Name: fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum
Uploaded: 2022-08-03T15:00:00
Description: Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Questo lavoro è stato supportato da AMED con il numero di sovvenzione JP22gm6110025 (a Y.N.) e dal JSPS KAKENHI Grant Number 22H02762 (a Y.N.).

NOTA: vedere la tabella dei materiali per i dettagli relativi a tutti i materiali, i reagenti e le apparecchiature utilizzate in questo protocollo.
1. Sintesi della sonda
<ol><li>Estrazione dell'RNA<ol><li>Posizionare tre meduse di Cladonema vive coltivate in acqua di mare artificiale (ASW) in una provetta da 1,5 ml utilizzando una pipetta di trasferimento da 3,1 ml con la punta tagliata e rimuovere quanto più ASW possibile. NOTA: ASW si prepara...

<ol>
	<li>Lecl&#232;re, L., R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+cnidarian+muscles:+Function,+anatomy,+development+and+regeneration.">Diversity of cnidarian muscles: Function, anatomy, development and regeneration.</a> Frontiers in Cell and Developmental Biology. 4, 157 (2017).</li><li>Bosch, T. C. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Back+to+the+basics:+Cnidarians+start+to+fire.">Back to the basics: Cnidarians start to fire.</a> Trends in Neurosciences. 40 (2), 92-105 (2017).</li><li>Gold, D. A., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+dynamics+in+Cnidaria:+Are+there+unifying+principles.">Stem cell dynamics in Cnidaria: Are there unifying principles.</a> Development Genes and Evolution. 223 (1-2), 53-66 (2013).</li><li>Technau, U., Steele, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+crossroads+in+developmental+biology:+Cnidaria.">Evolutionary crossroads in developmental biology: Cnidaria.</a> Development. 138 (8), 1447-1458 (2011).</li><li>Lecl&#232;re, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternally+localized+germ+plasm+mRNAs+and+germ+cell/stem+cell+formation+in+the+cnidarian+Clytia.">Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the cnidarian Clytia.</a> Developmental Biology. 364 (2), 236-248 (2012).</li><li>Bradshaw, B., Thompson, K., Frank, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+mechanisms+underlie+oral+vs+aboral+regeneration+in+the+cnidarian+Hydractinia+echinata.">Distinct mechanisms underlie oral vs aboral regeneration in the cnidarian Hydractinia echinata.</a> eLife. 4, 05506 (2015).</li><li>Sinigaglia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pattern+regulation+in+a+regenerating+jellyfish.">Pattern regulation in a regenerating jellyfish.</a> eLife. 9, 54868 (2020).</li><li>David, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interstitial+stem+cells+in+Hydra:+Multipotency+and+decision-making.">Interstitial stem cells in Hydra: Multipotency and decision-making.</a> The International Journal of Developmental Biology. 56 (6-7-8), 489-497 (2012).</li><li>R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nematostella+vectensis,+an+emerging+model+for+deciphering+the+molecular+and+cellular+mechanisms+underlying+whole-body+regeneration.">Nematostella vectensis, an emerging model for deciphering the molecular and cellular mechanisms underlying whole-body regeneration.</a> Cells. 10 (10), 2692 (2021).</li><li>Houliston, E., Momose, T., Manuel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clytia+hemisphaerica:+A+jellyfish+cousin+joins+the+laboratory.">Clytia hemisphaerica: A jellyfish cousin joins the laboratory.</a> Trends in Genetics. 26 (4), 159-167 (2010).</li><li>Peron, S., Houliston, E., Lecl&#232;re, L., Boutet, A., Shierwater, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Marine+Jellyfish+Model,+Clytia+hemisphaerica.">The Marine Jellyfish Model, Clytia hemisphaerica.</a> Handbook of Marine Model Organisms in Experimental Biology. , 129-147 (2021).</li><li>Denker, E., Manuel, M., Lecl&#232;re, L., Le Guyader, H., Rabet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ordered+progression+of+nematogenesis+from+stem+cells+through+differentiation+stages+in+the+tentacle+bulb+of+Clytia+hemisphaerica+(Hydrozoa,+Cnidaria).">Ordered progression of nematogenesis from stem cells through differentiation stages in the tentacle bulb of Clytia hemisphaerica (Hydrozoa, Cnidaria).</a> Developmental Biology. 315 (1), 99-113 (2008).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regeneration+potential+of+jellyfish:+Cellular+mechanisms+and+molecular+insights.">Regeneration potential of jellyfish: Cellular mechanisms and molecular insights.</a> Genes. 12 (5), 758 (2021).</li><li>Suga, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flexibly+deployed+Pax+genes+in+eye+development+at+the+early+evolution+of+animals+demonstrated+by+studies+on+a+hydrozoan+jellyfish.">Flexibly deployed Pax genes in eye development at the early evolution of animals demonstrated by studies on a hydrozoan jellyfish.</a> Proceedings of the National Academy of Sciences. 107 (32), 14263-14268 (2010).</li><li>Fujiki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Branching+pattern+and+morphogenesis+of+medusa+tentacles+in+the+jellyfish+Cladonema+pacificum+(Hydrozoa,+Cnidaria).">Branching pattern and morphogenesis of medusa tentacles in the jellyfish Cladonema pacificum (Hydrozoa, Cnidaria).</a> Zoological Letters. 5 (12), 13 (2019).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+controls+body+size+growth,+tentacle+morphogenesis,+and+regeneration+in+hydrozoan+jellyfish+Cladonema+pacificum.">Cell proliferation controls body size growth, tentacle morphogenesis, and regeneration in hydrozoan jellyfish Cladonema pacificum.</a> PeerJ. 7, 7579 (2019).</li><li>Hou, S., Zhu, J., Shibata, S., Nakamoto, A., Kumano, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repetitive+accumulation+of+interstitial+cells+generates+the+branched+structure+of+Cladonema+medusa+tentacles.">Repetitive accumulation of interstitial cells generates the branched structure of Cladonema medusa tentacles.</a> Development. 148 (23), (2021).</li><li>Salic, A., Mitchison, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+method+for+fast+and+sensitive+detection+of+DNA+synthesis+in+vivo.">A chemical method for fast and sensitive detection of DNA synthesis in vivo.</a> Proceedings of the National Academy of Sciences of the United States of America. 105 (7), 2415-2420 (2008).</li><li>Angerer, L. M., Angerer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+poly+A+++RNA+in+sea+urchin+eggs+and+embryos+by+quantitative+in+situ+hybridization.">Detection of poly A + RNA in sea urchin eggs and embryos by quantitative in situ hybridization.</a> Nucleic Acids Research. 9 (12), 2819-2840 (1981).</li><li>Rakotomamonjy, J., Guemez-Gamboa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purkinje+cell+survival+in+organotypic+cerebellar+slice+cultures.">Purkinje cell survival in organotypic cerebellar slice cultures.</a> Journal of Visualized Experiments. (154), e60353 (2019).</li><li>Tanaka, E. M., Reddien, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+basis+for+animal+regeneration.">The cellular basis for animal regeneration.</a> Developmental Cell. 21 (1), 172-185 (2011).</li><li>Penzo-M&#233;ndez, A. I., Stanger, B. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ-size+regulation+in+mammals.">Organ-size regulation in mammals.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), 019240 (2015).</li><li>Sinigaglia, C., Thiel, D., Hejnol, A., Houliston, E., Lecl&#232;re, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+safer,+urea-based+in+situ+hybridization+method+improves+detection+of+gene+expression+in+diverse+animal+species.">A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species.</a> Developmental Biology. 434 (1), 15-23 (2018).</li><li>King, R. S., Newmark, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+protocol+for+enhanced+detection+of+gene+expression+in+the+planarian+Schmidtea+mediterranea.">In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea.</a> BMC Developmental Biology. 13 (1), 8 (2013).</li><li>Flici, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+evolutionarily+conserved+SoxB-Hdac2+crosstalk+regulates+neurogenesis+in+a+cnidarian.">An evolutionarily conserved SoxB-Hdac2 crosstalk regulates neurogenesis in a cnidarian.</a> Cell Reports. 18 (6), 1395-1409 (2017).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axial+Hox+code+controls+tissue+segmentation+and+body+patterning+in+Nematostella+vectensis.">An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.</a> Science. 361 (6409), 1377-1380 (2018).</li><li>Govindasamy, N., Murthy, S., Ghanekar, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Slow-cycling+stem+cells+in+hydra+contribute+to+head+regeneration.">Slow-cycling stem cells in hydra contribute to head regeneration.</a> Biology Open. 3 (12), 1236-1244 (2014).</li><li>Passamaneck, Y. J., Martindale, M. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+is+necessary+for+the+regeneration+of+oral+structures+in+the+anthozoan+cnidarian+Nematostella+vectensis.">Cell proliferation is necessary for the regeneration of oral structures in the anthozoan cnidarian Nematostella vectensis.</a> BMC Developmental Biology. 12 (1), 34 (2012).</li><li>Gold, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+developmental+disparity+in+the+tentacles+of+the+moon+jellyfish+Aurelia+sp.1.">Structural and developmental disparity in the tentacles of the moon jellyfish Aurelia sp.1.</a> PLoS One. 10 (8), 0134741 (2015).</li><li>Gold, D. A., Nakanishi, N., Hensley, N. M., Hartenstein, V., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+tracking+supports+secondary+gastrulation+in+the+moon+jellyfish+Aurelia.">Cell tracking supports secondary gastrulation in the moon jellyfish Aurelia.</a> Development Genes and Evolution. 226 (6), 383-387 (2016).</li><li>Cheng, L. -. C., Alvarado, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-mount+BrdU+staining+with+fluorescence+in+situ+hybridization+in+planarians.">Whole-mount BrdU staining with fluorescence in situ hybridization in planarians.</a> Planarian Regeneration. 1774, 423-434 (2018).</li></ol>

Le cellule proliferanti e le cellule staminali sono importanti fonti cellulari in vari processi come la morfogenesi, la crescita e la rigenerazione21,22. Questo articolo descrive un metodo per co-colorare il marcatore di cellule staminali Nanos1 mediante marcatura FISH e EdU in Cladonema medusae. Lavori precedenti che utilizzano l'etichettatura EdU o BrdU hanno suggerito che le cellule proliferative si localizzano nei bulbi tentacolari<sup class...

Cnidaria è considerato un phylum metazoico basalmente ramificato contenente animali con nervi e muscoli, ponendoli in una posizione unica per comprendere l'evoluzione dello sviluppo animale e della fisiologia 1,2. Gli Cnidari sono classificati in due gruppi principali: gli antozoi (ad esempio, anemoni di mare e coralli) possiedono solo larve di planula e stadi di polipo sessili, mentre i Medusozoi (membri di Hydrozoa, Staurozoa, Scyphozoa e Cubozoa) assumono tipicamente la forma di meduse che nuotano liberamente, o meduse, così come larve di planula e polipi. Gli Cnidari mostrano comunemente un'elevata capacità rigenerativa e i loro meccanismi cellulari sottostanti, in particolare il possesso di cellule staminali adulte e cellule proliferative, hanno attirato molta attenzione 3,4. Inizialmente identificate in Hydra, le cellule staminali idrozoiche si trovano negli spazi interstiziali tra le cellule epiteliali ectodermiche e sono comunemente indicate come cellule interstiziali o cellulei-3.
Le cellule i-idrozoiche condividono caratteristiche comuni che includono la multipotenza, l'espressione di marcatori di cellule staminali ampiamente conservati (ad esempio, Nanos, Piwi, Vasa) e il potenziale di migrazione 3,5,6,7,8. Come cellule staminali funzionali, le cellule i-sono ampiamente coinvolte nello sviluppo, nella fisiologia e nelle risposte ambientali degli animali idrozoi, il che attesta la loro elevata capacità rigenerativa e plasticità3. Mentre le cellule staminali, simili alle cellule i, non sono state identificate al di fuori degli idrozoi, anche nella specie modello stabilita Nematostella, le cellule proliferative sono ancora coinvolte nel mantenimento e nella rigenerazione del tessuto somatico, così come la linea germinale9. Poiché gli studi sullo sviluppo e la rigenerazione cnidariana sono stati condotti prevalentemente su animali di tipo polipo come Hydra, Hydractinia e Nematostella, la dinamica cellulare e le funzioni delle cellule staminali nelle specie di meduse rimangono in gran parte non affrontate.
La medusa idrozoica Clytia hemisphaerica , una specie di medusa cosmopolita con diversi habitat in tutto il mondo, tra cui il Mar Mediterraneo e il Nord America, è stata utilizzata come animale modello sperimentale in diversi studi evolutivi e sullo sviluppo10. Con le sue piccole dimensioni, la facilità d'uso e le uova di grandi dimensioni, Clytia è adatto per la manutenzione in laboratorio, nonché per l'introduzione di strumenti genetici come i metodi di transgenesi e knockout recentemente stabiliti11, aprendo l'opportunità di un'analisi dettagliata dei meccanismi cellulari e molecolari alla base della biologia delle meduse. Nel tentacolo di Clytia medusa, le cellule I sono localizzate nella regione prossimale, chiamata bulbo, e i progenitori come i nematoblasti migrano verso la punta distale differenziandosi in tipi cellulari distinti, compresi i nematociti12.
Durante la rigenerazione del Clytia manubrium, l'organo orale delle meduse, le cellule Nanos1+ i-che sono presenti nelle gonadi migrano nella regione in cui il manubrio viene perso in risposta al danno e partecipano alla rigenerazione del manubrio7. Questi risultati supportano l'idea che le cellule i-in Clytia si comportano anche come cellule staminali funzionali coinvolte nella morfogenesi e nella rigenerazione. Tuttavia, dato che le proprietà delle cellule i-differiscono tra animali rappresentativi di tipo polipo come Hydra e Hydractinia3, è possibile che le caratteristiche e le funzioni delle cellule staminali siano diversificate tra le specie di meduse. Inoltre, con l'eccezione di Clytia, le tecniche sperimentali sono state limitate per altre meduse, e la dinamica dettagliata delle cellule proliferative e delle cellule staminali è sconosciuta13.
La medusa idrozoica Cladonema pacificum è un organismo modello emergente che può essere conservato in un ambiente di laboratorio senza pompa dell'acqua o sistema di filtrazione. Il Cladonema medusa ha tentacoli ramificati, una caratteristica comune nella famiglia Cladonematidae, e un organo fotorecettore chiamato ocello sullo strato ectodermico vicino al bulbo14. Il processo di ramificazione dei tentacoli si verifica in un nuovo sito di ramificazione che appare lungo il lato adassiale del tentacolo. Nel corso del tempo, i tentacoli continuano ad allungarsi e ramificarsi, con i rami più vecchi spinti verso la punta15. Inoltre, i tentacoli Cladonema possono rigenerarsi entro pochi giorni dall'amputazione. Studi recenti hanno suggerito il ruolo delle cellule proliferanti e delle cellule staminali nella ramificazione e rigenerazione dei tentacoli in Cladonema16,17. Tuttavia, mentre l'ibridazione convenzionale in situ (ISH) è stata utilizzata per visualizzare l'espressione genica in Cladonema, a causa della sua bassa risoluzione, è attualmente difficile osservare in dettaglio la dinamica delle cellule staminali a livello cellulare.
Questo articolo descrive un metodo per visualizzare cellule staminali simili a Cladonema mediante FISH e co-colorazione con EdU, un marker di proliferazione cellulare18. Visualizziamo il pattern di espressione di Nanos1, un marcatore di cellule staminali 5,17, di FISH, che consente l'identificazione della distribuzione delle cellule staminali a livello di singola cellula. Inoltre, la co-colorazione dell'espressione di Nanos1 con l'etichettatura EdU consente di distinguere le cellule staminali che proliferano attivamente. Questo metodo per monitorare sia le cellule staminali che le cellule proliferative può essere applicato a una vasta gamma di aree di indagine, tra cui la ramificazione dei tentacoli, l'omeostasi dei tessuti e la rigenerazione degli organi in Cladonema, e un approccio simile può essere applicato ad altre specie di meduse.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-Mercaptoethanol&#160;</td>
			<td>Wako</td>
			<td>137-06862</td>
			<td></td>
		</tr>
		<tr>
			<td>3.1 mL transfer pipette</td>
			<td>Thermo Scientific</td>
			<td>233-20S</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-4-chloro-3-indolyl-&#946;-D-galactopyranoside (X-Gal)</td>
			<td>Wako</td>
			<td>029-15043</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-DIG-POD</td>
			<td>Roche</td>
			<td>11207733910</td>
			<td></td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-AAGAGACACAGTCATTATCAAGC 
			GA-3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-CGACGTGTCCAATTTTACGTGCT -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- AAAAGAGCAGCGGCCAGAAAGA 
			AGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- GCGGGTCGCATACTTGTTGGTA 
			CTGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye</td>
			<td>Invitrogen&#160;</td>
			<td>C10337</td>
			<td>EdU kit</td>
		</tr>
		<tr>
			<td>Coroline off</td>
			<td>GEX Co. ltd</td>
			<td>N/A</td>
			<td>chlorine neutralizer</td>
		</tr>
		<tr>
			<td>DIG Nucleic Acid Detection Kit Blocking Reagent</td>
			<td>Roche</td>
			<td>11175041910</td>
			<td>blocking buffer&#160;</td>
		</tr>
		<tr>
			<td>DIG RNA labeling mix&#160;</td>
			<td>Roche</td>
			<td>11277073910</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>Promega</td>
			<td>P117B</td>
			<td></td>
		</tr>
		<tr>
			<td>ECOS competent cell DH5&#945;</td>
			<td>NIPPON GENE</td>
			<td>316-06233</td>
			<td>competent cell</td>
		</tr>
		<tr>
			<td>Fast gene Gel/PCR Extraction kit</td>
			<td>Fast gene</td>
			<td>FG-91302</td>
			<td>gel extraction kit</td>
		</tr>
		<tr>
			<td>Fast gene plasmid mini kit</td>
			<td>Fast gene</td>
			<td>FG-90502</td>
			<td>plasmid miniprep</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Wako&#160;</td>
			<td>068-00426</td>
			<td></td>
		</tr>
		<tr>
			<td>Heparin sodium salt from porcine</td>
			<td>SIGMA-ALDRICH&#160;</td>
			<td>H3393-10KU</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl-&#946;-D(-)-thiogalactopyranoside (IPTG)</td>
			<td>Wako</td>
			<td>096-05143</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar</td>
			<td>Invitrogen</td>
			<td>22700-025</td>
			<td>agar plate</td>
		</tr>
		<tr>
			<td>LB Broth Base</td>
			<td>Invitrogen</td>
			<td>12780-052</td>
			<td>LB medium</td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Wako</td>
			<td>134-00495</td>
			<td></td>
		</tr>
		<tr>
			<td>mini Quick spin RNA columns</td>
			<td>Roche</td>
			<td>11814427001</td>
			<td>clean-up column</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Wako&#160;</td>
			<td>191-01665</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop OneC Microvolume UV-Vis Spectrophotometer with Wi-Fi</td>
			<td>Thermo Scientific</td>
			<td>ND-ONEC-W</td>
			<td>spectrophotometer</td>
		</tr>
		<tr>
			<td>Polyoxyethlene (20) Sorbitan Monolaurate (Tween-20)</td>
			<td>Wako&#160;</td>
			<td>166-21115</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerMasher 2</td>
			<td>nippi&#160;</td>
			<td>891300</td>
			<td>homogenizer</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Nacarai Tesque&#160;</td>
			<td>29442-14</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor</td>
			<td>TaKaRa</td>
			<td>2313A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen&#160;</td>
			<td>74004</td>
			<td>total RNA isolation kit</td>
		</tr>
		<tr>
			<td>RQ1 RNase-Free Dnase</td>
			<td>Promega</td>
			<td>M6101</td>
			<td></td>
		</tr>
		<tr>
			<td>Saline Sodium Citrate Buffer 20x powder (20x SSC)</td>
			<td>TaKaRa</td>
			<td>T9172</td>
			<td></td>
		</tr>
		<tr>
			<td>SEA LIFE</td>
			<td>Marin Tech</td>
			<td>N/A</td>
			<td>mixture of mineral salts</td>
		</tr>
		<tr>
			<td>T3 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>11031163001</td>
			<td></td>
		</tr>
		<tr>
			<td>T7 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>10881767001</td>
			<td></td>
		</tr>
		<tr>
			<td>TAITEC HB-100</td>
			<td>TAITEC</td>
			<td>0040534-000</td>
			<td>Hybridization incuvator</td>
		</tr>
		<tr>
			<td>TaKaRa Ex Taq&#160;</td>
			<td>TaKaRa</td>
			<td>RR001A</td>
			<td>Taq DNA polymerase</td>
		</tr>
		<tr>
			<td>TaKaRa PrimeScript 2 1st strand cDNA Synthesis Kit</td>
			<td>TaKaRa</td>
			<td>6210A</td>
			<td>cDNA synthesis kit</td>
		</tr>
		<tr>
			<td>Target Clone</td>
			<td>TOYOBO&#160;</td>
			<td>TAK101</td>
			<td>pTA2 Vector</td>
		</tr>
		<tr>
			<td>tRNA</td>
			<td>Roche</td>
			<td>10109541001</td>
			<td></td>
		</tr>
		<tr>
			<td>TSA Plus Cyanine 5</td>
			<td>AKOYA Biosciences</td>
			<td>NEL745001KT</td>
			<td>tyramide signal amplification (TSA) technique</td>
		</tr>
		<tr>
			<td>Zeiss LSM 880</td>
			<td>ZEISS</td>
			<td>N/A</td>
			<td>laser scanning confocal microscope</td>
		</tr>
	</tbody>
</table>

fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum

Gli cnidiari, tra cui anemoni di mare, coralli e meduse, mostrano morfologie e stili di vita diversi che si manifestano in polipi sessili e meduse che nuotano liberamente. Come esemplificato in modelli consolidati come Hydra e Nematostella, le cellule staminali e/o le cellule proliferative contribuiscono allo sviluppo e alla rigenerazione dei polipi cnidariani. Tuttavia, i meccanismi cellulari sottostanti nella maggior parte delle meduse, in particolare allo stadio di medusa, sono in gran parte poco chiari e, quindi, lo sviluppo di un metodo robusto per identificare specifici tipi di cellule è fondamentale. Questo articolo descrive un protocollo per visualizzare le cellule proliferanti simili a staminali nella medusa idrozoica Cladonema pacificum. Cladonema medusae possiede tentacoli ramificati che crescono continuamente e mantengono la capacità rigenerativa durante la loro fase adulta, fornendo una piattaforma unica con cui studiare i meccanismi cellulari orchestrati da cellule proliferanti e / o staminali. L'ibridazione fluorescente in situ a montaggio intero (FISH) che utilizza un marcatore di cellule staminali consente la rilevazione di cellule staminali, mentre la marcatura a impulsi con 5-etinil-2'-deossiuridina (EdU), un marcatore di fase S, consente l'identificazione delle cellule proliferanti. Combinando sia l'etichettatura FISH che EdU, possiamo rilevare cellule staminali che proliferano attivamente su animali fissi e questa tecnica può essere ampiamente applicata ad altri animali, comprese le specie di meduse non modello.

I tentacoli Cladonema sono stati usati come modello per studiare i processi cellulari di morfogenesi e rigenerazione15,16,17. La struttura del tentacolo è composta da un tubo epiteliale in cui le cellule staminali, o i-cellule, si trovano nella regione prossimale, chiamata bulbo tentacolare, e nuovi rami vengono aggiunti sequenzialmente alla parte posteriore della regione distale del bulbo lungo il lato assiale (<stron...

Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Qui, descriviamo un protocollo per visualizzare le cellule proliferanti simili a staminali nella medusa Cladonema. L'ibridazione fluorescente in situ a montaggio intero con un marcatore di cellule staminali consente il rilevamento di cellule staminali e la marcatura con 5-etinil-2'-deossiuridina consente l'identificazione delle cellule proliferanti. Insieme, possono essere rilevate cellule staminali che proliferano attivamente.

Ibridazione fluorescente in situ e marcatura di 5-etinil-2'-deossiuridina per cellule staminali nella medusa idrozoica Cladonema pacificum

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and ...

La co-colorazione dell'espressione di Nanos1 con l'etichettatura EdU consente di distinguere le cellule staminali che proliferano attivamente. Possiamo identificare la distribuzione delle cellule staminali a livello di singola cellula nella medusa Cladonema. Possiamo visualizzare cellule staminali e cellule proliferanti nello stesso campione di meduse, che consente la rilevazione di cellule staminali proliferanti e non proliferanti, portando alla comprensione dell'eterogeneità delle cellule staminali.Studi di biologia dello sviluppo e rigenerazione utilizzando modelli animali che includono cellule staminali. La medusa idrozoica Cladonema pacificum è un organismo modello emergente che può essere tenuto in un ambiente di laboratorio senza alcun sistema specializzato. Cladonema medusae hanno tentacoli ramificati.La ramificazione si verifica in un nuovo sito lungo il lato adassiale del tentacolo. Nel corso del tempo, i tentacoli continuano ad allungarsi e ramificarsi, con i rami più vecchi spinti verso la punta. I tentacoli possono anche rigenerarsi entro pochi giorni dall'amputazione.Le piccole dimensioni, la facilità d'uso e la presenza di cellule staminali adulte o cellule staminali rendono Cladonema un buon sistema per studiare il ruolo delle cellule staminali in diversi processi. Per iniziare, posizionare Cladonema medusae in tubi da 1,5 millilitri utilizzando una pipetta di trasferimento da 3,5 millilitri e aggiungere ASW fino a un volume totale di 500 microlitri. Aggiungere 7,5 microlitri di soluzione madre EdU da 10 millimolari e incubare i campioni per un'ora a 22 gradi Celsius.Attendere un'ora e rimuovere il più possibile ASW contenente EdU. Dopo aver anestetizzato le meduse, incubare per cinque minuti. Fissare le meduse durante la notte a quattro gradi Celsius con il 4% di paraformaldeide in ASW.Per il trattamento con proteinasi e post-fissazione, rimuovere la paraformaldeide e lavare i campioni con PBS contenente 0,1% Tween 20 tre volte per 10 minuti ciascuno. Rimuovere il PBST e aggiungere il buffer di ibridazione. Incubare i campioni nel tampone di ibridazione per 15 minuti a temperatura ambiente.Rimuovere il buffer di ibridazione e aggiungere il nuovo buffer di ibridazione. Pre-ibridare a 55 gradi Celsius per almeno due ore in un incubatore di ibridazione. Rimuovere il buffer di ibridazione e incubare con il buffer di ibridazione contenente le sonde.Ibridare a 55 gradi Celsius per 18-24 ore in un incubatore di ibridazione. Quindi, procedere con la rimozione della sonda. Iniziare rimuovendo il buffer di ibridazione contenente le sonde e quindi aggiungere il buffer di lavaggio.Lavare i campioni con tampone di lavaggio due volte per 15 minuti a 55 gradi Celsius. Rimuovere il tampone di lavaggio uno e aggiungere il tampone di lavaggio due. Lavare i campioni con tampone di lavaggio due volte per 15 minuti a 55 gradi Celsius.Rimuovere il tampone di lavaggio due e quindi aggiungere 2X SSC. Lavare i campioni con 2X SSC due volte per 15 minuti a 55 gradi Celsius. Rimuovere 2X SSC e quindi aggiungere PBST preriscaldato.Lavare i campioni per 15 minuti con PBST a temperatura ambiente. Per l'incubazione di anticorpi anti-DIG, iniziare rimuovendo PBST e quindi aggiungere l'1% di tampone di blocco. Incubare i campioni per almeno un'ora a temperatura ambiente agitando lentamente su un bilanciere.Dopo il blocco, rimuovere il buffer di blocco dell'1%. Aggiungere la soluzione anti-DIG-POD e incubare i campioni durante la notte a quattro gradi Celsius. Per rilevare la sonda marcata DIG, rimuovere la soluzione anti-DIG-POD e aggiungere il tampone Tween tris cloruro di sodio.Lavare i campioni con tampone tris sodium chloride Tween tre volte per 10 minuti a temperatura ambiente. Diluire la soluzione madre di tiramide coniugata con colorante fluorescente nel tampone diluente di amplificazione per ottenere la soluzione attiva di tiramide Cy5. Rimuovere il più possibile il tampone tris cloruro di sodio Tween e quindi aggiungere la soluzione attiva di tiramide Cy5.Incubare i campioni per 10 minuti al buio. Lavare i campioni con PBST tre volte per 10 minuti al buio. Per preparare il cocktail di rilevamento EdU, mescolare i componenti.Rimuovere PBST e quindi aggiungere il cocktail di rilevamento EdU. Incubare il campione al buio per 30 minuti. Lavare con PBST tre volte per 10 minuti al buio.Per la colorazione del DNA, diluire Hoechst in PBST per preparare la soluzione di Hoechst. Rimuovere il PBST e aggiungere la soluzione di Hoechst. Incubare i campioni per 30 minuti al buio.Lavare i campioni con PBST tre o quattro volte per 10 minuti al buio. Successivamente per il montaggio, trasferire le meduse sulla banca sul vetro da vetrino usando una pipetta di trasferimento con la punta tagliata. Posizionare delicatamente una copertina sulle meduse con una pinza e sigillare il lato della copertina con smalto trasparente.La co-etichettatura dell'espressione di Nanos1 e delle cellule EdU positive ha rivelato il modello spaziale delle cellule staminali e delle cellule proliferative nel tentacolo. Le cellule EdU positive erano più ampiamente distribuite in tutto il bulbo tentacolare, mentre le cellule Nanos1 positive si sono accumulate più localmente nel bulbo tentacolare e nel nuovo sito di ramificazione, suggeriscono che vengono rilevate distribuzioni distinte di cellule staminali e cellule proliferanti a seconda dei tempi di sviluppo e delle diverse fasi. La co-etichettatura di EdU e Nanos1 è stata osservata nel 19,79% delle cellule, suggerendo che queste cellule sono una popolazione di cellule staminali attivamente proliferante.Curiosamente, il 14,46% delle cellule è risultato essere Nanos1 positivo EdU negativo nel mezzo del bulbo e nel nuovo sito di ramificazione, suggerendo la presenza di cellule proliferative non staminali. Al contrario, il 26,32% delle cellule è stato osservato come Nanos1 EdU negativo positivo alla base del bulbo e nel nuovo sito di ramificazione, indicando la presenza di una popolazione di cellule staminali che è a ciclo lento o quiescente, nessuna delle quali viene rilevata dalla marcatura a impulsi EdU. La marcatura a impulsi EdU con breve tempo di incubazione consente di rilevare solo cellule proliferative tra cellule staminali e cellule non staminali.Quando si cambia il tempo di incubazione per EdU e si combinano esperimenti di inseguimento a lungo termine, è possibile contrassegnare cellule staminali a ciclo lento o altri tipi di cellule, tra cui la progenie e le cellule differenziate.

fluorescent-situ-hybridization-5-ethynyl-2-deoxyuridine-labeling-for

Research

JoVE Journal

Developmental Biology

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development. The Xenopuslaevis embryo is very useful for studying organogenesis because their large size makes them very suitable for identifying organs at the earliest steps in organogenesis. At this time, the primary method used for identifying a specific organ or primordium is whole mount in situ hybridization with labeled antisense RNA probes specific to a gene that is expressed in the organ of interest. In addition, it is relatively easy to manipulate genes or signaling pathways in Xenopus and in situ hybridization allows one to then assay for changes in the presence or morphology of a target organ. Whole mount in situ hybridization is a multi-day protocol with many steps involved. Here we provide a simplified protocol with reduced numbers of steps and reagents used that works well for routine assays. In situ hybridization robots have greatly facilitated the process and we detail how and when we utilize that technology in the process. Once an in situ hybridization is complete, capturing the best image of the result can be frustrating. We provide advice on how to optimize imaging of in situ hybridization results. Although the protocol describes assessing organogenesis in Xenopus laevis, the same basic protocol can almost certainly be adapted to Xenopus tropicalis and other model systems.

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

The Xenopus laevis embryo continues to be exceptionally useful in the study of early development due to its large size and ease of manipulation. A simplified protocol for whole mount in situ hybridization protocol is provided that can be used in the identification of specific organs in this model system.

Capire in anticipo Organogenesis Utilizzando una semplificata<em&gt; In Situ</em&gt; Protocollo di ibridazione in<em&gt; Xenopus</em

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development.  The Xenopuslaevis embryo ...

Ricerca

Biologia dello sviluppo

Application of the DNA-Specific Stain Methyl Green in the Fluorescent Labeling of Embryos

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored until recently. In this article, we illustrate the method for preparing a methyl green aqueous stock solution, that when diluted can be used as a very convenient fluorescent nuclear label for fixed cells and tissues. Easy procedures to label whole zebrafish and chick embryos are detailed, and examples of images obtained shown. Methyl green is maximally excited by red light, at 633 nm, and emits with a relatively sharp spectrum that peaks at 677 nm. It is very inexpensive, non-toxic, highly stable in solution and very resistant to photobleaching when bound to DNA. Its red emission allows for unaltered high resolution scanning confocal imaging of nuclei in thick specimens. Finally, this methyl green staining protocol is compatible with other cell staining procedures, such as antibody labeling, or actin filaments labeling with fluorophore-conjugated phalloidin.

A method for fluorescent staining of fixed biological material with the specific DNA label methyl green is described. Methyl green is used in a diluted aqueous solution and is very resistant to photobleaching. Its far-red emission allows for deep specimen imaging, making it particularly adequate for whole embryos.

Applicazione del DNA-Specific Stain metile Verde al Fluorescent Etichettatura degli embrioni

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored ...

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are expressed in spatial relation to each other in situ. Multi-target chromogenic whole-mount in situ hybridization (MC-WISH) greatly facilitates the instant comparison of gene expression patterns, as it allows distinctive visualization of different mRNA species in contrasting colors in the same sample specimen. This provides the possibility to relate gene expression domains topographically to each other with high accuracy and to define unique and overlapping expression sites. In the presented protocol, we describe a MC-WISH procedure for comparing mRNA expression patterns of different genes in Drosophila embryos. Up to three RNA probes, each specific for another gene and labeled by a different hapten, are simultaneously hybridized to the embryo samples and subsequently detected by alkaline phosphatase-based colorimetric immunohistochemistry. The described procedure is detailed here for Drosophila, but works equally well with zebrafish embryos.

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

We describe a multi-target chromogenic whole-mount in situ hybridization (MC-WISH) procedure in intact Drosophila embryos allowing simultaneous and specific detection of three different mRNA distribution patterns by contrasting color precipitates.

Multi-bersaglio Cromogenico Whole-mount<em&gt; In Situ</em&gt; Ibridazione per il confronto Gene domini di espressione in<em&gt; Drosophila</em&gt; Embrioni

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

Dissezione e macchiatura immunofluorescente del corpo di fungo e del fotoricettore neuroni nel cervello adulto Drosophila melanogaster

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and optical transparency. In particular, the zebrafish embryo has become an important organism to study vertebrate kidney organogenesis as well as multiciliated cell (MCC) development. To visualize MCCs in the embryonic zebrafish kidney, we have developed a combined protocol of whole-mount fluorescent in situ hybridization (FISH) and whole mount immunofluorescence (IF) that enables high resolution imaging. This manuscript describes our technique for co-localizing RNA transcripts and protein as a tool to better understand the regulation of developmental programs through the expression of various lineage factors.

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

Cilia development is vital to proper organogenesis. This protocol describes an optimized method to label and visualize ciliated cells of the zebrafish.

Visualizzazione di cellule Multiciliated in Zebrafish attraverso un protocollo combinato di tutta Monte fluorescente ibridazione In Situ e immunofluorescenza

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and ...

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain and protect cellular identities. The conversion of germ cells into specific neurons in the nematode Caenorhabditis elegans (C. elegans) is a powerful tool for performing genetic screens in order to dissect regulatory pathways that safeguard established cell identities. Reprogramming of germ cells to a specific type of neurons termed ASE requires transgenic animals that allow broad over-expression of the Zn-finger transcription factor (TF) CHE-1. Endogenous CHE-1 is expressed exclusively in two head neurons and is required to specify the glutamatergic ASE neurons fate, which can easily be visualized by the gcy-5prom::gfp reporter. A trans gene containing the heat-shock promoter-driven che-1 gene expression construct allows broad mis-expression of CHE-1 in the entire animal upon heat-shock treatment. The combination of RNAi against the chromatin-regulating factor LIN-53 and heat-shock-induced che-1 over-expression leads to reprogramming of germ cell into ASE neuron-like cells. We describe here the specific RNAi procedure and appropriate conditions for heat-shock treatment of transgenic animals in order to successfully induce germ cell to neuron conversion.

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

This protocol describes how to study cellular processes during cell fate conversion in Caenorhabditis elegans in vivo. Using transgenic animals, allowing heat-shock promoter-driven overexpression of the neuron fate-inducing transcription factor CHE-1 and RNAi-mediated depletion of the chromatin-regulating factor LIN-53 germ cell to neuron reprogramming can be observed in vivo.

Applicazione di RNAi ed espressione di fattore di trascrizione indotta da calore-shock per riprogrammare le cellule germinali ai neuroni in c. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain ...

Wholemount In Situ Hybridization for Astyanax Embryos

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of genes. Prior research into this emerging model system capitalized on comprehensive genome-wide investigations that have identified numerous quantitative trait loci (QTL) associated with various cave-associated phenotypes. However, the ability to connect genes of interest to the heritable basis for phenotypic change remains a significant challenge. One technique that can facilitate deeper understanding of the role of development in troglomorphic evolution is whole-mount in situ hybridization. This technique can be implemented to directly compare gene expression between cave- and surface-dwelling forms, nominate candidate genes underlying established QTL, identify genes of interest from next-generation sequencing studies, or develop other discovery-based approaches. In this report, we present a simple protocol, supported by a flexible checklist, that can be widely adapted for use well beyond the presented study system. It is hoped that this protocol can serve as a broad resource for the Astyanax community and beyond.

Wholemount In Situ Hybridization for Astyanax Embryos

This protocol enables visualization of gene expression in embryonic Astyanax cavefish. This approach has been developed with the goal of maximizing gene expression signal, while minimizing non-specific background staining.

Wholemount ibridazione In Situ per gli embrioni Astyanax

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

Generazione in Vitro di Somite derivati da umani indotta da cellule staminali pluripotenti indotte

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Genotyping and Quantification of In Situ Hybridization Staining in Zebrafish

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in developmental biology for decades. Traditionally, most gene expression studies relied on visual evaluation of the ISH signal, a method that is prone to bias, particularly in cases where sample identities are known a priori. We have previously reported on a method to circumvent this bias and provide a more accurate quantification of ISH signals. Here, we present a simple guide to apply this method to quantify the expression levels of genes of interest in ISH-stained embryos and correlate that with their corresponding genotypes. The method is particularly useful to quantify spatially restricted gene expression signals in samples of mixed genotypes and it provides an unbiased and accurate alternative to the traditional visual scoring methods.

Gene editing technologies have enabled researchers to generate zebrafish mutants to investigate gene function with relative ease. Here, we provide a guide to perform parallel embryo genotyping and quantification of in situ hybridization signals in zebrafish. This unbiased approach provides greater accuracy in phenotypical analyses based on in situ hybridization.

Genotipizzazione e quantificazione della colorazione dell'ibridazione in situ nel pesce zebra

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in ...

Whole-Mount In Situ Hybridization in Zebrafish Embryos and Tube Formation Assay in iPSC-ECs to Study the Role of Endoglin in Vascular Development

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in zebrafish during different developmental stages. To investigate the role of endoglin(eng) in vessel formation during the development of hereditary hemorrhagic telangiectasia&#160;(HHT), morpholino-mediated targeted knockdown of eng in zebrafish are used to study its temporal expression and associated functions. Here, whole-mount in situ RNA hybridization (WISH) is employed for the analysis of eng and its downstream genes in zebrafish embryos. Also, tube formation assays are performed in HHT patient-derived induced pluripotent stem cell-differentiated&#160;endothelial cells (iPSC-ECs; with eng mutations). A specific signal amplifying system using the whole amount In Situ Hybridization &#8211; WISH provides higher resolution and lower background results compared to traditional methods. To obtain a better signal, the post-fixation time is adjusted to 30 min after probe hybridization. Because fluorescence staining is not sensitive in zebrafish embryos, it is replaced with diaminobezidine (DAB) staining here. In this protocol, HHT&#160;patient-derived iPSC lines containing an eng mutation are differentiated into endothelial cells. After coating a plate with basement membrane matrix for 30 min at 37 &#176;C, iPSC-ECs are seeded as a monolayer into wells and kept at 37 &#176;C for 3 h. Then, the tube length and number of branches are calculated using microscopic images. Thus, with this improved WISH protocol, it is shown that reduced eng expression affects endothelial progenitor formation in zebrafish embryos. This is further confirmed by tube formation assays using iPSC-ECs derived from a patient with HHT. These assays confirm the role for eng in early vascular development.

Presented here is a protocol for whole-mount in situ RNA hybridization analysis in zebrafish and tube formation assay in patient-derived induced pluripotent stem cell-derived endothelial cells to study the role of endoglin in vascular formation.

Ibridazione dell'intero Monte In Situ negli embrioni di pesce zebra e nella formazione dei tubi, analisi dei prodotti iPSC-EC per studiare il ruolo dell'endoglin nello sviluppo vascolare

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in ...