>
			<td></td>
		</tr>
		<tr>
			<td>SEA LIFE</td>
			<td>Marin Tech</td>
			<td>N/A</td>
			<td>mixture of mineral salts</td>
		</tr>
		<tr>
			<td>T3 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>11031163001</td>
			<td></td>
		</tr>
		<tr>
			<td>T7 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>10881767001</td>
			<td></td>
		</tr>
		<tr>
			<td>TAITEC HB-100</td>
			<td>TAITEC</td>
			<td>0040534-000</td>
			<td>Hybridization incuvator</td>
		</tr>
		<tr>
			<td>TaKaRa Ex Taq&#160;</td>
			<td>TaKaRa</td>
			<td>RR001A</td>
			<td>Taq DNA polymerase</td>
		</tr>
		<tr>
			<td>TaKaRa PrimeScript 2 1st strand cDNA Synthesis Kit</td>
			<td>TaKaRa</td>
			<td>6210A</td>
			<td>cDNA synthesis kit</td>
		</tr>
		<tr>
			<td>Target Clone</td>
			<td>TOYOBO&#160;</td>
			<td>TAK101</td>
			<td>pTA2 Vector</td>
		</tr>
		<tr>
			<td>tRNA</td>
			<td>Roche</td>
			<td>10109541001</td>
			<td></td>
		</tr>
		<tr>
			<td>TSA Plus Cyanine 5</td>
			<td>AKOYA Biosciences</td>
			<td>NEL745001KT</td>
			<td>tyramide signal amplification (TSA) technique</td>
		</tr>
		<tr>
			<td>Zeiss LSM 880</td>
			<td>ZEISS</td>
			<td>N/A</td>
			<td>laser scanning confocal microscope</td>
		</tr>
	</tbody>
</table>

fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum

קנידריאנים, כולל שושנות ים, אלמוגים ומדוזות, מפגינים מורפולוגיה ואורחות חיים מגוונים המתבטאים בפוליפים ססיליים ובמדוזות שחייה חופשית. כפי שמודגם במודלים מבוססים כגון הידרה ונמטוסטלה, תאי גזע ו/או תאים מתרבים תורמים להתפתחות והתחדשות של פוליפים קנידריים. עם זאת, המנגנונים התאיים הבסיסיים ברוב המדוזות, במיוחד בשלב המדוזה, אינם ברורים במידה רבה, ולכן פיתוח שיטה איתנה לזיהוי סוגי תאים ספציפיים הוא קריטי. מאמר זה מתאר פרוטוקול להדמיית תאים מתרבים דמויי גזע במדוזה ההידרוזואנית Cladonema pacificum. ל-Cladonema medusae יש זרועות ציד מסועפות שגדלות ללא הרף ושומרות על יכולת התחדשות לאורך כל שלב הבוגרים שלהן, ומספקות פלטפורמה ייחודית שבאמצעותה ניתן לחקור את המנגנונים התאיים המתוזמרים על ידי תאים מתרבים ו/או דמויי גזע. הכלאה פלואורסצנטית שלמה באתרה (FISH) באמצעות סמן תאי גזע מאפשרת זיהוי של תאים דמויי גזע, בעוד תיוג פולסים עם 5-אתיניל-2'-דאוקסיורידין (EdU), סמן שלב S, מאפשר זיהוי של תאים מתרבים. בשילוב של תיוג FISH ו-EdU, אנו יכולים לזהות תאים דמויי גזע המתרבים באופן פעיל על בעלי חיים קבועים, וטכניקה זו יכולה להיות מיושמת באופן נרחב על בעלי חיים אחרים, כולל מיני מדוזות שאינן דוגמניות.

זרועות הציד של קלדונמה שימשו כמודל לחקר התהליכים התאיים של מורפוגנזה והתחדשות15,16,17. מבנה זרועות הציד מורכב מצינור אפיתל שבו תאים דמויי גזע, או תאי i, ממוקמים באזור הפרוקסימלי, הנקרא נורת זרועות ציד, וענפים חדשים מתווספים ברצף לחלק האח...

Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

כאן אנו מתארים פרוטוקול להדמיית תאים מתרבים דמויי גזע במדוזה Cladonema. הכלאה פלואורסצנטית שלמה באתרה עם סמן תאי גזע מאפשרת זיהוי של תאים דמויי גזע, ותיוג 5-אתיניל-2'-דאוקסיורידין מאפשר זיהוי של תאים מתרבים. יחד, ניתן לזהות תאים דמויי גזע המתרבים באופן פעיל.

הכלאה פלואורסצנטית באתרה ותיוג 5-אתיניל-2'-דאוקסיורידין לתאים דמויי גזע במדוזה הידרוזואנית Cladonema pacificum

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and ...

צביעה משותפת של ביטוי Nanos1 עם תיוג EdU מאפשרת להבחין בין תאים דמויי גזע המתרבים באופן פעיל. אנו יכולים לזהות התפלגות תאים דמויי גזע ברמת התא הבודד במדוזה Cladonema. אנו יכולים לדמיין תאים דמויי גזע ותאים מתרבים באותה דגימת מדוזות, המאפשרת זיהוי של תאים דמויי גזע מתרבים ולא מתרבים, מה שמוביל להבנת ההטרוגניות של תאי גזע.ביולוגיה התפתחותית ומחקרי התחדשות באמצעות מודלים של בעלי חיים הכוללים תאי גזע. המדוזה ההידרוזואנית Cladonema pacificum היא אורגניזם מודל מתפתח שניתן לשמור בסביבת מעבדה ללא כל מערכת מיוחדת. ל-Cladonema medusae יש זרועות ציד מסועפות.ההסתעפות מתרחשת באתר חדש לאורך הצד האדאקסיאלי של זרועות הציד. עם הזמן, זרועות הציד ממשיכות להתארך ולהסתעף, כאשר ענפים ישנים יותר נדחקים החוצה לכיוון הקצה. זרועות הציד יכולות גם להתחדש תוך מספר ימים לאחר הקטיעה.גודל קטן, טיפול קל ונוכחות של תאי גזע בוגרים או תאים דמויי גזע הופכים את Cladonema למערכת טובה לחקור את תפקידם של תאי גזע בתהליכים שונים. כדי להתחיל, מקם את Cladonema medusae לתוך צינורות 1.5 מיליליטר באמצעות פיפטה העברה של 3.5 מיליליטר והוסף ASW עד לנפח כולל של 500 מיקרוליטר. הוסיפו 7.5 מיקרוליטרים של תמיסת מלאי EdU של 10 מילימולר ודגרו את הדגימות למשך שעה אחת בטמפרטורה של 22 מעלות צלזיוס.המתן שעה והסר כמה שיותר ASW המכיל EdU. לאחר הרדמת המדוזה, לדגור במשך חמש דקות. תקן את המדוזה למשך הלילה בארבע מעלות צלזיוס עם 4% פרפורמלדהיד ב- ASW.לטיפול בפרוטאינאז ולאחר קיבוע, הסר את הפרפורמלדהיד ושטוף את הדגימות עם PBS המכיל 0.1% Tween 20 thrice במשך 10 דקות כל אחת. הסר את ה- PBST והוסף את מאגר ההכלאה. דגירה של הדגימות במאגר ההכלאה למשך 15 דקות בטמפרטורת החדר.הסר את מאגר ההכלאה והוסף את מאגר ההכלאה החדש. טרום הכלאה ב-55 מעלות צלזיוס למשך שעתיים לפחות באינקובטור הכלאה. הסר את מאגר ההכלאה ודגירה עם מאגר ההכלאה המכיל את הבדיקות.הכלאה ב-55 מעלות צלזיוס למשך 18 עד 24 שעות באינקובטור הכלאה. לאחר מכן, המשך בהסרת בדיקה. התחל עם הסרת מאגר ההכלאה המכיל בדיקות ולאחר מכן הוסף מאגר שטיפה אחד.לשטוף את הדגימות עם מאגר לשטוף פעמיים במשך 15 דקות ב 55 מעלות צלזיוס. הסר את מאגר הכביסה אחד והוסף את מאגר הכביסה שניים. שטפו את הדגימות במאגר פעמיים למשך 15 דקות בטמפרטורה של 55 מעלות צלזיוס.הסר את מאגר הכביסה 2 ולאחר מכן הוסף 2X SSC. לשטוף את הדגימות עם 2X SSC פעמיים במשך 15 דקות ב 55 מעלות צלזיוס. הסר 2X SSC ולאחר מכן הוסף PBST שחומם מראש.שטפו את הדגימות במשך 15 דקות עם PBST בטמפרטורת החדר. עבור דגירה של נוגדנים נגד DIG, התחל על ידי הסרת PBST ולאחר מכן הוסף מאגר חוסם 1%. דגרו את הדגימות למשך שעה לפחות בטמפרטורת החדר תוך כדי ניעור איטי על נדנדה.לאחר החסימה, הסר את המאגר החוסם 1%. הוסיפו תמיסת אנטי-DIG-POD ודגרו את הדגימות למשך הלילה בטמפרטורה של ארבע מעלות צלזיוס. כדי לזהות את הבדיקה המסומנת ב- DIG, הסר את התמיסה נגד DIG-POD והוסף חיץ Tween של טריס נתרן כלורי.שטפו את הדגימות עם חיץ Tween של טריס נתרן כלורי שלוש פעמים למשך 10 דקות בטמפרטורת החדר. דילול תמיסת מלאי טירמיד מצומדת בצבע פלואורסצנטי במאגר המדולל של ההגברה כדי ליצור את תמיסת הטירמיד הפעילה Cy5. הסר כמה שיותר חיץ טריס נתרן כלורי Tween ולאחר מכן הוסף את תמיסת הטירמיד הפעילה Cy5.לדגור את הדגימות במשך 10 דקות בחושך. לשטוף את הדגימות עם PBST שלוש פעמים במשך 10 דקות בחושך. כדי להכין את קוקטייל זיהוי EdU, מערבבים את הרכיבים.הסר PBST ולאחר מכן הוסף את קוקטייל זיהוי EdU. לדגור את הדגימה בחושך במשך 30 דקות. יש לשטוף עם PBST שלוש פעמים במשך 10 דקות בחושך.לצביעת DNA, יש לדלל את Hoechst ב-PBST כדי להכין את תמיסת Hoechst. הסר את ה- PBST ולאחר מכן הוסף את פתרון Hoechst. דגירה של הדגימות במשך 30 דקות בחושך.שטפו את הדגימות עם PBST שלוש עד ארבע פעמים למשך 10 דקות בחושך. הבא להרכבה, להעביר את medusae לבנק על זכוכית שקופית באמצעות פיפטה העברה עם קצה מנותק. יש להניח בעדינות כיסוי על המדוזה בעזרת מלקחיים ולאטום את צד הכיסוי עם לק שקוף.התיוג המשותף של ביטוי Nanos1 ותאים חיוביים של EdU חשף את התבנית המרחבית של תאים דמויי גזע ותאים מתרבים בזרוע. תאים חיוביים של EdU הופצו באופן נרחב יותר בכל נורת זרועות הציד, בעוד שתאים חיוביים של Nanos1 שהצטברו באופן מקומי יותר בנורת זרועות הציד ובאתר ההסתעפות החדש, מצביעים על כך שהתפלגויות שונות של תאים דמויי גזע ותאים מתרבים מזוהות בהתאם לתזמון ההתפתחותי ולשלבים שונים. התיוג המשותף של EdU ו-Nanos1 נצפה ב-19.79% מהתאים, מה שמרמז על כך שתאים אלה הם אוכלוסיית תאי גזע המתרבה באופן פעיל.באופן מסקרן, 14.46% מהתאים נמצאו כחיוביים ל-EdU Nanos1 שליליים במרכז הנורה ובאתר ההסתעפות החדש, מה שמרמז על נוכחותם של תאים מתרבים שאינם דמויי גזע. לעומת זאת, 26.32% מהתאים נצפו כחיוביים ל-EdU שלילי Nanos1 בבסיס הנורה ובאתר ההסתעפות החדש, מה שמעיד על נוכחות של אוכלוסיית תאי גזע שהיא מחזורית איטית או שקטה, שאף אחד מהם לא זוהה על ידי תיוג דופק EdU. תיוג דופק EdU עם זמן דגירה קצר מאפשר זיהוי של תאים מתרבים בלבד בקרב תאים דמויי גזע ותאים שאינם דמויי גזע.כאשר משנים את זמן הדגירה עבור EdU ומשלבים ניסויי מרדף ארוכי שנים, ניתן לסמן תאי גזע בעלי מחזור איטי או סוגי תאים אחרים כולל צאצאים ותאים ממוינים.

fluorescent-situ-hybridization-5-ethynyl-2-deoxyuridine-labeling-for

Research

JoVE Journal

Developmental Biology

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development. The Xenopuslaevis embryo is very useful for studying organogenesis because their large size makes them very suitable for identifying organs at the earliest steps in organogenesis. At this time, the primary method used for identifying a specific organ or primordium is whole mount in situ hybridization with labeled antisense RNA probes specific to a gene that is expressed in the organ of interest. In addition, it is relatively easy to manipulate genes or signaling pathways in Xenopus and in situ hybridization allows one to then assay for changes in the presence or morphology of a target organ. Whole mount in situ hybridization is a multi-day protocol with many steps involved. Here we provide a simplified protocol with reduced numbers of steps and reagents used that works well for routine assays. In situ hybridization robots have greatly facilitated the process and we detail how and when we utilize that technology in the process. Once an in situ hybridization is complete, capturing the best image of the result can be frustrating. We provide advice on how to optimize imaging of in situ hybridization results. Although the protocol describes assessing organogenesis in Xenopus laevis, the same basic protocol can almost certainly be adapted to Xenopus tropicalis and other model systems.

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

The Xenopus laevis embryo continues to be exceptionally useful in the study of early development due to its large size and ease of manipulation. A simplified protocol for whole mount in situ hybridization protocol is provided that can be used in the identification of specific organs in this model system.

הבנת organogenesis המוקדם שימוש פשוטה<em&gt; באתר</em&gt; הכלאת פרוטוקול ב<em&gt; Xenopus</em

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development.  The Xenopuslaevis embryo ...

Application of the DNA-Specific Stain Methyl Green in the Fluorescent Labeling of Embryos

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored until recently. In this article, we illustrate the method for preparing a methyl green aqueous stock solution, that when diluted can be used as a very convenient fluorescent nuclear label for fixed cells and tissues. Easy procedures to label whole zebrafish and chick embryos are detailed, and examples of images obtained shown. Methyl green is maximally excited by red light, at 633 nm, and emits with a relatively sharp spectrum that peaks at 677 nm. It is very inexpensive, non-toxic, highly stable in solution and very resistant to photobleaching when bound to DNA. Its red emission allows for unaltered high resolution scanning confocal imaging of nuclei in thick specimens. Finally, this methyl green staining protocol is compatible with other cell staining procedures, such as antibody labeling, or actin filaments labeling with fluorophore-conjugated phalloidin.

A method for fluorescent staining of fixed biological material with the specific DNA label methyl green is described. Methyl green is used in a diluted aqueous solution and is very resistant to photobleaching. Its far-red emission allows for deep specimen imaging, making it particularly adequate for whole embryos.

יישום של ה- DNA ספציפי הכתם מתיל הירוק בתיוג פלורסנט של עוברים

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored ...

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are expressed in spatial relation to each other in situ. Multi-target chromogenic whole-mount in situ hybridization (MC-WISH) greatly facilitates the instant comparison of gene expression patterns, as it allows distinctive visualization of different mRNA species in contrasting colors in the same sample specimen. This provides the possibility to relate gene expression domains topographically to each other with high accuracy and to define unique and overlapping expression sites. In the presented protocol, we describe a MC-WISH procedure for comparing mRNA expression patterns of different genes in Drosophila embryos. Up to three RNA probes, each specific for another gene and labeled by a different hapten, are simultaneously hybridized to the embryo samples and subsequently detected by alkaline phosphatase-based colorimetric immunohistochemistry. The described procedure is detailed here for Drosophila, but works equally well with zebrafish embryos.

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

We describe a multi-target chromogenic whole-mount in situ hybridization (MC-WISH) procedure in intact Drosophila embryos allowing simultaneous and specific detection of three different mRNA distribution patterns by contrasting color precipitates.

רב-יעד Chromogenic כל הר<em&gt; באתר</em&gt; הכלאה להשוואת תחומים ביטוי גנים ב<em&gt; דרוזופילה</em&gt; עוברים

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

ניתוח Immunofluorescent מכתים של פטריות הגוף והנפש ומה קולט אור נוירונים במוח למבוגרים דרוזופילה melanogaster

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and optical transparency. In particular, the zebrafish embryo has become an important organism to study vertebrate kidney organogenesis as well as multiciliated cell (MCC) development. To visualize MCCs in the embryonic zebrafish kidney, we have developed a combined protocol of whole-mount fluorescent in situ hybridization (FISH) and whole mount immunofluorescence (IF) that enables high resolution imaging. This manuscript describes our technique for co-localizing RNA transcripts and protein as a tool to better understand the regulation of developmental programs through the expression of various lineage factors.

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

Cilia development is vital to proper organogenesis. This protocol describes an optimized method to label and visualize ciliated cells of the zebrafish.

להמחיש Multiciliated בתאים דג זברה באמצעות פרוטוקול משולב של פלורסנט הר שלמה בחיי עיר הכלאה, Immunofluorescence

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and ...

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain and protect cellular identities. The conversion of germ cells into specific neurons in the nematode Caenorhabditis elegans (C. elegans) is a powerful tool for performing genetic screens in order to dissect regulatory pathways that safeguard established cell identities. Reprogramming of germ cells to a specific type of neurons termed ASE requires transgenic animals that allow broad over-expression of the Zn-finger transcription factor (TF) CHE-1. Endogenous CHE-1 is expressed exclusively in two head neurons and is required to specify the glutamatergic ASE neurons fate, which can easily be visualized by the gcy-5prom::gfp reporter. A trans gene containing the heat-shock promoter-driven che-1 gene expression construct allows broad mis-expression of CHE-1 in the entire animal upon heat-shock treatment. The combination of RNAi against the chromatin-regulating factor LIN-53 and heat-shock-induced che-1 over-expression leads to reprogramming of germ cell into ASE neuron-like cells. We describe here the specific RNAi procedure and appropriate conditions for heat-shock treatment of transgenic animals in order to successfully induce germ cell to neuron conversion.

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

This protocol describes how to study cellular processes during cell fate conversion in Caenorhabditis elegans in vivo. Using transgenic animals, allowing heat-shock promoter-driven overexpression of the neuron fate-inducing transcription factor CHE-1 and RNAi-mediated depletion of the chromatin-regulating factor LIN-53 germ cell to neuron reprogramming can be observed in vivo.

היישום של RNAi חום-הלם-induced בביטוי פקטור שעתוק כדי לתכנת בתאי הנבט את הנוירונים C . elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain ...

Wholemount In Situ Hybridization for Astyanax Embryos

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of genes. Prior research into this emerging model system capitalized on comprehensive genome-wide investigations that have identified numerous quantitative trait loci (QTL) associated with various cave-associated phenotypes. However, the ability to connect genes of interest to the heritable basis for phenotypic change remains a significant challenge. One technique that can facilitate deeper understanding of the role of development in troglomorphic evolution is whole-mount in situ hybridization. This technique can be implemented to directly compare gene expression between cave- and surface-dwelling forms, nominate candidate genes underlying established QTL, identify genes of interest from next-generation sequencing studies, or develop other discovery-based approaches. In this report, we present a simple protocol, supported by a flexible checklist, that can be widely adapted for use well beyond the presented study system. It is hoped that this protocol can serve as a broad resource for the Astyanax community and beyond.

Wholemount In Situ Hybridization for Astyanax Embryos

This protocol enables visualization of gene expression in embryonic Astyanax cavefish. This approach has been developed with the goal of maximizing gene expression signal, while minimizing non-specific background staining.

Wholemount ב באתרו הכלאה עבור עוברי Astyanax

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

בדור חוץ גופית של Somite נגזרים מן האדם המושרה בתאי גזע Pluripotent

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Genotyping and Quantification of In Situ Hybridization Staining in Zebrafish

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in developmental biology for decades. Traditionally, most gene expression studies relied on visual evaluation of the ISH signal, a method that is prone to bias, particularly in cases where sample identities are known a priori. We have previously reported on a method to circumvent this bias and provide a more accurate quantification of ISH signals. Here, we present a simple guide to apply this method to quantify the expression levels of genes of interest in ISH-stained embryos and correlate that with their corresponding genotypes. The method is particularly useful to quantify spatially restricted gene expression signals in samples of mixed genotypes and it provides an unbiased and accurate alternative to the traditional visual scoring methods.

Gene editing technologies have enabled researchers to generate zebrafish mutants to investigate gene function with relative ease. Here, we provide a guide to perform parallel embryo genotyping and quantification of in situ hybridization signals in zebrafish. This unbiased approach provides greater accuracy in phenotypical analyses based on in situ hybridization.

כתמים וכימות של היברידיזציה באתרו בתוך דג זברה

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in ...

Whole-Mount In Situ Hybridization in Zebrafish Embryos and Tube Formation Assay in iPSC-ECs to Study the Role of Endoglin in Vascular Development

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in zebrafish during different developmental stages. To investigate the role of endoglin(eng) in vessel formation during the development of hereditary hemorrhagic telangiectasia&#160;(HHT), morpholino-mediated targeted knockdown of eng in zebrafish are used to study its temporal expression and associated functions. Here, whole-mount in situ RNA hybridization (WISH) is employed for the analysis of eng and its downstream genes in zebrafish embryos. Also, tube formation assays are performed in HHT patient-derived induced pluripotent stem cell-differentiated&#160;endothelial cells (iPSC-ECs; with eng mutations). A specific signal amplifying system using the whole amount In Situ Hybridization &#8211; WISH provides higher resolution and lower background results compared to traditional methods. To obtain a better signal, the post-fixation time is adjusted to 30 min after probe hybridization. Because fluorescence staining is not sensitive in zebrafish embryos, it is replaced with diaminobezidine (DAB) staining here. In this protocol, HHT&#160;patient-derived iPSC lines containing an eng mutation are differentiated into endothelial cells. After coating a plate with basement membrane matrix for 30 min at 37 &#176;C, iPSC-ECs are seeded as a monolayer into wells and kept at 37 &#176;C for 3 h. Then, the tube length and number of branches are calculated using microscopic images. Thus, with this improved WISH protocol, it is shown that reduced eng expression affects endothelial progenitor formation in zebrafish embryos. This is further confirmed by tube formation assays using iPSC-ECs derived from a patient with HHT. These assays confirm the role for eng in early vascular development.

Presented here is a protocol for whole-mount in situ RNA hybridization analysis in zebrafish and tube formation assay in patient-derived induced pluripotent stem cell-derived endothelial cells to study the role of endoglin in vascular formation.

הר שלם בתוך היברידיזציה ב-Zebrafish עוברים ושיטת היווצרות צינור ב-iPSC-ECs ללמוד את התפקיד של אנגלין בפיתוח כלי דם

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in ...