Name: fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum
Uploaded: 2022-08-03T15:00:00
Description: Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

이 작업은 AMED가 보조금 번호 JP22gm6110025(Y.N.에게)와 JSPS KAKENHI 보조금 번호 22H02762(Y.N.에게)에 의해 지원되었습니다.

알림: 이 프로토콜에 사용되는 모든 재료, 시약 및 장비와 관련된 자세한 내용은 재료 표를 참조하십시오.
1. 프로브 합성
<ol><li>RNA 추출<ol><li>인공 해수(ASW)에서 배양된 살아있는 클라도네마 메두사 3개를 팁이 잘린 상태에서 3.1mL 전달 피펫을 사용하여 1.5mL 튜브에 넣고 가능한 한 많은 ASW를 제거합니다. 알림: ASW는 수돗물에 미네랄 염의 혼?...

<ol>
	<li>Lecl&#232;re, L., R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+cnidarian+muscles:+Function,+anatomy,+development+and+regeneration.">Diversity of cnidarian muscles: Function, anatomy, development and regeneration.</a> Frontiers in Cell and Developmental Biology. 4, 157 (2017).</li><li>Bosch, T. C. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Back+to+the+basics:+Cnidarians+start+to+fire.">Back to the basics: Cnidarians start to fire.</a> Trends in Neurosciences. 40 (2), 92-105 (2017).</li><li>Gold, D. A., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+dynamics+in+Cnidaria:+Are+there+unifying+principles.">Stem cell dynamics in Cnidaria: Are there unifying principles.</a> Development Genes and Evolution. 223 (1-2), 53-66 (2013).</li><li>Technau, U., Steele, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+crossroads+in+developmental+biology:+Cnidaria.">Evolutionary crossroads in developmental biology: Cnidaria.</a> Development. 138 (8), 1447-1458 (2011).</li><li>Lecl&#232;re, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternally+localized+germ+plasm+mRNAs+and+germ+cell/stem+cell+formation+in+the+cnidarian+Clytia.">Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the cnidarian Clytia.</a> Developmental Biology. 364 (2), 236-248 (2012).</li><li>Bradshaw, B., Thompson, K., Frank, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+mechanisms+underlie+oral+vs+aboral+regeneration+in+the+cnidarian+Hydractinia+echinata.">Distinct mechanisms underlie oral vs aboral regeneration in the cnidarian Hydractinia echinata.</a> eLife. 4, 05506 (2015).</li><li>Sinigaglia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pattern+regulation+in+a+regenerating+jellyfish.">Pattern regulation in a regenerating jellyfish.</a> eLife. 9, 54868 (2020).</li><li>David, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interstitial+stem+cells+in+Hydra:+Multipotency+and+decision-making.">Interstitial stem cells in Hydra: Multipotency and decision-making.</a> The International Journal of Developmental Biology. 56 (6-7-8), 489-497 (2012).</li><li>R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nematostella+vectensis,+an+emerging+model+for+deciphering+the+molecular+and+cellular+mechanisms+underlying+whole-body+regeneration.">Nematostella vectensis, an emerging model for deciphering the molecular and cellular mechanisms underlying whole-body regeneration.</a> Cells. 10 (10), 2692 (2021).</li><li>Houliston, E., Momose, T., Manuel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clytia+hemisphaerica:+A+jellyfish+cousin+joins+the+laboratory.">Clytia hemisphaerica: A jellyfish cousin joins the laboratory.</a> Trends in Genetics. 26 (4), 159-167 (2010).</li><li>Peron, S., Houliston, E., Lecl&#232;re, L., Boutet, A., Shierwater, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Marine+Jellyfish+Model,+Clytia+hemisphaerica.">The Marine Jellyfish Model, Clytia hemisphaerica.</a> Handbook of Marine Model Organisms in Experimental Biology. , 129-147 (2021).</li><li>Denker, E., Manuel, M., Lecl&#232;re, L., Le Guyader, H., Rabet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ordered+progression+of+nematogenesis+from+stem+cells+through+differentiation+stages+in+the+tentacle+bulb+of+Clytia+hemisphaerica+(Hydrozoa,+Cnidaria).">Ordered progression of nematogenesis from stem cells through differentiation stages in the tentacle bulb of Clytia hemisphaerica (Hydrozoa, Cnidaria).</a> Developmental Biology. 315 (1), 99-113 (2008).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regeneration+potential+of+jellyfish:+Cellular+mechanisms+and+molecular+insights.">Regeneration potential of jellyfish: Cellular mechanisms and molecular insights.</a> Genes. 12 (5), 758 (2021).</li><li>Suga, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flexibly+deployed+Pax+genes+in+eye+development+at+the+early+evolution+of+animals+demonstrated+by+studies+on+a+hydrozoan+jellyfish.">Flexibly deployed Pax genes in eye development at the early evolution of animals demonstrated by studies on a hydrozoan jellyfish.</a> Proceedings of the National Academy of Sciences. 107 (32), 14263-14268 (2010).</li><li>Fujiki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Branching+pattern+and+morphogenesis+of+medusa+tentacles+in+the+jellyfish+Cladonema+pacificum+(Hydrozoa,+Cnidaria).">Branching pattern and morphogenesis of medusa tentacles in the jellyfish Cladonema pacificum (Hydrozoa, Cnidaria).</a> Zoological Letters. 5 (12), 13 (2019).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+controls+body+size+growth,+tentacle+morphogenesis,+and+regeneration+in+hydrozoan+jellyfish+Cladonema+pacificum.">Cell proliferation controls body size growth, tentacle morphogenesis, and regeneration in hydrozoan jellyfish Cladonema pacificum.</a> PeerJ. 7, 7579 (2019).</li><li>Hou, S., Zhu, J., Shibata, S., Nakamoto, A., Kumano, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repetitive+accumulation+of+interstitial+cells+generates+the+branched+structure+of+Cladonema+medusa+tentacles.">Repetitive accumulation of interstitial cells generates the branched structure of Cladonema medusa tentacles.</a> Development. 148 (23), (2021).</li><li>Salic, A., Mitchison, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+method+for+fast+and+sensitive+detection+of+DNA+synthesis+in+vivo.">A chemical method for fast and sensitive detection of DNA synthesis in vivo.</a> Proceedings of the National Academy of Sciences of the United States of America. 105 (7), 2415-2420 (2008).</li><li>Angerer, L. M., Angerer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+poly+A+++RNA+in+sea+urchin+eggs+and+embryos+by+quantitative+in+situ+hybridization.">Detection of poly A + RNA in sea urchin eggs and embryos by quantitative in situ hybridization.</a> Nucleic Acids Research. 9 (12), 2819-2840 (1981).</li><li>Rakotomamonjy, J., Guemez-Gamboa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purkinje+cell+survival+in+organotypic+cerebellar+slice+cultures.">Purkinje cell survival in organotypic cerebellar slice cultures.</a> Journal of Visualized Experiments. (154), e60353 (2019).</li><li>Tanaka, E. M., Reddien, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+basis+for+animal+regeneration.">The cellular basis for animal regeneration.</a> Developmental Cell. 21 (1), 172-185 (2011).</li><li>Penzo-M&#233;ndez, A. I., Stanger, B. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ-size+regulation+in+mammals.">Organ-size regulation in mammals.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), 019240 (2015).</li><li>Sinigaglia, C., Thiel, D., Hejnol, A., Houliston, E., Lecl&#232;re, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+safer,+urea-based+in+situ+hybridization+method+improves+detection+of+gene+expression+in+diverse+animal+species.">A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species.</a> Developmental Biology. 434 (1), 15-23 (2018).</li><li>King, R. S., Newmark, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+protocol+for+enhanced+detection+of+gene+expression+in+the+planarian+Schmidtea+mediterranea.">In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea.</a> BMC Developmental Biology. 13 (1), 8 (2013).</li><li>Flici, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+evolutionarily+conserved+SoxB-Hdac2+crosstalk+regulates+neurogenesis+in+a+cnidarian.">An evolutionarily conserved SoxB-Hdac2 crosstalk regulates neurogenesis in a cnidarian.</a> Cell Reports. 18 (6), 1395-1409 (2017).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axial+Hox+code+controls+tissue+segmentation+and+body+patterning+in+Nematostella+vectensis.">An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.</a> Science. 361 (6409), 1377-1380 (2018).</li><li>Govindasamy, N., Murthy, S., Ghanekar, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Slow-cycling+stem+cells+in+hydra+contribute+to+head+regeneration.">Slow-cycling stem cells in hydra contribute to head regeneration.</a> Biology Open. 3 (12), 1236-1244 (2014).</li><li>Passamaneck, Y. J., Martindale, M. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+is+necessary+for+the+regeneration+of+oral+structures+in+the+anthozoan+cnidarian+Nematostella+vectensis.">Cell proliferation is necessary for the regeneration of oral structures in the anthozoan cnidarian Nematostella vectensis.</a> BMC Developmental Biology. 12 (1), 34 (2012).</li><li>Gold, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+developmental+disparity+in+the+tentacles+of+the+moon+jellyfish+Aurelia+sp.1.">Structural and developmental disparity in the tentacles of the moon jellyfish Aurelia sp.1.</a> PLoS One. 10 (8), 0134741 (2015).</li><li>Gold, D. A., Nakanishi, N., Hensley, N. M., Hartenstein, V., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+tracking+supports+secondary+gastrulation+in+the+moon+jellyfish+Aurelia.">Cell tracking supports secondary gastrulation in the moon jellyfish Aurelia.</a> Development Genes and Evolution. 226 (6), 383-387 (2016).</li><li>Cheng, L. -. C., Alvarado, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-mount+BrdU+staining+with+fluorescence+in+situ+hybridization+in+planarians.">Whole-mount BrdU staining with fluorescence in situ hybridization in planarians.</a> Planarian Regeneration. 1774, 423-434 (2018).</li></ol>

증식 세포와 줄기 세포는 형태 형성, 성장 및 재생과 같은 다양한 과정에서 중요한 세포 공급원입니다21,22. 이 논문은 Cladonema medusae에서 FISH 및 EdU 표지에 의해 줄기 세포 마커 Nanos1을 공동 염색하는 방법을 설명합니다. EdU 또는 BrdU 표지를 사용한 이전 연구는 증식 세포가 촉수 전구16,17에 국한된?...

Cnidaria는 신경과 근육을 가진 동물을 포함하는 기저 분기 후생 동물 문으로 간주되어 동물 발달 및 생리학 1,2의 진화를 이해할 수있는 독특한 위치에 배치합니다. Cnidarians는 두 가지 주요 그룹으로 분류됩니다 : Anthozoa (예 : 말미잘 및 산호)는 평면 유충과 고착 폴립 단계 만 가지고있는 반면, Medusozoa (Hydrozoa, Staurozoa, Scyphozoa 및 Cubozoa의 구성원)는 일반적으로 자유 수영 메두사 또는 해파리뿐만 아니라 평면 유충 및 폴립의 형태를 취합니다. Cnidarians는 일반적으로 높은 재생 능력을 나타내며, 기본 세포 메커니즘, 특히 성체 줄기 세포와 증식 세포의 소유는 많은 관심을 끌었습니다 3,4. Hydra에서 처음 확인 된 수중 동물 줄기 세포는 외배엽 상피 세포 사이의 간질 공간에 위치하며 일반적으로 간질 세포 또는 i- 세포3라고합니다.
Hydrozoan i- 세포는 다 효능, 널리 보존 된 줄기 세포 마커 (예 : Nanos, Piwi, Vasa)의 발현 및 이동 잠재력 3,5,6,7,8을 포함하는 공통 특성을 공유합니다. 기능성 줄기 세포로서 i- 세포는 수생 동물의 발달, 생리학 및 환경 반응에 광범위하게 관여하며, 이는 높은 재생 능력과 가소성을 입증합니다3. i- 세포와 유사한 줄기 세포는 수생 동물 외부에서 확인되지 않았지만 확립 된 모델 종 인 Nematostella에서도 증식 세포는 여전히 체세포 및 생식 계통9의 유지 및 재생에 관여합니다. 자포동물 발달 및 재생에 대한 연구가 주로 히드라, 히드라티니아, 네마토스텔라와 같은 폴립형 동물에 대해 수행되었기 때문에 해파리 종에서 줄기세포의 세포 역학과 기능은 크게 다루어지지 않은 상태로 남아 있습니다.
지중해와 북미를 포함한 전 세계의 다양한 서식지를 가진 국제적인 해파리 종인 수중동물 해파리 Clytia hemisphaerica 는 여러 발달 및 진화 연구에서 실험 모델 동물로 활용되었습니다10. 작은 크기, 쉬운 취급 및 큰 알을 갖춘 Clytia 는 실험실 유지 관리뿐만 아니라 최근에 확립 된 형질 전환 및 녹아웃 방법11과 같은 유전 도구의 도입에 적합하여 해파리 생물학의 기초가되는 세포 및 분자 메커니즘에 대한 자세한 분석 기회를 열어줍니다. Clytia medusa 촉수에서 i- 세포는 전구라고하는 근위 영역에 국한되며, 선충 세포와 같은 전구 세포는 선충 세포12를 포함한 별개의 세포 유형으로 분화하면서 말단부로 이동합니다.
해파리의 구강 기관인 Clytia manubrium을 재생하는 동안 생식선에 존재하는 Nanos1+ i-세포는 손상에 반응하여 제조소가 손실되는 영역으로 이동하여 제조7의 재생에 참여합니다. 이러한 발견은 Clytia의 i- 세포가 형태 형성 및 재생에 관여하는 기능적 줄기 세포로도 작용한다는 아이디어를 뒷받침합니다. 그러나 i-세포의 성질이 히드라(Hydra)와 히드라티니아(Hydractinia)3와 같은 대표적인 폴립형 동물마다 다르다는 점을 감안할 때, 줄기세포의 특성과 기능은 해파리 종에 따라 다양화될 가능성이 있다. 또한 Clytia를 제외하고 다른 해파리에 대한 실험 기술은 제한적이며 증식 세포와 줄기 세포의 상세한 역학은 알려져 있지 않습니다13.
수중 동물 해파리 Cladonema pacificum은 워터 펌프 나 여과 시스템없이 실험실 환경에 보관할 수있는 새로운 모델 유기체입니다. Cladonema medusa는 Cladonematidae 가족의 일반적인 특징 인 분지 촉수와 전구14 근처의 외배엽 층에 ocellus라고하는 광 수용체 기관을 가지고 있습니다. 촉수 분기 과정은 촉수의 축 방향 측면을 따라 나타나는 새로운 분기 부위에서 발생합니다. 시간이 지남에 따라 촉수는 계속 늘어나고 가지가 갈라지며 오래된 가지는 끝15쪽으로 밀려납니다. 또한 Cladonema 촉수는 절단 후 며칠 이내에 재생될 수 있습니다. 최근 연구는 Cladonema16,17에서 촉수 분기 및 재생에서 증식하는 세포와 줄기 유사 세포의 역할을 제안했습니다. 그러나 기존의 현장 혼성화(ISH)는 Cladonema에서 유전자 발현을 시각화하는 데 활용되었지만 해상도가 낮기 때문에 현재 세포 수준에서 줄기 세포 역학을 자세히 관찰하기가 어렵습니다.
이 논문은 FISH에 의해 Cladonema에서 줄기 유사 세포를 시각화하고 세포 증식 마커 인 EdU와 공동 염색하는 방법을 설명합니다18. 우리는 FISH에 의해 줄기 세포 마커 인 Nanos1,17의 발현 패턴을 시각화하여 단일 세포 수준에서 줄기 유사 세포 분포를 식별 할 수 있습니다. 또한, Nanos1 발현과 EdU 표지의 동시 염색은 활발하게 증식하는 줄기 유사 세포를 구별하는 것을 가능하게 한다. 줄기 유사 세포와 증식 세포를 모두 모니터링하기 위한 이 방법은 Cladonema의 촉수 분지, 조직 항상성 및 장기 재생을 포함한 광범위한 조사 영역에 적용될 수 있으며 유사한 접근 방식을 다른 해파리 종에도 적용할 수 있습니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-Mercaptoethanol&#160;</td>
			<td>Wako</td>
			<td>137-06862</td>
			<td></td>
		</tr>
		<tr>
			<td>3.1 mL transfer pipette</td>
			<td>Thermo Scientific</td>
			<td>233-20S</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-4-chloro-3-indolyl-&#946;-D-galactopyranoside (X-Gal)</td>
			<td>Wako</td>
			<td>029-15043</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-DIG-POD</td>
			<td>Roche</td>
			<td>11207733910</td>
			<td></td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-AAGAGACACAGTCATTATCAAGC 
			GA-3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-CGACGTGTCCAATTTTACGTGCT -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- AAAAGAGCAGCGGCCAGAAAGA 
			AGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- GCGGGTCGCATACTTGTTGGTA 
			CTGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye</td>
			<td>Invitrogen&#160;</td>
			<td>C10337</td>
			<td>EdU kit</td>
		</tr>
		<tr>
			<td>Coroline off</td>
			<td>GEX Co. ltd</td>
			<td>N/A</td>
			<td>chlorine neutralizer</td>
		</tr>
		<tr>
			<td>DIG Nucleic Acid Detection Kit Blocking Reagent</td>
			<td>Roche</td>
			<td>11175041910</td>
			<td>blocking buffer&#160;</td>
		</tr>
		<tr>
			<td>DIG RNA labeling mix&#160;</td>
			<td>Roche</td>
			<td>11277073910</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>Promega</td>
			<td>P117B</td>
			<td></td>
		</tr>
		<tr>
			<td>ECOS competent cell DH5&#945;</td>
			<td>NIPPON GENE</td>
			<td>316-06233</td>
			<td>competent cell</td>
		</tr>
		<tr>
			<td>Fast gene Gel/PCR Extraction kit</td>
			<td>Fast gene</td>
			<td>FG-91302</td>
			<td>gel extraction kit</td>
		</tr>
		<tr>
			<td>Fast gene plasmid mini kit</td>
			<td>Fast gene</td>
			<td>FG-90502</td>
			<td>plasmid miniprep</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Wako&#160;</td>
			<td>068-00426</td>
			<td></td>
		</tr>
		<tr>
			<td>Heparin sodium salt from porcine</td>
			<td>SIGMA-ALDRICH&#160;</td>
			<td>H3393-10KU</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl-&#946;-D(-)-thiogalactopyranoside (IPTG)</td>
			<td>Wako</td>
			<td>096-05143</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar</td>
			<td>Invitrogen</td>
			<td>22700-025</td>
			<td>agar plate</td>
		</tr>
		<tr>
			<td>LB Broth Base</td>
			<td>Invitrogen</td>
			<td>12780-052</td>
			<td>LB medium</td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Wako</td>
			<td>134-00495</td>
			<td></td>
		</tr>
		<tr>
			<td>mini Quick spin RNA columns</td>
			<td>Roche</td>
			<td>11814427001</td>
			<td>clean-up column</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Wako&#160;</td>
			<td>191-01665</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop OneC Microvolume UV-Vis Spectrophotometer with Wi-Fi</td>
			<td>Thermo Scientific</td>
			<td>ND-ONEC-W</td>
			<td>spectrophotometer</td>
		</tr>
		<tr>
			<td>Polyoxyethlene (20) Sorbitan Monolaurate (Tween-20)</td>
			<td>Wako&#160;</td>
			<td>166-21115</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerMasher 2</td>
			<td>nippi&#160;</td>
			<td>891300</td>
			<td>homogenizer</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Nacarai Tesque&#160;</td>
			<td>29442-14</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor</td>
			<td>TaKaRa</td>
			<td>2313A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen&#160;</td>
			<td>74004</td>
			<td>total RNA isolation kit</td>
		</tr>
		<tr>
			<td>RQ1 RNase-Free Dnase</td>
			<td>Promega</td>
			<td>M6101</td>
			<td></td>
		</tr>
		<tr>
			<td>Saline Sodium Citrate Buffer 20x powder (20x SSC)</td>
			<td>TaKaRa</td>
			<td>T9172</td>
			<td></td>
		</tr>
		<tr>
			<td>SEA LIFE</td>
			<td>Marin Tech</td>
			<td>N/A</td>
			<td>mixture of mineral salts</td>
		</tr>
		<tr>
			<td>T3 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>11031163001</td>
			<td></td>
		</tr>
		<tr>
			<td>T7 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>10881767001</td>
			<td></td>
		</tr>
		<tr>
			<td>TAITEC HB-100</td>
			<td>TAITEC</td>
			<td>0040534-000</td>
			<td>Hybridization incuvator</td>
		</tr>
		<tr>
			<td>TaKaRa Ex Taq&#160;</td>
			<td>TaKaRa</td>
			<td>RR001A</td>
			<td>Taq DNA polymerase</td>
		</tr>
		<tr>
			<td>TaKaRa PrimeScript 2 1st strand cDNA Synthesis Kit</td>
			<td>TaKaRa</td>
			<td>6210A</td>
			<td>cDNA synthesis kit</td>
		</tr>
		<tr>
			<td>Target Clone</td>
			<td>TOYOBO&#160;</td>
			<td>TAK101</td>
			<td>pTA2 Vector</td>
		</tr>
		<tr>
			<td>tRNA</td>
			<td>Roche</td>
			<td>10109541001</td>
			<td></td>
		</tr>
		<tr>
			<td>TSA Plus Cyanine 5</td>
			<td>AKOYA Biosciences</td>
			<td>NEL745001KT</td>
			<td>tyramide signal amplification (TSA) technique</td>
		</tr>
		<tr>
			<td>Zeiss LSM 880</td>
			<td>ZEISS</td>
			<td>N/A</td>
			<td>laser scanning confocal microscope</td>
		</tr>
	</tbody>
</table>

fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum

말미잘, 산호, 해파리를 포함한 자포동물은 고착 폴립과 자유 수영 메두사에서 나타나는 다양한 형태와 생활 방식을 나타냅니다. 히드라 및 네마토스텔라와 같은 확립된 모델에서 예시된 바와 같이, 줄기 세포 및/또는 증식성 세포는 자포동물 폴립의 발달 및 재생에 기여한다. 그러나 대부분의 해파리, 특히 메두사 단계의 기본 세포 메커니즘은 대체로 불분명하므로 특정 세포 유형을 식별하기 위한 강력한 방법을 개발하는 것이 중요합니다. 이 논문은 수중 동물 해파리 Cladonema pacificum에서 줄기 유사 증식 세포를 시각화하기위한 프로토콜을 설명합니다. Cladonema medusae는 성체 단계 내내 지속적으로 성장하고 재생 능력을 유지하는 분지 촉수를 가지고 있어 증식 및/또는 줄기 유사 세포에 의해 조정된 세포 메커니즘을 연구할 수 있는 고유한 플랫폼을 제공합니다. 줄기 세포 마커를 사용하는 전체 장착 형광 현장 혼성화(FISH)를 통해 줄기 유사 세포를 검출할 수 있으며, S상 마커인 5-에티닐-2'-데옥시우리딘(EdU)을 사용한 펄스 라벨링은 증식하는 세포를 식별할 수 있습니다. FISH와 EdU 라벨링을 결합하여 고정 동물에서 활발하게 증식하는 줄기 유사 세포를 검출 할 수 있으며,이 기술은 비 모델 해파리 종을 포함한 다른 동물에 광범위하게 적용될 수 있습니다.

Cladonema 촉수는 형태 형성 및 재생15,16,17의 세포 과정을 연구하기위한 모델로 사용되었습니다. 촉수 구조는 줄기 유사 세포 또는 i- 세포가 촉수 전구라고하는 근위 영역에 위치하는 상피관으로 구성되며 축 쪽을 따라 전구의 원위 영역 뒤쪽에 새로운 가지가 순차적으로 추가됩니다 (그림 3A)<sup class...

Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

여기에서는 해파리 Cladonema에서 줄기 유사 증식 세포를 시각화하는 프로토콜을 설명합니다. 줄기 세포 마커를 사용한 전체 장착 형광 in situ 혼성화는 줄기 유사 세포의 검출을 가능하게 하고 5-에티닐-2'-데옥시우리딘 표지는 증식하는 세포의 식별을 가능하게 합니다. 함께, 활발하게 증식하는 줄기 유사 세포를 검출 할 수 있습니다.

형광 현장 혼성화 및 5-에티닐-2'-데옥시우리딘 표지 수중동물 해파리 클라도네마 파시피쿰에서 줄기 유사 세포

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and ...

Nanos1 발현과 EdU 표지의 동시 염색을 통해 활발하게 증식하는 줄기 유사 세포를 구별할 수 있습니다. 우리는 해파리 Cladonema의 단일 세포 수준에서 줄기 유사 세포 분포를 확인할 수 있습니다. 우리는 동일한 해파리 샘플에서 줄기 유사 세포와 증식하는 세포를 시각화 할 수 있으며, 이를 통해 증식하는 줄기 유사 세포와 비증식하는 줄기 유사 세포를 검출 할 수있어 줄기 세포 이질성에 대한 이해를 유도합니다.줄기 세포를 포함하는 동물 모델을 사용한 발달 생물학 및 재생 연구. 수중 동물 해파리 Cladonema pacificum은 특별한 시스템없이 실험실 환경에서 보관할 수있는 새로운 모델 유기체입니다. 클라도네마 메두사에는 분지 촉수가 있습니다.분기는 촉수의 축 방향 측면을 따라 새로운 사이트에서 발생합니다. 시간이 지남에 따라 촉수는 계속 늘어나고 가지가 갈라지며 오래된 가지가 끝쪽으로 밀려납니다. 촉수는 절단 후 며칠 이내에 재생될 수도 있습니다.작은 크기, 쉬운 취급, 성체 줄기 세포 또는 줄기 유사 세포의 존재로 인해 Cladonema는 다양한 과정에서 줄기 세포의 역할을 조사하기에 좋은 시스템입니다. 시작하려면 3.5 밀리리터 이송 피펫을 사용하여 Cladonema medusae를 1.5 밀리리터 튜브에 넣고 ASW를 총 부피 500 마이크로 리터까지 추가하십시오. 7.5 마이크로리터의 10 밀리몰 EdU 원액을 첨가하고 섭씨 22도에서 1시간 동안 샘플을 배양한다.한 시간 동안 기다렸다가 EdU가 포함된 ASW를 최대한 많이 제거합니다. 메두사를 마취 한 후 5 분 동안 배양하십시오. ASW에서 4%파라포름알데히드로 섭씨 4도에서 밤새 메두사를 고정합니다.프로테이나제 처리 및 사후 고정을 위해, 파라포름알데히드를 제거하고 샘플을 0.1%트윈을 함유하는 PBS로 각각 10분 동안 20회 세척한다. PBST를 제거하고 하이브리드화 버퍼를 추가합니다. 샘플을 실온에서 15분 동안 혼성화 완충액에서 인큐베이션한다.하이브리드화 완충액을 제거하고 새로운 혼성화 완충액을 첨가한다. 하이브리드 화 인큐베이터에서 최소 2 시간 동안 섭씨 55도에서 사전 하이브리드 화합니다. 하이브리드화 완충액을 제거하고, 프로브를 포함하는 혼성화 완충액과 함께 인큐베이션한다.하이브리드 화 인큐베이터에서 섭씨 55도에서 18-24 시간 동안 하이브리드 화합니다. 다음으로 프로브 제거를 진행하십시오. 프로브를 포함하는 하이브리드화 버퍼를 제거하는 것으로 시작한 다음 세척 버퍼 하나를 추가합니다.샘플을 섭씨 55도에서 15분 동안 세척 완충액으로 두 번 세척합니다. 세척 버퍼 1을 제거하고 세척 버퍼 2를 추가합니다. 샘플을 세척 완충액으로 2회 섭씨 55도에서 15분 동안 2회 세척한다.세척 버퍼 2를 제거한 다음 2X SSC를 추가합니다. 샘플을 섭씨 55도에서 15분 동안 2X SSC로 두 번 세척합니다. 2X SSC를 제거한 다음 예열된 PBST를 추가합니다.샘플을 실온에서 PBST로 15분 동안 세척한다. 항-DIG 항체 배양의 경우 PBST를 제거한 다음 1% 차단 완충액을 추가하여 시작합니다. 샘플을 실온에서 적어도 1시간 동안 인큐베이션하면서 로커에서 천천히 흔들어준다.차단 후 1% 차단 버퍼를 제거합니다. 안티-DIG-POD 용액을 추가하고 섭씨 4도에서 밤새 샘플을 배양합니다. DIG 표지 프로브를 검출하려면 안티-DIG-POD 용액을 제거하고 트리스 염화나트륨 트윈 버퍼를 추가합니다.샘플을 트리스 염화나트륨 트윈 완충액으로 실온에서 10분 동안 3회 세척한다. 형광 염료 공액 티라마이드 원액을 증폭 희석 완충액에 희석하여 활성 Cy5 티라미드 용액을 만든다. 가능한 한 많은 트리스 염화나트륨 트윈 버퍼를 제거한 다음 활성 Cy5 티라마이드 용액을 추가합니다.어둠 속에서 10 분 동안 샘플을 배양하십시오. 어둠 속에서 10분 동안 PBST로 샘플을 세 번 세척한다. EdU 감지 칵테일을 준비하려면 구성 요소를 혼합하십시오.PBST를 제거한 다음 EdU 검색 칵테일을 추가합니다. 샘플을 어두운 곳에서 30 분 동안 배양하십시오. 어둠 속에서 PBST로 10 분 동안 3 번 씻으십시오.DNA 염색을 위해, 회히스트를 PBST로 희석하여 회히스트 용액을 제조한다. PBST를 제거한 다음 Hoechst 솔루션을 추가합니다. 어둠 속에서 30 분 동안 샘플을 배양하십시오.샘플을 PBST로 3-4회 암실에서 10분 동안 세척한다. 다음으로 장착을 위해 팁이 잘린 상태에서 이송 피펫을 사용하여 메두사를 슬라이드 유리의 은행으로 옮깁니다. 집게로 메두사에 커버슬립을 부드럽게 놓고 투명한 매니큐어로 커버슬립의 측면을 밀봉합니다.Nanos1 발현과 EdU 양성 세포의 공동 표지는 촉수에서 줄기 유사 세포와 증식 세포의 공간 패턴을 나타 냈습니다. EdU 양성 세포는 촉수 구근 전체에 더 널리 분포된 반면, Nanos1 양성 세포는 촉수 구근과 새로운 분기 부위에 더 국부적으로 축적되어 발달 시기와 다른 단계에 따라 줄기 유사 세포와 증식하는 세포의 뚜렷한 분포가 감지됨을 시사합니다. EdU와 Nanos1의 공동 표지는 세포의 19.79%에서 관찰되었으며, 이는 이들 세포가 활발하게 증식하는 줄기 세포 집단임을 시사합니다.흥미롭게도 세포의 14.46%가 전구 중앙과 새로운 분기 부위에서 EdU 양성 Nanos1 음성으로 발견되어 줄기와 유사하지 않은 증식 세포의 존재를 시사합니다. 대조적으로, 세포의 26.32%는 전구 기저부와 새로운 분기 부위에서 EdU 음성 Nanos1 양성으로 관찰되었으며, 이는 느린 사이클링 또는 정지 상태인 줄기 세포 집단의 존재를 나타내며, 둘 다 EdU 펄스 라벨링으로 감지되지 않습니다. 짧은 배양 시간으로 EdU 펄스 라벨링을 통해 줄기 유사 세포와 비 줄기 유사 세포 중에서 증식 세포 만 검출 할 수 있습니다.EdU의 배양 시간을 변경하고 장기간 추적 실험을 결합하면 느린 순환 줄기 세포 또는 자손 및 분화 된 세포를 포함한 다른 세포 유형을 표시 할 수 있습니다.

fluorescent-situ-hybridization-5-ethynyl-2-deoxyuridine-labeling-for

Research

JoVE Journal

Developmental Biology

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development. The Xenopuslaevis embryo is very useful for studying organogenesis because their large size makes them very suitable for identifying organs at the earliest steps in organogenesis. At this time, the primary method used for identifying a specific organ or primordium is whole mount in situ hybridization with labeled antisense RNA probes specific to a gene that is expressed in the organ of interest. In addition, it is relatively easy to manipulate genes or signaling pathways in Xenopus and in situ hybridization allows one to then assay for changes in the presence or morphology of a target organ. Whole mount in situ hybridization is a multi-day protocol with many steps involved. Here we provide a simplified protocol with reduced numbers of steps and reagents used that works well for routine assays. In situ hybridization robots have greatly facilitated the process and we detail how and when we utilize that technology in the process. Once an in situ hybridization is complete, capturing the best image of the result can be frustrating. We provide advice on how to optimize imaging of in situ hybridization results. Although the protocol describes assessing organogenesis in Xenopus laevis, the same basic protocol can almost certainly be adapted to Xenopus tropicalis and other model systems.

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

The Xenopus laevis embryo continues to be exceptionally useful in the study of early development due to its large size and ease of manipulation. A simplified protocol for whole mount in situ hybridization protocol is provided that can be used in the identification of specific organs in this model system.

이해 간체를 사용하여 초기 형성기<em&gt; 현장에서</em에서&gt; 하이브리드 프로토콜<em&gt; 아프리카 발톱 개구리</em

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development.  The Xenopuslaevis embryo ...

연구

발생학

Application of the DNA-Specific Stain Methyl Green in the Fluorescent Labeling of Embryos

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored until recently. In this article, we illustrate the method for preparing a methyl green aqueous stock solution, that when diluted can be used as a very convenient fluorescent nuclear label for fixed cells and tissues. Easy procedures to label whole zebrafish and chick embryos are detailed, and examples of images obtained shown. Methyl green is maximally excited by red light, at 633 nm, and emits with a relatively sharp spectrum that peaks at 677 nm. It is very inexpensive, non-toxic, highly stable in solution and very resistant to photobleaching when bound to DNA. Its red emission allows for unaltered high resolution scanning confocal imaging of nuclei in thick specimens. Finally, this methyl green staining protocol is compatible with other cell staining procedures, such as antibody labeling, or actin filaments labeling with fluorophore-conjugated phalloidin.

A method for fluorescent staining of fixed biological material with the specific DNA label methyl green is described. Methyl green is used in a diluted aqueous solution and is very resistant to photobleaching. Its far-red emission allows for deep specimen imaging, making it particularly adequate for whole embryos.

배아의 형광 라벨의 DNA 특정 얼룩 메틸 녹색의 응용 프로그램

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored ...

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are expressed in spatial relation to each other in situ. Multi-target chromogenic whole-mount in situ hybridization (MC-WISH) greatly facilitates the instant comparison of gene expression patterns, as it allows distinctive visualization of different mRNA species in contrasting colors in the same sample specimen. This provides the possibility to relate gene expression domains topographically to each other with high accuracy and to define unique and overlapping expression sites. In the presented protocol, we describe a MC-WISH procedure for comparing mRNA expression patterns of different genes in Drosophila embryos. Up to three RNA probes, each specific for another gene and labeled by a different hapten, are simultaneously hybridized to the embryo samples and subsequently detected by alkaline phosphatase-based colorimetric immunohistochemistry. The described procedure is detailed here for Drosophila, but works equally well with zebrafish embryos.

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

We describe a multi-target chromogenic whole-mount in situ hybridization (MC-WISH) procedure in intact Drosophila embryos allowing simultaneous and specific detection of three different mRNA distribution patterns by contrasting color precipitates.

멀티 타겟 원체 전체 마운트<em&gt; 현장에서</em&gt; 하이브리드에서 유전자 발현의 도메인을 비교<em&gt; 초파리</em&gt; 배아

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

해 부 및 Immunofluorescent 얼룩의 버섯 몸과 성인 초파리 melanogaster 두뇌 신경 세포 포토 리셉터

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and optical transparency. In particular, the zebrafish embryo has become an important organism to study vertebrate kidney organogenesis as well as multiciliated cell (MCC) development. To visualize MCCs in the embryonic zebrafish kidney, we have developed a combined protocol of whole-mount fluorescent in situ hybridization (FISH) and whole mount immunofluorescence (IF) that enables high resolution imaging. This manuscript describes our technique for co-localizing RNA transcripts and protein as a tool to better understand the regulation of developmental programs through the expression of various lineage factors.

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

Cilia development is vital to proper organogenesis. This protocol describes an optimized method to label and visualize ciliated cells of the zebrafish.

Multiciliated 셀 전체 마운트 형광 제자리에서 교 잡 및 면역 형광의 결합 된 프로토콜을 통해 Zebrafish에 시각화

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and ...

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain and protect cellular identities. The conversion of germ cells into specific neurons in the nematode Caenorhabditis elegans (C. elegans) is a powerful tool for performing genetic screens in order to dissect regulatory pathways that safeguard established cell identities. Reprogramming of germ cells to a specific type of neurons termed ASE requires transgenic animals that allow broad over-expression of the Zn-finger transcription factor (TF) CHE-1. Endogenous CHE-1 is expressed exclusively in two head neurons and is required to specify the glutamatergic ASE neurons fate, which can easily be visualized by the gcy-5prom::gfp reporter. A trans gene containing the heat-shock promoter-driven che-1 gene expression construct allows broad mis-expression of CHE-1 in the entire animal upon heat-shock treatment. The combination of RNAi against the chromatin-regulating factor LIN-53 and heat-shock-induced che-1 over-expression leads to reprogramming of germ cell into ASE neuron-like cells. We describe here the specific RNAi procedure and appropriate conditions for heat-shock treatment of transgenic animals in order to successfully induce germ cell to neuron conversion.

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

This protocol describes how to study cellular processes during cell fate conversion in Caenorhabditis elegans in vivo. Using transgenic animals, allowing heat-shock promoter-driven overexpression of the neuron fate-inducing transcription factor CHE-1 and RNAi-mediated depletion of the chromatin-regulating factor LIN-53 germ cell to neuron reprogramming can be observed in vivo.

C. 선 충 에서 신경 세포를 세균 세포를 재 설 정할 RNAi 및 열 충격 유도 하는 전사 인자 식의 적용

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain ...

Wholemount In Situ Hybridization for Astyanax Embryos

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of genes. Prior research into this emerging model system capitalized on comprehensive genome-wide investigations that have identified numerous quantitative trait loci (QTL) associated with various cave-associated phenotypes. However, the ability to connect genes of interest to the heritable basis for phenotypic change remains a significant challenge. One technique that can facilitate deeper understanding of the role of development in troglomorphic evolution is whole-mount in situ hybridization. This technique can be implemented to directly compare gene expression between cave- and surface-dwelling forms, nominate candidate genes underlying established QTL, identify genes of interest from next-generation sequencing studies, or develop other discovery-based approaches. In this report, we present a simple protocol, supported by a flexible checklist, that can be widely adapted for use well beyond the presented study system. It is hoped that this protocol can serve as a broad resource for the Astyanax community and beyond.

Wholemount In Situ Hybridization for Astyanax Embryos

This protocol enables visualization of gene expression in embryonic Astyanax cavefish. This approach has been developed with the goal of maximizing gene expression signal, while minimizing non-specific background staining.

Wholemount Astyanax 배아에 대 한 제자리 교 잡

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

인간 유도에서 Somite 파생 상품의 체 외 발생에서 만능 줄기 세포

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Genotyping and Quantification of In Situ Hybridization Staining in Zebrafish

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in developmental biology for decades. Traditionally, most gene expression studies relied on visual evaluation of the ISH signal, a method that is prone to bias, particularly in cases where sample identities are known a priori. We have previously reported on a method to circumvent this bias and provide a more accurate quantification of ISH signals. Here, we present a simple guide to apply this method to quantify the expression levels of genes of interest in ISH-stained embryos and correlate that with their corresponding genotypes. The method is particularly useful to quantify spatially restricted gene expression signals in samples of mixed genotypes and it provides an unbiased and accurate alternative to the traditional visual scoring methods.

Gene editing technologies have enabled researchers to generate zebrafish mutants to investigate gene function with relative ease. Here, we provide a guide to perform parallel embryo genotyping and quantification of in situ hybridization signals in zebrafish. This unbiased approach provides greater accuracy in phenotypical analyses based on in situ hybridization.

제브라피시의 인시투 혼성화 염색의 게놈 및 정량화

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in ...

Whole-Mount In Situ Hybridization in Zebrafish Embryos and Tube Formation Assay in iPSC-ECs to Study the Role of Endoglin in Vascular Development

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in zebrafish during different developmental stages. To investigate the role of endoglin(eng) in vessel formation during the development of hereditary hemorrhagic telangiectasia&#160;(HHT), morpholino-mediated targeted knockdown of eng in zebrafish are used to study its temporal expression and associated functions. Here, whole-mount in situ RNA hybridization (WISH) is employed for the analysis of eng and its downstream genes in zebrafish embryos. Also, tube formation assays are performed in HHT patient-derived induced pluripotent stem cell-differentiated&#160;endothelial cells (iPSC-ECs; with eng mutations). A specific signal amplifying system using the whole amount In Situ Hybridization &#8211; WISH provides higher resolution and lower background results compared to traditional methods. To obtain a better signal, the post-fixation time is adjusted to 30 min after probe hybridization. Because fluorescence staining is not sensitive in zebrafish embryos, it is replaced with diaminobezidine (DAB) staining here. In this protocol, HHT&#160;patient-derived iPSC lines containing an eng mutation are differentiated into endothelial cells. After coating a plate with basement membrane matrix for 30 min at 37 &#176;C, iPSC-ECs are seeded as a monolayer into wells and kept at 37 &#176;C for 3 h. Then, the tube length and number of branches are calculated using microscopic images. Thus, with this improved WISH protocol, it is shown that reduced eng expression affects endothelial progenitor formation in zebrafish embryos. This is further confirmed by tube formation assays using iPSC-ECs derived from a patient with HHT. These assays confirm the role for eng in early vascular development.

Presented here is a protocol for whole-mount in situ RNA hybridization analysis in zebrafish and tube formation assay in patient-derived induced pluripotent stem cell-derived endothelial cells to study the role of endoglin in vascular formation.

혈관 발달에서 엔도글린의 역할을 연구하기 위해 iPSC-ECs의 제브라피시 배아 및 튜브 형성 분석에서 시투 혼성화에 대한 전체 마운트

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in ...