Name: fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum
Uploaded: 2022-08-03T15:00:00
Description: Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Bu çalışma AMED tarafından JP22gm6110025 Hibe Numarası altında (YN'ye) ve JSPS KAKENHI Hibe Numarası 22H02762 (YN'ye) tarafından desteklenmiştir.

NOT: Bu protokolde kullanılan tüm malzemeler, reaktifler ve ekipmanlarla ilgili ayrıntılar için Malzeme Tablosuna bakın.
1. Prob sentezi
<ol><li>RNA ekstraksiyonu<ol><li>Yapay deniz suyunda (ASW) kültürlenmiş üç canlı Cladonema medusae'yi, ucu kesilmiş 3,1 mL'lik bir transfer pipeti kullanarak 1,5 mL'lik bir tüpe yerleştirin ve mümkün olduğunca fazla ASW'yi çıkarın. NOT: ASW, mineral tuzların bir karışımını musluk suyun...

<ol>
	<li>Lecl&#232;re, L., R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+cnidarian+muscles:+Function,+anatomy,+development+and+regeneration.">Diversity of cnidarian muscles: Function, anatomy, development and regeneration.</a> Frontiers in Cell and Developmental Biology. 4, 157 (2017).</li><li>Bosch, T. C. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Back+to+the+basics:+Cnidarians+start+to+fire.">Back to the basics: Cnidarians start to fire.</a> Trends in Neurosciences. 40 (2), 92-105 (2017).</li><li>Gold, D. A., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+dynamics+in+Cnidaria:+Are+there+unifying+principles.">Stem cell dynamics in Cnidaria: Are there unifying principles.</a> Development Genes and Evolution. 223 (1-2), 53-66 (2013).</li><li>Technau, U., Steele, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+crossroads+in+developmental+biology:+Cnidaria.">Evolutionary crossroads in developmental biology: Cnidaria.</a> Development. 138 (8), 1447-1458 (2011).</li><li>Lecl&#232;re, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternally+localized+germ+plasm+mRNAs+and+germ+cell/stem+cell+formation+in+the+cnidarian+Clytia.">Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the cnidarian Clytia.</a> Developmental Biology. 364 (2), 236-248 (2012).</li><li>Bradshaw, B., Thompson, K., Frank, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+mechanisms+underlie+oral+vs+aboral+regeneration+in+the+cnidarian+Hydractinia+echinata.">Distinct mechanisms underlie oral vs aboral regeneration in the cnidarian Hydractinia echinata.</a> eLife. 4, 05506 (2015).</li><li>Sinigaglia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pattern+regulation+in+a+regenerating+jellyfish.">Pattern regulation in a regenerating jellyfish.</a> eLife. 9, 54868 (2020).</li><li>David, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interstitial+stem+cells+in+Hydra:+Multipotency+and+decision-making.">Interstitial stem cells in Hydra: Multipotency and decision-making.</a> The International Journal of Developmental Biology. 56 (6-7-8), 489-497 (2012).</li><li>R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nematostella+vectensis,+an+emerging+model+for+deciphering+the+molecular+and+cellular+mechanisms+underlying+whole-body+regeneration.">Nematostella vectensis, an emerging model for deciphering the molecular and cellular mechanisms underlying whole-body regeneration.</a> Cells. 10 (10), 2692 (2021).</li><li>Houliston, E., Momose, T., Manuel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clytia+hemisphaerica:+A+jellyfish+cousin+joins+the+laboratory.">Clytia hemisphaerica: A jellyfish cousin joins the laboratory.</a> Trends in Genetics. 26 (4), 159-167 (2010).</li><li>Peron, S., Houliston, E., Lecl&#232;re, L., Boutet, A., Shierwater, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Marine+Jellyfish+Model,+Clytia+hemisphaerica.">The Marine Jellyfish Model, Clytia hemisphaerica.</a> Handbook of Marine Model Organisms in Experimental Biology. , 129-147 (2021).</li><li>Denker, E., Manuel, M., Lecl&#232;re, L., Le Guyader, H., Rabet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ordered+progression+of+nematogenesis+from+stem+cells+through+differentiation+stages+in+the+tentacle+bulb+of+Clytia+hemisphaerica+(Hydrozoa,+Cnidaria).">Ordered progression of nematogenesis from stem cells through differentiation stages in the tentacle bulb of Clytia hemisphaerica (Hydrozoa, Cnidaria).</a> Developmental Biology. 315 (1), 99-113 (2008).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regeneration+potential+of+jellyfish:+Cellular+mechanisms+and+molecular+insights.">Regeneration potential of jellyfish: Cellular mechanisms and molecular insights.</a> Genes. 12 (5), 758 (2021).</li><li>Suga, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flexibly+deployed+Pax+genes+in+eye+development+at+the+early+evolution+of+animals+demonstrated+by+studies+on+a+hydrozoan+jellyfish.">Flexibly deployed Pax genes in eye development at the early evolution of animals demonstrated by studies on a hydrozoan jellyfish.</a> Proceedings of the National Academy of Sciences. 107 (32), 14263-14268 (2010).</li><li>Fujiki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Branching+pattern+and+morphogenesis+of+medusa+tentacles+in+the+jellyfish+Cladonema+pacificum+(Hydrozoa,+Cnidaria).">Branching pattern and morphogenesis of medusa tentacles in the jellyfish Cladonema pacificum (Hydrozoa, Cnidaria).</a> Zoological Letters. 5 (12), 13 (2019).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+controls+body+size+growth,+tentacle+morphogenesis,+and+regeneration+in+hydrozoan+jellyfish+Cladonema+pacificum.">Cell proliferation controls body size growth, tentacle morphogenesis, and regeneration in hydrozoan jellyfish Cladonema pacificum.</a> PeerJ. 7, 7579 (2019).</li><li>Hou, S., Zhu, J., Shibata, S., Nakamoto, A., Kumano, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repetitive+accumulation+of+interstitial+cells+generates+the+branched+structure+of+Cladonema+medusa+tentacles.">Repetitive accumulation of interstitial cells generates the branched structure of Cladonema medusa tentacles.</a> Development. 148 (23), (2021).</li><li>Salic, A., Mitchison, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+method+for+fast+and+sensitive+detection+of+DNA+synthesis+in+vivo.">A chemical method for fast and sensitive detection of DNA synthesis in vivo.</a> Proceedings of the National Academy of Sciences of the United States of America. 105 (7), 2415-2420 (2008).</li><li>Angerer, L. M., Angerer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+poly+A+++RNA+in+sea+urchin+eggs+and+embryos+by+quantitative+in+situ+hybridization.">Detection of poly A + RNA in sea urchin eggs and embryos by quantitative in situ hybridization.</a> Nucleic Acids Research. 9 (12), 2819-2840 (1981).</li><li>Rakotomamonjy, J., Guemez-Gamboa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purkinje+cell+survival+in+organotypic+cerebellar+slice+cultures.">Purkinje cell survival in organotypic cerebellar slice cultures.</a> Journal of Visualized Experiments. (154), e60353 (2019).</li><li>Tanaka, E. M., Reddien, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+basis+for+animal+regeneration.">The cellular basis for animal regeneration.</a> Developmental Cell. 21 (1), 172-185 (2011).</li><li>Penzo-M&#233;ndez, A. I., Stanger, B. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ-size+regulation+in+mammals.">Organ-size regulation in mammals.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), 019240 (2015).</li><li>Sinigaglia, C., Thiel, D., Hejnol, A., Houliston, E., Lecl&#232;re, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+safer,+urea-based+in+situ+hybridization+method+improves+detection+of+gene+expression+in+diverse+animal+species.">A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species.</a> Developmental Biology. 434 (1), 15-23 (2018).</li><li>King, R. S., Newmark, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+protocol+for+enhanced+detection+of+gene+expression+in+the+planarian+Schmidtea+mediterranea.">In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea.</a> BMC Developmental Biology. 13 (1), 8 (2013).</li><li>Flici, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+evolutionarily+conserved+SoxB-Hdac2+crosstalk+regulates+neurogenesis+in+a+cnidarian.">An evolutionarily conserved SoxB-Hdac2 crosstalk regulates neurogenesis in a cnidarian.</a> Cell Reports. 18 (6), 1395-1409 (2017).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axial+Hox+code+controls+tissue+segmentation+and+body+patterning+in+Nematostella+vectensis.">An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.</a> Science. 361 (6409), 1377-1380 (2018).</li><li>Govindasamy, N., Murthy, S., Ghanekar, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Slow-cycling+stem+cells+in+hydra+contribute+to+head+regeneration.">Slow-cycling stem cells in hydra contribute to head regeneration.</a> Biology Open. 3 (12), 1236-1244 (2014).</li><li>Passamaneck, Y. J., Martindale, M. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+is+necessary+for+the+regeneration+of+oral+structures+in+the+anthozoan+cnidarian+Nematostella+vectensis.">Cell proliferation is necessary for the regeneration of oral structures in the anthozoan cnidarian Nematostella vectensis.</a> BMC Developmental Biology. 12 (1), 34 (2012).</li><li>Gold, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+developmental+disparity+in+the+tentacles+of+the+moon+jellyfish+Aurelia+sp.1.">Structural and developmental disparity in the tentacles of the moon jellyfish Aurelia sp.1.</a> PLoS One. 10 (8), 0134741 (2015).</li><li>Gold, D. A., Nakanishi, N., Hensley, N. M., Hartenstein, V., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+tracking+supports+secondary+gastrulation+in+the+moon+jellyfish+Aurelia.">Cell tracking supports secondary gastrulation in the moon jellyfish Aurelia.</a> Development Genes and Evolution. 226 (6), 383-387 (2016).</li><li>Cheng, L. -. C., Alvarado, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-mount+BrdU+staining+with+fluorescence+in+situ+hybridization+in+planarians.">Whole-mount BrdU staining with fluorescence in situ hybridization in planarians.</a> Planarian Regeneration. 1774, 423-434 (2018).</li></ol>

Proliferasyon yapan hücreler ve kök hücreler morfogenez, büyüme ve rejenerasyon gibi çeşitli süreçlerde önemli hücresel kaynaklardır21,22. Bu yazıda kök hücre belirteci Nanos1'in Cladonema medusae'de FISH ve EdU etiketlemesi ile birlikte boyanması için bir yöntem açıklanmaktadır. EdU veya BrdU etiketlemesini kullanan önceki çalışmalar, proliferatif hücrelerin dokunaç ampulleri16,17'ye lokalize o...

Cnidaria, sinir ve kasları olan hayvanları içeren temel olarak dallanan bir metazoan filum olarak kabul edilir ve onları hayvan gelişiminin ve fizyolojisinin evrimini anlamak için benzersiz bir konuma yerleştirir 1,2. Cnidarians iki ana gruba ayrılır: Anthozoa (örneğin, deniz anemonları, mercanlar) sadece planula larvalarına ve sapsız polip aşamalarına sahipken, Medusozoa (Hydrozoa, Staurozoa, Scyphozoa ve Cubozoa üyeleri) tipik olarak serbest yüzme medusae veya denizanası ile planula larvaları ve polipleri şeklini alır. Cnidarians genellikle yüksek rejeneratif kapasite sergiler ve altta yatan hücresel mekanizmaları, özellikle yetişkin kök hücrelere ve proliferatif hücrelere sahip olmaları, çok dikkat çekmiştir 3,4. Başlangıçta Hydra'da tanımlanan hidrozoan kök hücreler, ektodermal epitel hücreleri arasındaki interstisyel boşluklarda bulunur ve genellikle interstisyel hücreler veya i-hücreleri3 olarak adlandırılır.
Hidrozoan i-hücreleri, çok yönlülük, yaygın olarak korunan kök hücre belirteçlerinin ekspresyonu (örneğin, Nanolar, Piwi, Vasa) ve göç potansiyeli 3,5,6,7,8 gibi ortak özellikleri paylaşır. Fonksiyonel kök hücreler olarak, i-hücreler hidrozoan hayvanların gelişimine, fizyolojisine ve çevresel tepkilerine yoğun bir şekilde katılır ve bu da yüksek rejeneratif kapasitelerini ve plastisitelerini kanıtlar3. I-hücrelerine benzer kök hücreler, hidrozoanların dışında, yerleşik model türü Nematostella'da bile tanımlanmamış olsa da, proliferatif hücreler hala somatik dokunun ve germ hattı9'un bakımı ve yenilenmesinde rol oynamaktadır. Cnidarian gelişimi ve rejenerasyonu ile ilgili çalışmalar ağırlıklı olarak Hydra, Hydractinia ve Nematostella gibi polip tipi hayvanlar üzerinde yapıldığından, denizanası türlerinde kök hücrelerin hücresel dinamikleri ve işlevleri büyük ölçüde ele alınmamıştır.
Akdeniz ve Kuzey Amerika da dahil olmak üzere dünya çapında farklı habitatlara sahip kozmopolit bir denizanası türü olan hidrozoan denizanası Clytia hemisphaerica , çeşitli gelişimsel ve evrimsel çalışmalarda deneysel bir model hayvan olarak kullanılmıştır10. Küçük boyutu, kolay kullanımı ve büyük yumurtaları ile Clytia , laboratuar bakımı için ve yakın zamanda kurulan transgenez ve nakavt yöntemleri11 gibi genetik araçların tanıtılması için uygundur ve denizanası biyolojisinin altında yatan hücresel ve moleküler mekanizmaların ayrıntılı analizi için fırsat yaratır. Clytia medusa dokunaçlarında, i-hücreleri ampul adı verilen proksimal bölgede lokalize olur ve nematoblastlar gibi progenitörler, nematositler12 de dahil olmak üzere farklı hücre tiplerine farklılaşırken distal uca göç eder.
Denizanasının oral organı olan Clytia manubriumunun yenilenmesi sırasında, gonadlarda bulunan Nanos1 + i-hücreleri, hasara yanıt olarak manubriumun kaybolduğu bölgeye göç eder ve manubrium7'nin yenilenmesine katılır. Bu bulgular, Clytia'daki i-hücrelerinin aynı zamanda morfogenez ve rejenerasyonda rol oynayan fonksiyonel kök hücreler gibi davrandığı fikrini desteklemektedir. Bununla birlikte, i-hücrelerinin özelliklerinin Hydra ve Hydractinia 3 gibi temsili polip tipi hayvanlar arasında farklılık gösterdiği göz önüne alındığında, kök hücrelerin özelliklerinin ve işlevlerinin denizanası türleri arasında çeşitlendirilmesi mümkündür. Ayrıca, Clytia hariç, diğer denizanaları için deneysel teknikler sınırlandırılmıştır ve proliferatif hücrelerin ve kök hücrelerin ayrıntılı dinamikleri bilinmemektedir13.
Hidrozoan denizanası Cladonema pacificum, su pompası veya filtreleme sistemi olmadan laboratuvar ortamında tutulabilen yeni bir model organizmadır. Cladonema medusa, Cladonematidae ailesinde ortak bir özellik olan dallanmış dokunaçlara ve ampul14'ün yakınındaki ektodermal tabakada ocellus adı verilen bir fotoreseptör organına sahiptir. Dokunaç dallanma süreci, dokunaçların adaksiyal tarafı boyunca görünen yeni bir dallanma bölgesinde meydana gelir. Zamanla, dokunaçlar uzamaya ve dallanmaya devam eder, eski dallar uç15'e doğru itilir. Ek olarak, Cladonema dokunaçları amputasyondan sonra birkaç gün içinde yenilenebilir. Son zamanlarda yapılan çalışmalar, Cladonema16,17'de dokunaç dallanmasında ve rejenerasyonunda çoğalan hücrelerin ve kök benzeri hücrelerin rolünü ortaya koymuştur. Bununla birlikte, geleneksel in situ hibridizasyon (ISH), Cladonema'daki gen ekspresyonunu görselleştirmek için kullanılırken, düşük çözünürlüğü nedeniyle, kök hücre dinamiklerini hücresel düzeyde ayrıntılı olarak gözlemlemek şu anda zordur.
Bu yazıda Cladonema'daki kök benzeri hücrelerin FISH ile görselleştirilmesi ve hücre proliferasyonunun bir belirteci olan EdU ile birlikte boyanması için bir yöntem açıklanmaktadır18. Bir kök hücre belirteciolan 5,17 olan Nanos1'in ekspresyon paternini, tek hücre düzeyinde kök benzeri hücre dağılımının tanımlanmasına izin veren FISH tarafından görselleştiriyoruz. Ek olarak, Nanos1 ekspresyonunun EdU etiketlemesi ile birlikte boyanması, aktif olarak çoğalan kök benzeri hücrelerin ayırt edilmesini mümkün kılar. Hem kök benzeri hücreleri hem de proliferatif hücreleri izlemek için kullanılan bu yöntem, dokunaç dallanması, doku homeostazı ve Cladonema'da organ rejenerasyonu dahil olmak üzere çok çeşitli araştırma alanlarına uygulanabilir ve benzer bir yaklaşım diğer denizanası türlerine de uygulanabilir.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-Mercaptoethanol&#160;</td>
			<td>Wako</td>
			<td>137-06862</td>
			<td></td>
		</tr>
		<tr>
			<td>3.1 mL transfer pipette</td>
			<td>Thermo Scientific</td>
			<td>233-20S</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-4-chloro-3-indolyl-&#946;-D-galactopyranoside (X-Gal)</td>
			<td>Wako</td>
			<td>029-15043</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-DIG-POD</td>
			<td>Roche</td>
			<td>11207733910</td>
			<td></td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-AAGAGACACAGTCATTATCAAGC 
			GA-3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-CGACGTGTCCAATTTTACGTGCT -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- AAAAGAGCAGCGGCCAGAAAGA 
			AGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- GCGGGTCGCATACTTGTTGGTA 
			CTGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye</td>
			<td>Invitrogen&#160;</td>
			<td>C10337</td>
			<td>EdU kit</td>
		</tr>
		<tr>
			<td>Coroline off</td>
			<td>GEX Co. ltd</td>
			<td>N/A</td>
			<td>chlorine neutralizer</td>
		</tr>
		<tr>
			<td>DIG Nucleic Acid Detection Kit Blocking Reagent</td>
			<td>Roche</td>
			<td>11175041910</td>
			<td>blocking buffer&#160;</td>
		</tr>
		<tr>
			<td>DIG RNA labeling mix&#160;</td>
			<td>Roche</td>
			<td>11277073910</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>Promega</td>
			<td>P117B</td>
			<td></td>
		</tr>
		<tr>
			<td>ECOS competent cell DH5&#945;</td>
			<td>NIPPON GENE</td>
			<td>316-06233</td>
			<td>competent cell</td>
		</tr>
		<tr>
			<td>Fast gene Gel/PCR Extraction kit</td>
			<td>Fast gene</td>
			<td>FG-91302</td>
			<td>gel extraction kit</td>
		</tr>
		<tr>
			<td>Fast gene plasmid mini kit</td>
			<td>Fast gene</td>
			<td>FG-90502</td>
			<td>plasmid miniprep</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Wako&#160;</td>
			<td>068-00426</td>
			<td></td>
		</tr>
		<tr>
			<td>Heparin sodium salt from porcine</td>
			<td>SIGMA-ALDRICH&#160;</td>
			<td>H3393-10KU</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl-&#946;-D(-)-thiogalactopyranoside (IPTG)</td>
			<td>Wako</td>
			<td>096-05143</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar</td>
			<td>Invitrogen</td>
			<td>22700-025</td>
			<td>agar plate</td>
		</tr>
		<tr>
			<td>LB Broth Base</td>
			<td>Invitrogen</td>
			<td>12780-052</td>
			<td>LB medium</td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Wako</td>
			<td>134-00495</td>
			<td></td>
		</tr>
		<tr>
			<td>mini Quick spin RNA columns</td>
			<td>Roche</td>
			<td>11814427001</td>
			<td>clean-up column</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Wako&#160;</td>
			<td>191-01665</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop OneC Microvolume UV-Vis Spectrophotometer with Wi-Fi</td>
			<td>Thermo Scientific</td>
			<td>ND-ONEC-W</td>
			<td>spectrophotometer</td>
		</tr>
		<tr>
			<td>Polyoxyethlene (20) Sorbitan Monolaurate (Tween-20)</td>
			<td>Wako&#160;</td>
			<td>166-21115</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerMasher 2</td>
			<td>nippi&#160;</td>
			<td>891300</td>
			<td>homogenizer</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Nacarai Tesque&#160;</td>
			<td>29442-14</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor</td>
			<td>TaKaRa</td>
			<td>2313A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen&#160;</td>
			<td>74004</td>
			<td>total RNA isolation kit</td>
		</tr>
		<tr>
			<td>RQ1 RNase-Free Dnase</td>
			<td>Promega</td>
			<td>M6101</td>
			<td></td>
		</tr>
		<tr>
			<td>Saline Sodium Citrate Buffer 20x powder (20x SSC)</td>
			<td>TaKaRa</td>
			<td>T9172</td>
			<td></td>
		</tr>
		<tr>
			<td>SEA LIFE</td>
			<td>Marin Tech</td>
			<td>N/A</td>
			<td>mixture of mineral salts</td>
		</tr>
		<tr>
			<td>T3 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>11031163001</td>
			<td></td>
		</tr>
		<tr>
			<td>T7 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>10881767001</td>
			<td></td>
		</tr>
		<tr>
			<td>TAITEC HB-100</td>
			<td>TAITEC</td>
			<td>0040534-000</td>
			<td>Hybridization incuvator</td>
		</tr>
		<tr>
			<td>TaKaRa Ex Taq&#160;</td>
			<td>TaKaRa</td>
			<td>RR001A</td>
			<td>Taq DNA polymerase</td>
		</tr>
		<tr>
			<td>TaKaRa PrimeScript 2 1st strand cDNA Synthesis Kit</td>
			<td>TaKaRa</td>
			<td>6210A</td>
			<td>cDNA synthesis kit</td>
		</tr>
		<tr>
			<td>Target Clone</td>
			<td>TOYOBO&#160;</td>
			<td>TAK101</td>
			<td>pTA2 Vector</td>
		</tr>
		<tr>
			<td>tRNA</td>
			<td>Roche</td>
			<td>10109541001</td>
			<td></td>
		</tr>
		<tr>
			<td>TSA Plus Cyanine 5</td>
			<td>AKOYA Biosciences</td>
			<td>NEL745001KT</td>
			<td>tyramide signal amplification (TSA) technique</td>
		</tr>
		<tr>
			<td>Zeiss LSM 880</td>
			<td>ZEISS</td>
			<td>N/A</td>
			<td>laser scanning confocal microscope</td>
		</tr>
	</tbody>
</table>

fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum

Deniz anemonları, mercanlar ve denizanası da dahil olmak üzere Cnidarian'lar, sapsız poliplerde ve serbest yüzme medusalarında ortaya çıkan çeşitli morfoloji ve yaşam tarzları sergilerler. Hydra ve Nematostella gibi yerleşik modellerde örneklendiği gibi, kök hücreler ve / veya proliferatif hücreler cnidarian poliplerin gelişimine ve yenilenmesine katkıda bulunur. Bununla birlikte, çoğu denizanasında, özellikle medusa aşamasında, altta yatan hücresel mekanizmalar büyük ölçüde belirsizdir ve bu nedenle, spesifik hücre tiplerini tanımlamak için sağlam bir yöntem geliştirmek kritik öneme sahiptir. Bu yazıda, hidrozoan denizanası Cladonema pacificum'daki kök benzeri çoğalan hücreleri görselleştirmek için bir protokol açıklanmaktadır. Cladonema medusae, yetişkin evreleri boyunca sürekli büyüyen ve rejeneratif kapasiteyi koruyan dallanmış dokunaçlara sahiptir ve çoğalan ve / veya kök benzeri hücreler tarafından düzenlenen hücresel mekanizmaları incelemek için eşsiz bir platform sağlar. Bir kök hücre belirteci kullanan tam montajlı floresan in situ hibridizasyon (FISH), kök benzeri hücrelerin tespit edilmesine izin verirken, bir S faz belirteci olan 5-etinil-2'-deoksiüridin (EdU) ile nabız etiketlemesi, çoğalan hücrelerin tanımlanmasını sağlar. Hem FISH hem de EdU etiketlemesini birleştirerek, sabit hayvanlar üzerinde aktif olarak çoğalan kök benzeri hücreleri tespit edebiliriz ve bu teknik, model olmayan denizanası türleri de dahil olmak üzere diğer hayvanlara geniş çapta uygulanabilir.

Kladonoma dokunaçları, morfogenez ve rejenerasyonun hücresel süreçlerini incelemek için bir model olarak kullanılmıştır15,16,17. Tentacle yapısı, kök benzeri hücrelerin veya i-hücrelerinin, dokunaç ampulü adı verilen proksimal bölgede bulunduğu ve ampulün distal bölgesinin arkasına adaksiyal taraf boyunca sırayla yeni dalların eklendiği bir epitel tüpünden oluşur (Şekil...

Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Burada, denizanası Cladonema'daki kök benzeri çoğalan hücreleri görselleştirmek için bir protokol açıklıyoruz. Bir kök hücre belirteci ile tam montajlı floresan in situ hibridizasyon, kök benzeri hücrelerin tespit edilmesine izin verir ve 5-etinil-2'-deoksiüridin etiketlemesi, çoğalan hücrelerin tanımlanmasını sağlar. Birlikte, aktif olarak çoğalan kök benzeri hücreler tespit edilebilir.

Hidrozoan Denizanası Cladonema pacificum'daki Kök Benzeri Hücreler için Floresan In Situ Hibridizasyon ve 5-Etinil-2'-Deoksiüridin Etiketleme

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and ...

Nanos1 ekspresyonunun EdU etiketleme ile birlikte boyanması, aktif olarak çoğalan kök benzeri hücrelerin ayırt edilmesini mümkün kılar. Denizanası Cladonema'da kök benzeri hücrelerin tek hücre seviyesinde dağılımını tanımlayabiliriz. Kök benzeri hücreleri ve çoğalan hücreleri aynı denizanası örneğinde görselleştirebiliriz, bu da çoğalan ve çoğalmayan kök benzeri hücrelerin tespit edilmesini sağlayarak kök hücre heterojenliğinin anlaşılmasına yol açar.Kök hücreleri içeren hayvan modellerini kullanarak gelişimsel biyoloji ve rejenerasyon çalışmaları. Hidrozoon denizanası Cladonema pacificum, herhangi bir özel sistem olmadan laboratuvar ortamında tutulabilen, gelişmekte olan bir model organizmadır. Cladonema medusae dallanmış dokunaçlara sahiptir.Dallanma, dokunacın adaksial tarafı boyunca yeni bir bölgede meydana gelir. Zamanla, dokunaçlar uzamaya ve dallanmaya devam eder, eski dallar uca doğru itilir. Dokunaçlar ayrıca amputasyondan sonraki birkaç gün içinde yenilenebilir.Küçük boyutlu, kolay kullanımı ve yetişkin kök hücrelerin veya kök benzeri hücrelerin varlığı, Cladonema'yı kök hücrelerin farklı süreçlerdeki rolünü araştırmak için iyi bir sistem haline getirir. Başlamak için, Cladonema medusae'yi 3,5 mililitrelik bir transfer pipeti kullanarak 1,5 mililitrelik tüplere yerleştirin ve toplam 500 mikrolitre hacme kadar ASW ekleyin. 7,5 mikrolitre 10 milimolar EdU stok çözeltisi ekleyin ve numuneleri 22 santigrat derecede bir saat boyunca inkübe edin.Bir saat bekleyin ve mümkün olduğunca EdU içeren ASW'yi çıkarın. Medusae'yi anestezi altına aldıktan sonra, beş dakika boyunca kuluçkaya yatırın. Medusae'yi ASW'de% 4 paraformaldehit ile gece boyunca dört santigrat derecede sabitleyin.Proteinaz tedavisi ve fiksasyon sonrası için, paraformaldehiti çıkarın ve numuneleri% 0.1 içeren PBS ile yıkayınHer biri 10 dakika boyunca 20 üç kez ara. PBST'yi çıkarın ve hibridizasyon arabelleğini ekleyin. Hibridizasyon tamponundaki numuneleri oda sıcaklığında 15 dakika boyunca inkübe edin.Hibridizasyon tamponunu çıkarın ve yeni hibridizasyon tamponunu ekleyin. Bir hibridizasyon inkübatöründe en az iki saat boyunca 55 santigrat derecede ön hibridize edin. Hibridizasyon tamponunu çıkarın ve probları içeren hibridizasyon tamponu ile inkübe edin.Bir hibridizasyon inkübatöründe 18 ila 24 saat boyunca 55 santigrat derecede hibridize edin. Ardından, prob çıkarma işlemine devam edin. Probları içeren hibridizasyon tamponunu çıkarmakla başlayın ve ardından yıkama tamponu ekleyin.Numuneleri 55 santigrat derecede 15 dakika boyunca iki kez yıkama tamponu ile yıkayın. Yıkama tamponu birini çıkarın ve ikinci yıkama tamponunu ekleyin. Numuneleri 55 santigrat derecede 15 dakika boyunca iki kez yıkama tamponu ile yıkayın.İki yıkama tamponunu çıkarın ve ardından 2X SSC ekleyin. Numuneleri 2X SSC ile 55 santigrat derecede 15 dakika boyunca iki kez yıkayın. 2X SSC'yi kaldırın ve önceden ısıtılmış PBST'yi ekleyin.Numuneleri oda sıcaklığında PBST ile 15 dakika yıkayın. Anti-DIG antikor inkübasyonu için, PBST'yi çıkararak başlayın ve% 1 bloke edici tampon ekleyin. Bir rocker üzerinde yavaşça sallanırken numuneleri oda sıcaklığında en az bir saat boyunca inkübe edin.Engelledikten sonra,% 1 engelleme arabelleğini çıkarın. Anti-DIG-POD çözeltisi ekleyin ve numuneleri gece boyunca dört santigrat derecede inkübe edin. DIG etiketli probu tespit etmek için, anti-DIG-POD çözeltisini çıkarın ve tris sodyum klorür Ara tamponu ekleyin.Numuneleri tris sodyum klorür Ara tamponu ile oda sıcaklığında 10 dakika boyunca üç kez yıkayın. Aktif Cy5 tiramid çözeltisini yapmak için floresan boya konjuge tiramid stok çözeltisini amplifikasyon seyreltici tamponunda seyreltin. Mümkün olduğunca çok tris sodyum klorür Ara tamponunu çıkarın ve ardından aktif Cy5 tiramid çözeltisini ekleyin.Örnekleri karanlıkta 10 dakika boyunca inkübe edin. Numuneleri karanlıkta 10 dakika boyunca PBST ile üç kez yıkayın. EdU algılama kokteylini hazırlamak için bileşenleri karıştırın.PBST'yi kaldırın ve ardından EdU algılama kokteylini ekleyin. Numuneyi karanlıkta 30 dakika boyunca inkübe edin. PBST ile karanlıkta 10 dakika boyunca üç kez yıkayın.DNA boyama için, Hoechst çözeltisini hazırlamak için PBST'de Hoechst'i seyreltin. PBST'yi kaldırın ve Hoechst çözümünü ekleyin. Örnekleri karanlıkta 30 dakika boyunca inkübe edin.Numuneleri karanlıkta 10 dakika boyunca PBST ile üç ila dört kez yıkayın. Montaj için daha sonra, ucu kesilmiş bir transfer pipeti kullanarak medusae'yi slayt camındaki bankaya aktarın. Medusae üzerine forseps ile yavaşça bir örtü parçası yerleştirin ve kapak kaymasının yan tarafını şeffaf oje ile kapatın.Nanos1 ekspresyonu ve EdU pozitif hücrelerin birlikte etiketlenmesi, dokunaçtaki kök benzeri hücrelerin ve proliferatif hücrelerin uzamsal modelini ortaya çıkardı. EdU pozitif hücreler dokunaç ampulü boyunca daha yaygın olarak dağılırken, dokunaç ampulünde ve yeni dallanma bölgesinde daha lokal olarak biriken Nanos1 pozitif hücreler, kök benzeri hücrelerin ve çoğalan hücrelerin farklı dağılımlarının gelişimsel zamanlamaya ve farklı aşamalara bağlı olarak tespit edildiğini göstermektedir. EdU ve Nanos1'un birlikte etiketlenmesi, hücrelerin% 19.79'unda gözlendi ve bu hücrelerin aktif olarak çoğalan bir kök hücre popülasyonu olduğunu düşündürdü.İlginç bir şekilde, hücrelerin% 14.46'sının, ampulün ortasında ve yeni dallanma bölgesinde EdU pozitif Nanos1 negatif olduğu bulundu ve bu da kök benzeri olmayan proliferatif hücrelerin varlığını düşündürdü. Buna karşılık, hücrelerin% 26.32'sinin, ampulün tabanında ve yeni dallanma bölgesinde EdU negatif Nanos1 pozitif olduğu gözlendi; bu, yavaş döngülü veya sessiz bir kök hücre popülasyonunun varlığını gösteriyordu. Kısa inkübasyon süresine sahip EdU nabız etiketlemesi, kök benzeri hücreler ve kök benzeri olmayan hücreler arasında sadece proliferatif hücrelerin tespit edilmesini sağlar.EdU için kuluçka süresini değiştirirken ve uzun süreli kovalama deneylerini birleştirirken, yavaş döngülü kök hücreler veya soy ve farklılaşmış hücreler de dahil olmak üzere diğer hücre tipleri işaretlenebilir.

fluorescent-situ-hybridization-5-ethynyl-2-deoxyuridine-labeling-for

Research

JoVE Journal

Developmental Biology

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development. The Xenopuslaevis embryo is very useful for studying organogenesis because their large size makes them very suitable for identifying organs at the earliest steps in organogenesis. At this time, the primary method used for identifying a specific organ or primordium is whole mount in situ hybridization with labeled antisense RNA probes specific to a gene that is expressed in the organ of interest. In addition, it is relatively easy to manipulate genes or signaling pathways in Xenopus and in situ hybridization allows one to then assay for changes in the presence or morphology of a target organ. Whole mount in situ hybridization is a multi-day protocol with many steps involved. Here we provide a simplified protocol with reduced numbers of steps and reagents used that works well for routine assays. In situ hybridization robots have greatly facilitated the process and we detail how and when we utilize that technology in the process. Once an in situ hybridization is complete, capturing the best image of the result can be frustrating. We provide advice on how to optimize imaging of in situ hybridization results. Although the protocol describes assessing organogenesis in Xenopus laevis, the same basic protocol can almost certainly be adapted to Xenopus tropicalis and other model systems.

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

The Xenopus laevis embryo continues to be exceptionally useful in the study of early development due to its large size and ease of manipulation. A simplified protocol for whole mount in situ hybridization protocol is provided that can be used in the identification of specific organs in this model system.

Anlamak Basitleştirilmiş kullanma Erken Organogenez<em&gt; In Situ</emIçinde&gt; Hibridizasyon Protokolü<em&gt; Ksenopus</em

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development.  The Xenopuslaevis embryo ...

Gelişim Biyolojisi

Application of the DNA-Specific Stain Methyl Green in the Fluorescent Labeling of Embryos

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored until recently. In this article, we illustrate the method for preparing a methyl green aqueous stock solution, that when diluted can be used as a very convenient fluorescent nuclear label for fixed cells and tissues. Easy procedures to label whole zebrafish and chick embryos are detailed, and examples of images obtained shown. Methyl green is maximally excited by red light, at 633 nm, and emits with a relatively sharp spectrum that peaks at 677 nm. It is very inexpensive, non-toxic, highly stable in solution and very resistant to photobleaching when bound to DNA. Its red emission allows for unaltered high resolution scanning confocal imaging of nuclei in thick specimens. Finally, this methyl green staining protocol is compatible with other cell staining procedures, such as antibody labeling, or actin filaments labeling with fluorophore-conjugated phalloidin.

A method for fluorescent staining of fixed biological material with the specific DNA label methyl green is described. Methyl green is used in a diluted aqueous solution and is very resistant to photobleaching. Its far-red emission allows for deep specimen imaging, making it particularly adequate for whole embryos.

Embriyolar Floresan Etiketleme DNA Özgü Leke Metil Green Uygulaması

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored ...

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are expressed in spatial relation to each other in situ. Multi-target chromogenic whole-mount in situ hybridization (MC-WISH) greatly facilitates the instant comparison of gene expression patterns, as it allows distinctive visualization of different mRNA species in contrasting colors in the same sample specimen. This provides the possibility to relate gene expression domains topographically to each other with high accuracy and to define unique and overlapping expression sites. In the presented protocol, we describe a MC-WISH procedure for comparing mRNA expression patterns of different genes in Drosophila embryos. Up to three RNA probes, each specific for another gene and labeled by a different hapten, are simultaneously hybridized to the embryo samples and subsequently detected by alkaline phosphatase-based colorimetric immunohistochemistry. The described procedure is detailed here for Drosophila, but works equally well with zebrafish embryos.

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

We describe a multi-target chromogenic whole-mount in situ hybridization (MC-WISH) procedure in intact Drosophila embryos allowing simultaneous and specific detection of three different mRNA distribution patterns by contrasting color precipitates.

Çoklu hedef Kromojenik Tüm montaj<em&gt; In Situ</em&gt; Melezleme Gen İfade Etki karşılaştırılması için<em&gt; Drosophila</em&gt; Embriyolar

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

Diseksiyon ve mantar vücut immünfloresan boyama ve yetişkin Drosophila melanogaster beynindeki nöronlar Photoreceptor

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and optical transparency. In particular, the zebrafish embryo has become an important organism to study vertebrate kidney organogenesis as well as multiciliated cell (MCC) development. To visualize MCCs in the embryonic zebrafish kidney, we have developed a combined protocol of whole-mount fluorescent in situ hybridization (FISH) and whole mount immunofluorescence (IF) that enables high resolution imaging. This manuscript describes our technique for co-localizing RNA transcripts and protein as a tool to better understand the regulation of developmental programs through the expression of various lineage factors.

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

Cilia development is vital to proper organogenesis. This protocol describes an optimized method to label and visualize ciliated cells of the zebrafish.

Zebra balığı bütün Dağı Floresan Situ hibridizasyon ve ayirt kombine bir protokol aracılığıyla Multiciliated hücrelerde görüntülenmesi

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and ...

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain and protect cellular identities. The conversion of germ cells into specific neurons in the nematode Caenorhabditis elegans (C. elegans) is a powerful tool for performing genetic screens in order to dissect regulatory pathways that safeguard established cell identities. Reprogramming of germ cells to a specific type of neurons termed ASE requires transgenic animals that allow broad over-expression of the Zn-finger transcription factor (TF) CHE-1. Endogenous CHE-1 is expressed exclusively in two head neurons and is required to specify the glutamatergic ASE neurons fate, which can easily be visualized by the gcy-5prom::gfp reporter. A trans gene containing the heat-shock promoter-driven che-1 gene expression construct allows broad mis-expression of CHE-1 in the entire animal upon heat-shock treatment. The combination of RNAi against the chromatin-regulating factor LIN-53 and heat-shock-induced che-1 over-expression leads to reprogramming of germ cell into ASE neuron-like cells. We describe here the specific RNAi procedure and appropriate conditions for heat-shock treatment of transgenic animals in order to successfully induce germ cell to neuron conversion.

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

This protocol describes how to study cellular processes during cell fate conversion in Caenorhabditis elegans in vivo. Using transgenic animals, allowing heat-shock promoter-driven overexpression of the neuron fate-inducing transcription factor CHE-1 and RNAi-mediated depletion of the chromatin-regulating factor LIN-53 germ cell to neuron reprogramming can be observed in vivo.

Uygulama için yeniden programlamak Germ hücreleri için C. elegans nöronlarda RNAi ve transkripsiyon faktörü ifade ısı şok bağlı

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain ...

Wholemount In Situ Hybridization for Astyanax Embryos

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of genes. Prior research into this emerging model system capitalized on comprehensive genome-wide investigations that have identified numerous quantitative trait loci (QTL) associated with various cave-associated phenotypes. However, the ability to connect genes of interest to the heritable basis for phenotypic change remains a significant challenge. One technique that can facilitate deeper understanding of the role of development in troglomorphic evolution is whole-mount in situ hybridization. This technique can be implemented to directly compare gene expression between cave- and surface-dwelling forms, nominate candidate genes underlying established QTL, identify genes of interest from next-generation sequencing studies, or develop other discovery-based approaches. In this report, we present a simple protocol, supported by a flexible checklist, that can be widely adapted for use well beyond the presented study system. It is hoped that this protocol can serve as a broad resource for the Astyanax community and beyond.

Wholemount In Situ Hybridization for Astyanax Embryos

This protocol enables visualization of gene expression in embryonic Astyanax cavefish. This approach has been developed with the goal of maximizing gene expression signal, while minimizing non-specific background staining.

İn Situ hibridizasyon Astyanax embriyo için Wholemount

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

Somite türevleri indüklenen insan nesil Vitro Pluripotent kök hücreler

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Genotyping and Quantification of In Situ Hybridization Staining in Zebrafish

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in developmental biology for decades. Traditionally, most gene expression studies relied on visual evaluation of the ISH signal, a method that is prone to bias, particularly in cases where sample identities are known a priori. We have previously reported on a method to circumvent this bias and provide a more accurate quantification of ISH signals. Here, we present a simple guide to apply this method to quantify the expression levels of genes of interest in ISH-stained embryos and correlate that with their corresponding genotypes. The method is particularly useful to quantify spatially restricted gene expression signals in samples of mixed genotypes and it provides an unbiased and accurate alternative to the traditional visual scoring methods.

Gene editing technologies have enabled researchers to generate zebrafish mutants to investigate gene function with relative ease. Here, we provide a guide to perform parallel embryo genotyping and quantification of in situ hybridization signals in zebrafish. This unbiased approach provides greater accuracy in phenotypical analyses based on in situ hybridization.

Zebrabalığında Situ Hibridizasyon Boyamada Genotibrasyon ve Nicelik

In situ hybridization (ISH) is an important technique that enables researchers to study mRNA distribution in situ and has been a critical technique in ...

Whole-Mount In Situ Hybridization in Zebrafish Embryos and Tube Formation Assay in iPSC-ECs to Study the Role of Endoglin in Vascular Development

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in zebrafish during different developmental stages. To investigate the role of endoglin(eng) in vessel formation during the development of hereditary hemorrhagic telangiectasia&#160;(HHT), morpholino-mediated targeted knockdown of eng in zebrafish are used to study its temporal expression and associated functions. Here, whole-mount in situ RNA hybridization (WISH) is employed for the analysis of eng and its downstream genes in zebrafish embryos. Also, tube formation assays are performed in HHT patient-derived induced pluripotent stem cell-differentiated&#160;endothelial cells (iPSC-ECs; with eng mutations). A specific signal amplifying system using the whole amount In Situ Hybridization &#8211; WISH provides higher resolution and lower background results compared to traditional methods. To obtain a better signal, the post-fixation time is adjusted to 30 min after probe hybridization. Because fluorescence staining is not sensitive in zebrafish embryos, it is replaced with diaminobezidine (DAB) staining here. In this protocol, HHT&#160;patient-derived iPSC lines containing an eng mutation are differentiated into endothelial cells. After coating a plate with basement membrane matrix for 30 min at 37 &#176;C, iPSC-ECs are seeded as a monolayer into wells and kept at 37 &#176;C for 3 h. Then, the tube length and number of branches are calculated using microscopic images. Thus, with this improved WISH protocol, it is shown that reduced eng expression affects endothelial progenitor formation in zebrafish embryos. This is further confirmed by tube formation assays using iPSC-ECs derived from a patient with HHT. These assays confirm the role for eng in early vascular development.

Presented here is a protocol for whole-mount in situ RNA hybridization analysis in zebrafish and tube formation assay in patient-derived induced pluripotent stem cell-derived endothelial cells to study the role of endoglin in vascular formation.

Zebrabalığı Embriyolarında Situ Hibridizasyon ve IPSC-EC'lerde Tüp Oluşumu Nda Endoglin'in Vasküler Gelişimdeki Rolünü İncelemek İçin Tam Montaj

Vascular development is determined by the sequential expression of specific genes, which can be studied by performing in situ hybridization assays in ...