Name: Forfatter Spotlight: Fremme af kromatinforskning og overvindelse af begrænsninger med en locus-specifik kromatinisoleringsprotokol med høj berigelse
Uploaded: 2023-11-17T13:20:00
Description: Watch this Scientific Journal Video about Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol at JoVE.com

Arbejdet i S.H.-laboratoriet blev støttet af DFG gennem SFB1064 (projekt-ID 213249687), Det Europæiske Forskningsråd (ERC Starting Grant 852798 ConflictResolution) og Helmholtz Gesellschaft.

Se materialefortegnelsen for detaljer vedrørende alle de materialer og instrumenter, der anvendes i denne protokol. Se tabel 1 for en liste over de anvendte opløsninger, buffere og medier.
1. Rekombinant gærstammekonstruktion
<ol><li>For at konstruere en rekombinationskompetent gærstamme omdannes SbfI-fordøjet plasmid K238 til en gærstamme med integrerede LexA-bindingssteder og RS-rekombinationssteder på interessestedet<sup class="xre...

Locus-specifik kromatinisolering fra gærceller

<ol>
	<li>Kornberg, R. D., Lorch, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty-five+years+of+the+nucleosome,+fundamental+particle+of+the+eukaryote+chromosome.">Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome.</a> Cell. 98 (3), 285-294 (1999).</li><li>Gauchier, M., van Mierlo, G., Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+enrichment+of+specific+chromatin+loci.">Purification and enrichment of specific chromatin loci.</a> Nature Methods. 17 (4), 380-389 (2020).</li><li>Korthout, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoding+the+chromatin+proteome+of+a+single+genomic+locus+by+DNA+sequencing.">Decoding the chromatin proteome of a single genomic locus by DNA sequencing.</a> PLoS Biology. 16 (7), e2005542 (2018).</li><li>Ant&#227;o, J. M., Mason, J. M., D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+landscape+at+Drosophila+melanogaster+telomere-associated+sequence+repeats.">Protein landscape at Drosophila melanogaster telomere-associated sequence repeats.</a> Molecular and Cellular Biology. 32 (12), 2170-2182 (2012).</li><li>D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+proteins+associated+with+specific+genomic+loci.">Purification of proteins associated with specific genomic loci.</a> Cell. 136 (1), 175-186 (2009).</li><li>Ide, S., Dejardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=End-targeting+proteomics+of+isolated+chromatin+segments+of+a+mammalian+ribosomal+RNA+gene+promoter.">End-targeting proteomics of isolated chromatin segments of a mammalian ribosomal RNA gene promoter.</a> Nature Communications. 6, 6674 (2015).</li><li>Unnikrishnan, A., Gafken, P. R., Tsukiyama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+changes+in+histone+acetylation+regulate+origins+of+DNA+replication.">Dynamic changes in histone acetylation regulate origins of DNA replication.</a> Nature Structural &amp;amp; Molecular Biology. 17 (4), 430 (2010).</li><li>Buxton, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+protein-DNA+interactions+in+human+alphoid+chromatin+via+hybridization+capture+and+mass+spectrometry.">Elucidating protein-DNA interactions in human alphoid chromatin via hybridization capture and mass spectrometry.</a> Journal of Proteome Research. 16 (9), 3433-3442 (2017).</li><li>Kennedy-Darling, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+chromatin-associated+proteins+via+sequence-specific+capture+and+mass+spectrometric+protein+identification+in+Saccharomyces+cerevisiae.">Discovery of chromatin-associated proteins via sequence-specific capture and mass spectrometric protein identification in Saccharomyces cerevisiae.</a> Journal of Proteome Research. 13 (8), 3810-3825 (2014).</li><li>Liu, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRi-based+genome-scale+identification+of+functional+long+noncoding+RNA+loci+in+human+cells.">CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells.</a> Science. 355, 7111 (2017).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+specific+chromatin+domains+from+single-copy+gene+loci+in+Saccharomyces+cerevisiae.">Purification of specific chromatin domains from single-copy gene loci in Saccharomyces cerevisiae.</a> Functional Analysis of DNA and Chromatin. 1094, 329-341 (2014).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compositional+and+structural+analysis+of+selected+chromosomal+domains+from+Saccharomyces+cerevisiae.">Compositional and structural analysis of selected chromosomal domains from Saccharomyces cerevisiae.</a> Nucleic Acids Research. 42 (1), 2 (2014).</li><li>Wei&#946;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-copy+locus+proteomics+of+early-+and+late-firing+DNA+replication+origins+identifies+a+role+of+Ask1/DASH+complex+in+replication+timing+control.">Single-copy locus proteomics of early- and late-firing DNA replication origins identifies a role of Ask1/DASH complex in replication timing control.</a> Cell Reports. 42 (2), 112045 (2023).</li><li>Gietz, R. D., Schiestl, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+yeast+transformation+using+the+LiAc/SS+carrier+DNA/PEG+method.">High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method.</a> Nature Protocols. 2 (1), 31-34 (2007).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Towbin, H., Staehelin, T., Gordon, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+transfer+of+proteins+from+polyacrylamide+gels+to+nitrocellulose+sheets:+procedure+and+some+applications.">Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (9), 4350-4354 (1979).</li><li>Western blot membrane stripping for restaining protocol. Abcam Available from: <a target="_blank" href="https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol">https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol</a> (2023)</li><li>Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Locus-specific+chromatin+isolation.">Locus-specific chromatin isolation.</a> Nature Reviews. Molecular Cell Biology. 21 (5), 249-250 (2020).</li></ol>

Identificeringen af faktorer og kromatinlandskab i en specifik målgenomregion udgør fortsat en stor udfordring inden for kromatinforskning18. Denne protokol beskriver et effektivt system til specifikt at punktafgifter og rense forskellige kromatindomæner fra gærkromosomer. Så vidt vi ved, overvinder renheden og udbyttet af denne enkelttrinsoprensning mange af begrænsningerne ved locusspecifikke kromatinrensningsmetoder, hvilket muliggør opnåelse af meget høj berigelse af de målrettede lo...

Den dynamiske organisering af eukaryote genomer i kromatin komprimerer DNA'et, så det passer inden for kernens grænser, samtidig med at der sikres tilstrækkelig dynamik til genekspression og tilgængelighed for regulatoriske faktorer. Til dels medieres denne alsidighed af nukleosomet, den grundlæggende enhed af kromatin, som omfatter en kernepartikel med 147 bp DNA indpakket ~ 1,7 gange omkring histonoctammeren1. Nukleosomet er en meget dynamisk struktur med hensyn til dets sammensætning med adskillige histonvarianter og posttranslationelle modifikationer (PTM'er) på de N- og C-terminale histonhaler. Desuden interagerer eukaryot kromatin med en lang række andre væsentlige komponenter, såsom transkriptionsfaktorer, DNA- og RNA-behandlingsmaskiner, arkitektoniske proteiner, enzymer involveret i kromatinremodellering og modifikation og RNA-molekyler forbundet med kromatin. Disse vigtige maskiner, der er involveret i transkription, replikation og reparation, kræver alle adgang til kromatin, som fungerer som det naturlige substrat for disse processer. Følgelig kræver forståelsen af de molekylære mekanismer, der ligger til grund for disse DNA-transaktioner, en præcis definition af de kollektive ændringer i kromatinstrukturen i de specifikke genomiske regioner, hvor disse maskiner konvergerer og letter biologiske reaktioner.
På trods af identifikation af adskillige kromatinfaktorer gennem genetik og protein-protein-interaktionsundersøgelser er udførelse af direkte, upartiske og omfattende analyser af kromatininteraktioner på bestemte genomiske steder forblevet en betydelig hindring 2,3. Indledningsvis kunne kun meget rigelige områder af genomet (dvs. gentagne loci) eller multikopiplasmider isoleres i tilstrækkelige mængder og renhed til massespektrometrisk identifikation af de associerede proteiner 4,5,6,7. En række nye tilgange baseret på direkte hybridisering af indfangningssonder til kromatiniseret DNA, nærhedsbiotinylering ved hjælp af CRISPR-dCas9-systemet eller binding af sekvensspecifikke adapterproteiner til det interessante sted er begyndt at optrævle proteomet af enkeltkopi-loci fra gær- og pattedyrgenomer 8,9,10. Imidlertid kræver alle disse metoder formaldehydtværbinding for at stabilisere protein-DNA-interaktionerne og sonikering for at opløse kromatinet til efterfølgende oprensning. Sammen udelukker begge manipulationer muligheden for efterfølgende strukturelle og funktionelle undersøgelser af det rensede kromatin.
For at overvinde disse begrænsninger har vi tidligere udtænkt en metode, der anvender stedspecifik rekombination til at udtrække målrettede kromosomale domæner fra gær 11,12. I det væsentlige er det genomiske område af interesse omgivet af genkendelsessteder (RS) for den stedspecifikke R-rekombinase fra Zygosaccharomyces rouxi, samtidig med at den inkorporerer en gruppe af tre DNA-bindingssteder for det prokaryote transkriptionelle repressor LexA-protein (LexA) inden for samme region. Gærcellerne indeholder en ekspressionskassette til samtidig ekspression af R-rekombinase og et LexA-protein smeltet sammen med et tandemaffinitetsrensningsmærke (TAP). Efter induktionen af R-rekombinase udskærer enzymet effektivt målområdet fra kromosomet i form af et cirkulært kromatindomæne. Dette domæne kan renses via LexA-TAP-adapterproteinet, som binder til LexA DNA-bindingsstederne såvel som til en affinitetsstøtte. Denne metode er for nylig blevet brugt til at isolere forskellige kromatindomæner, der indeholder udvalgte replikationsoprindelser af gærkromosom III13.
En stor fordel ved denne ex vivo-tilgang er, at den giver mulighed for funktionelle analyser af det isolerede materiale. For eksempel kan replikationsoprindelsesdomæner, der er renset med denne metode, underkastes in vitro-replikationsassays for at vurdere effektiviteten af oprindelsesaffyring i et reagensglas fra native in vivo-samlede kromatinskabeloner. I sidste ende kan den biokemiske og funktionelle karakterisering af det isolerede materiale tillade rekonstitution af nukleare processer ved anvendelse af rensede proteiner sammen med den oprindelige kromatinskabelon. Sammenfattende åbner denne metode en spændende vej inden for kromatinforskning, da det vil være muligt at følge de kollektive sammensætnings- og strukturelle kromatinændringer i en bestemt genomisk region, der gennemgår en bestemt kromosomtransaktion.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Yeast strains</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Control Strain: MATa; ura3&#916;0; leu2&#916;0; his3&#916;1; met15&#916;0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td>
			<td></td>
			<td></td>
			<td>Section 1, see references 13 and 14</td>
		</tr>
		<tr>
			<td>Recombination Strain: MATa; ura3&#916;0; leu2&#916;0; his3&#916;1; met15&#916;0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td>
			<td></td>
			<td></td>
			<td>Section 1, see reference 13 and 14</td>
		</tr>
		<tr>
			<td>Plasmid</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>K238 plasmid</td>
			<td></td>
			<td></td>
			<td>Section 1, see reference 13 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>K071 Spike-in plasmid DNA</td>
			<td></td>
			<td></td>
			<td>Section 7.1, see reference 13 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Acetone</td>
			<td>Carl Roth</td>
			<td>5025.1</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium acetate (NH4Ac)</td>
			<td>Sigma Aldrich</td>
			<td>A7262</td>
			<td>Section 6 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium solution (NH4OH) 25%</td>
			<td>Merck Millipore</td>
			<td>533003</td>
			<td>Section 6 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium sulfate</td>
			<td>Santa Cruz</td>
			<td>Sc-29085</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Bacto agar</td>
			<td>BD (VWR)</td>
			<td>90000-760</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Bacto peptone</td>
			<td>BD (VWR)</td>
			<td>211820</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>&#946;-Mercaptoethanol</td>
			<td>Sigma Aldrich</td>
			<td>07604</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Chemiluminescent substrate kit</td>
			<td>ThermoFisher</td>
			<td>34580</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Di-Sodium Hydrogen phosphate dodecahydrate</td>
			<td>Merck</td>
			<td>1.06579.1000</td>
			<td>Section 2 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>ThermoFisher</td>
			<td>15508013</td>
			<td>Section 4 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Merck</td>
			<td>100983</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid (EDTA)</td>
			<td>Sigma Aldrich</td>
			<td>ED</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Galactose (20% (w/v) stock)</td>
			<td>Sigma Aldrich</td>
			<td>G0625-1KG&#160; /&#160; 5KG</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Gel loading dye (6x)</td>
			<td>BioLabs</td>
			<td>B7024A</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Glusose</td>
			<td>Sigma-Aldrich</td>
			<td>G8270</td>
			<td>Section 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Carl Roth</td>
			<td>.0079.4</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Glycogen (5 mg/mL)</td>
			<td>Invitrogen</td>
			<td>AM9510</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Hydrochloric acid (HCl)</td>
			<td>PanReac AppliChem</td>
			<td>182109.1211</td>
			<td>Section 2, 4 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Magnesium Acetate (MgAc)</td>
			<td>Bernd Kraft</td>
			<td>15274.2600/C035</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Magnesium chloride (MgCl2)</td>
			<td>Sigma Aldrich</td>
			<td>M8266</td>
			<td>Section 6 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Nu PAGE LDS sample buffer (4x)</td>
			<td>Invitrogen</td>
			<td>2399549</td>
			<td>Section 7.2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)</td>
			<td>Invitrogen</td>
			<td>15593-031</td>
			<td>Section 7.1 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Potassium chloride (KCl)</td>
			<td>Sigma</td>
			<td>P9541</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Radioactively labeled &#945;-32P dATP (3,000 Ci/mmol, 10 mCi/mL)</td>
			<td>Hartmann Analytic</td>
			<td>SRP-203</td>
			<td>Section 7.1 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>RadPrime labeling system</td>
			<td>ThermoFisher</td>
			<td>18428-011</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Raffinose (20% (w/v) stock)</td>
			<td>SERVA</td>
			<td>34140.03</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium chloride (NaCl)</td>
			<td>Merck</td>
			<td>K53710504142</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium citrate (Na3C6H5O7)</td>
			<td>Sigma-Aldrich</td>
			<td>71402</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium hydroxide (NaOH)</td>
			<td>Sigma Aldrich</td>
			<td>S5881</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )</td>
			<td>Alfa Aesar</td>
			<td>A11183</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium phosphate monobasic</td>
			<td>Sigma-Aldrich</td>
			<td>71496</td>
			<td>Section 2 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium&#160;azide</td>
			<td>Santa Cruz&#160;Biotechnology</td>
			<td>sc-208393</td>
			<td>Section 2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>&#160;Triethylamine</td>
			<td>Sigma Aldrich</td>
			<td>90340</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Tris base</td>
			<td>Chem Cruz</td>
			<td>SC-3715B</td>
			<td>Section 2 and 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td>X100</td>
			<td>Section 2 and 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Tween-20</td>
			<td>Bernd Kraft</td>
			<td>18014332</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>BD (VWR)</td>
			<td>212720</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Yeast mating factor alpha (1 &#181;g/mL stock )</td>
			<td>&#160;Biomol</td>
			<td>Y2016.5</td>
			<td>Section 3 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Yeast Synthetic Drop-out medium Supplements without LEUCINE</td>
			<td>Sigma Aldrich</td>
			<td>Y1376</td>
			<td>Section 1, see reference 14</td>
		</tr>
		<tr>
			<td>Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HpaI restriction enzyme (5,000 U/mL)</td>
			<td>NEB</td>
			<td>R0105S</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Protease and Phosphatase Inhibitor Cocktail (100x)</td>
			<td>ThermoFisher Scientific</td>
			<td>78446</td>
			<td>Section 4 
			Storage: Store at4 &#176;C</td>
		</tr>
		<tr>
			<td>Proteinase K (10 mg/mL)</td>
			<td>SERVA</td>
			<td>33756</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>RNase A (10 mg/mL)</td>
			<td>&#160;ThermoFisher</td>
			<td>EN0531</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>TEV protease (10000 U/&#181;L)</td>
			<td>NEB</td>
			<td>P8112S</td>
			<td>Section 5 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BcMag Epoxy-Activated Magnetic Beads</td>
			<td>Bioclone Inc.</td>
			<td>FC-102</td>
			<td>Section 2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Dry ice</td>
			<td></td>
			<td></td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Low-binding centrifuge tubes 2.0 mL</td>
			<td>Eppendorf</td>
			<td>22431102</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Microspin&#160;G-25 Columns</td>
			<td>Cytiva</td>
			<td>27-5325-01</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>Merck</td>
			<td>P7793</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Positive nylon membrane</td>
			<td>Biozol</td>
			<td>11MEMP0001</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>PVDF transfer membrane</td>
			<td>Immobilon-Merck Millipore</td>
			<td>IPVH00010</td>
			<td>Section 7.2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)</td>
			<td>Invitrogen</td>
			<td>&#160;NP0336BOX</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Syringe (25 mL) with luer fitting</td>
			<td>Henke Sass Wolf</td>
			<td>4200-000V0</td>
			<td>Section 3</td>
		</tr>
		<tr>
			<td>Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)</td>
			<td>Cytiva</td>
			<td>3030-917</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody</td>
			<td>Merck Millipore</td>
			<td>06-719</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate</td>
			<td>Invitrogen</td>
			<td>G21234</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins</td>
			<td>Sigma Aldrich</td>
			<td>P1291-500UL</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Rabbit IgG antibodies</td>
			<td>Sigma</td>
			<td>I5006-100MG</td>
			<td>Section 2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Primers (10 &#181;M)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ARS316: fwd 5&#39;- CGGCATTATCGTACACAACCT, rev 5&#39;- GTTCTTCGTTGCCTACATTTTCT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>K071 Spike-in plasmid DNA: fwd: 5&#39;-TTTTCGCTGCTTGTCCTTTT, rev 5&#39;- CATTTTCGTCCTCCCAACAT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>PCR fragment from yeast genomic DNA as a template &#160;for ARS316 amplification (for southern blot): fwd 5&#8217;- AAATTCTGCCCTTGATTCGT&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; rev 5&#8217;- TTTGTTTATCTCATCACTAAT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>PDC1: fwd 5&#39;- CATGATCAGATGGGGCTTCA, rev 5&#39;-ACCGGTGGTAGCGACTCTGT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Coffee grinder</td>
			<td>Gastroback</td>
			<td>42601</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Dewar flask</td>
			<td>NAL GENE</td>
			<td>4150-2000</td>
			<td>Section 3</td>
		</tr>
		<tr>
			<td>DynaMag TM-2 magnetic rack</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>Section 4, 5 and 6</td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Hybaid Mini10</td>
			<td>Ri418</td>
			<td>Section 2</td>
		</tr>
		<tr>
			<td>Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5424R</td>
			<td>Section 4 and 7.1</td>
		</tr>
		<tr>
			<td>UV-crosslinker</td>
			<td>Analytikjena</td>
			<td>95-0174-02</td>
			<td>Section 7.1</td>
		</tr>
	</tbody>
</table>

single-copy gene locus chromatin purification in saccharomyces cerevisiae

Den grundlæggende organisatoriske enhed af eukaryot kromatin er nukleosomkernepartiklen (NCP), som omfatter DNA indpakket ~ 1,7 gange omkring en histonoctammer. Kromatin defineres som enheden af NCP'er og adskillige andre proteinkomplekser, herunder transkriptionsfaktorer, kromatinremodellering og modificerende enzymer. Det er stadig uklart, hvordan disse protein-DNA-interaktioner orkestreres på niveauet af specifikke genomiske loci under forskellige stadier af cellecyklussen. Dette skyldes hovedsageligt de nuværende tekniske begrænsninger, som gør det udfordrende at opnå præcise målinger af sådanne dynamiske interaktioner. Her beskriver vi en forbedret metode, der kombinerer stedspecifik rekombination med en effektiv enkelttrins affinitetsrensningsprotokol for at isolere et enkeltkopi-gen-locus af interesse i dets oprindelige kromatintilstand. Metoden muliggør robust berigelse af målstedet over genomisk kromatin, hvilket gør denne teknik til en effektiv strategi til identifikation og kvantificering af proteininteraktioner på en upartisk og systematisk måde, for eksempel ved massespektrometri. Ud over sådanne sammensætningsanalyser afspejler naturligt chromatin renset ved denne metode sandsynligvis in vivo-situationen med hensyn til nukleosompositionering og histonmodifikationer og kan derfor underkastes yderligere strukturelle og biokemiske analyser af kromatin afledt af praktisk talt ethvert genomisk locus i gær.

The dynamic organization of eukaryotic genomes into chromatin compacts the DNA to fit within the confines of the nucleus while ensuring sufficient dynamics for gene expression and accessibility for regulatory factors. In part, this versatility is mediated by the nucleosome, the basic unit of chromatin, which comprises a core particle with 147 bp of DNA wrapped ~1.7 times around the histone octamer1. The nucleosome is a highly dynamic structure with respect to its composition, with numerous histone variants and posttranslational modifications (PTMs) on the N- and C-terminal histone tails. Furthermore, eukaryotic chromatin interacts with a multitude of other essential components, such as transcription factors, DNA and RNA processing machinery, architectural proteins, enzymes involved in chromatin remodeling and modification, and RNA molecules associated with chromatin. These crucial machineries involved in transcription, replication, and repair all require access to chromatin, which serves as the natural substrate for these processes. Consequently, comprehending the molecular mechanisms underlying these DNA transactions necessitates a precise definition of the collective alterations in chromatin structure at the specific genomic regions where these machineries converge and facilitate biological reactions.
Despite the identification of numerous chromatin factors through genetics and protein-protein interaction studies, performing direct, unbiased, and comprehensive analyses of chromatin interactions at particular genomic sites has remained a significant obstacle2,3. Initially, only highly abundant regions of the genome (i.e., repetitive loci) or multi-copy plasmids could be isolated in sufficient amounts and purity for mass spectrometric identification of the associated proteins4,5,6,7. A series of new approaches based on the direct hybridization of capture probes to chromatinized DNA, proximity biotinylation using the CRISPR-dCas9 system, or the binding of sequence-specific adapter proteins to the locus of interest have started to unravel the proteome of single-copy loci from yeast and mammalian genomes8,9,10. However, all these methods require formaldehyde crosslinking to stabilize the protein-DNA interactions and sonication to solubilize the chromatin for subsequent purification. Together, both manipulations exclude the possibility of subsequent structural and functional studies of the purified chromatin.
To overcome these limitations, we previously devised a methodology that employs site-specific recombination to extract targeted chromosomal domains from yeast11,12. In essence, the genomic region of interest is surrounded by recognition sites (RS) for the site-specific R-recombinase from Zygosaccharomyces rouxi while simultaneously incorporating a group of three DNA binding sites for the prokaryotic transcriptional repressor LexA protein (LexA) within the same region. The yeast cells contain an expression cassette for the simultaneous expression of R-recombinase and a LexA protein fused to a tandem affinity purification (TAP) tag. After the induction of R-recombinase, the enzyme efficiently excises the targeted region from the chromosome in the form of a circular chromatin domain. This domain can be purified via the LexA-TAP adapter protein, which binds to the LexA DNA binding sites, as well as to an affinity support. This method has been recently used to isolate distinct chromatin domains containing selected replication origins of yeast chromosome III13.
One major advantage of this ex vivo approach is that it allows for functional analyses of the isolated material. For example, replication origin domains purified with this method can be subjected to in vitro replication assays to assess the efficiency of origin firing in a test tube from native in vivo assembled chromatin templates. Ultimately, the biochemical and functional characterization of the isolated material may allow the reconstitution of nuclear processes using purified proteins together with the native chromatin template. In summary, this methodology opens an exciting avenue in chromatin research, as it will be possible to follow the collective compositional and structural chromatin changes of a specific genomic region undergoing a certain chromosomal transaction.

Forfatter Spotlight: Fremme af kromatinforskning og overvindelse af begrænsninger med en locus-specifik kromatinisoleringsprotokol med høj berigelse 

Enkelt-kopi gen locus kromatin oprensning i Saccharomyces cerevisiae

A eukaryotic nucleus is very crowded with many biological processes occurring simultaneously. The scope of our research is to understand how all of these processes are coordinated on our genomes without major accidents that would otherwise lead to genomic instability and human diseases. This protocol allows us to purify a specific locus of the genome in its native state, allowing both the compositional and functional characterization of the isolated material, such as the measurements of protein DNA interactions.This protocol enables an enormous level of enrichment of a targeted locus, which overcomes many current limitations of locus-specific chromatin isolation. The material has not been cross-linked. That also allows many downstream functional analysis, such as in vitro transcription or in vitro replication.This protocol enabled us to excise and purify distinct replication origins from yeast chromosomes, allowing us to perform a proteomic analysis and identify novel origin interacting chromatin factors, and therefore, advance the research field of DNA replication. This protocol enables in vitro replication studies using the purified origin material to examine chromatin states, histone modifications, and perform structural analysis on the native nucleosomal templates from endogenous chromosomes, advancing chromatin research.

Oprensningen af ~1,4 kb ARS316-kromatindomænet blev medieret af det konstitutivt udtrykte LexA-TAP-adapterprotein. For at fungere som en negativ kontrol udførte vi oprensninger ved hjælp af en isogen stamme, der udtrykker LexA-TAP, men ikke indeholder integrerede RS- og LexA-bindingssteder. Figur 3 illustrerer DNA-analyseresultatet fra et standardrensningseksperiment udført på både kontrol- og en rekombinationskompetent stamme rettet mod ARS316-locus. Efter DNA-isolering og restriktion...

Watch this Scientific Journal Video about Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol at JoVE.com

Denne protokol præsenterer en locus-specifik kromatinisoleringsmetode baseret på stedspecifik rekombination for at rense et enkeltkopi-gensted af interesse i dets oprindelige kromatinkontekst fra spirende gær, Saccharomyces cerevisiae.

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone ...

En eukaryot kerne er meget overfyldt med mange biologiske processer, der forekommer samtidigt. Formålet med vores forskning er at forstå, hvordan alle disse processer koordineres på vores genomer uden større ulykker, der ellers ville føre til genomisk ustabilitet og menneskelige sygdomme. Denne protokol giver os mulighed for at rense et specifikt sted for genomet i dets oprindelige tilstand, hvilket tillader både sammensætningsmæssig og funktionel karakterisering af det isolerede materiale, såsom målinger af protein-DNA-interaktioner.Denne protokol muliggør et enormt niveau af berigelse af et målrettet locus, som overvinder mange nuværende begrænsninger af locus-specifik kromatinisolering. Materialet er ikke blevet tværbundet. Det giver også mulighed for mange downstream funktionelle analyser, såsom in vitro transkription eller in vitro replikation.Denne protokol gjorde det muligt for os at punktafgifter og rense forskellige replikationsoprindelser fra gærkromosomer, hvilket giver os mulighed for at udføre en proteomisk analyse og identificere nye oprindelsesinteragerende kromatinfaktorer og derfor fremme forskningsområdet DNA-replikation. Denne protokol muliggør in vitro-replikationsundersøgelser ved hjælp af det oprensede oprindelsesmateriale til at undersøge kromatintilstande, histonmodifikationer og udføre strukturel analyse på de indfødte nukleosomale skabeloner fra endogene kromosomer, hvilket fremmer kromatinforskning.

single-copy-gene-locus-chromatin-purification-saccharomyces

Research

JoVE Journal

Biochemistry

Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone octamer. Chromatin is defined as the entity of NCPs and numerous other protein complexes, including transcription factors, chromatin remodeling and modifying enzymes. It is still unclear how these protein-DNA interactions are orchestrated at the level of specific genomic loci during different stages of the cell cycle. This is mainly due to the current technical limitations, which make it challenging to obtain precise measurements of such dynamic interactions. Here, we describe an improved method combining site-specific recombination with an efficient single-step affinity purification protocol to isolate a single-copy gene locus of interest in its native chromatin state. The method allows for the robust enrichment of the target locus over genomic chromatin, making this technique an effective strategy for identifying and quantifying protein interactions in an unbiased and systematic manner, for example by mass spectrometry. Further to such compositional analyses, native chromatin purified by this method likely reflects the in vivo situation regarding nucleosome positioning and histone modifications and is, therefore, amenable to further structural and biochemical analyses of chromatin derived from virtually any genomic locus in yeast.

This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.

Yeast Cell Culture and Cell Harvesting for Single-Copy Gene Locus Chromatin Purification

Begin by inoculating the control and recombination competent yeast strains from YPD plates into five milliliters of YPR medium, and grow the culture overnight at 30 degrees Celsius and 200 RPM. Next, scale up the culture by inoculating two milliliters into 100 milliliters of fresh YPR medium and growing it overnight at 30 degrees Celsius and 200 RPM. For each strain, dispense 1, 800 milliliters of autoclave yeast Peptone medium, and 200 milliliters of autoclave 20%raffinose solution into two 5 liter Erlenmeyer flasks.Inoculate each yeast strain with 0.2 optical density at 600 nanometers in the respective medium, and incubate for about six hours at 200 RPM, or until the cells reach the desired 1.0 optical density. Add 200 milliliters of 2%galactose and 110 microliters of yeast mating factor alpha or YMFA simultaneously to arrest cells in the G1 phase and incubate it for two hours. Transfer the cell suspension into one liter centrifuge buckets and centrifuge the bucket at 6, 000 G and four degrees Celsius for 10 minutes.Discard the supernatant and resuspend the cell pellets in 10 to 15 milliliters of distilled water. Next, seal a 25 milliliter syringe with a lure plug and place it inside a 50 milliliter conical tube filled with water. Transfer the cell suspension to the syringe assembly.Wash the centrifuge buckets with five milliliters of distilled water to collect the remaining cells. Then, centrifuge the assembly at 2, 397 G for 10 minutes at room temperature and discard the supernatant. Then remove the lure plug from the syringe and extrude the cells into liquid nitrogen to form cell spaghetti.Lastly, transfer the frozen cell spaghetti into a 50 milliliter conical tube and store it at minus 80 degrees Celsius until further use.

Gærcellekultur og cellehøstning til enkeltkopi-gen-locus-kromatinoprensning

Locus-Specific Chromatin Purification from Saccharomyces cerevisiae

Locus-Specific Chromatin Purification from Saccharomyces cerevisiae  

Begin cooling a commercial coffee grinder by grinding approximately 30 to 50 grams of dry ice twice, for 30 seconds each time. Discard the dry ice powder and mix three grams of frozen yeast cell spaghetti with approximately 30 to 50 grams of dry ice in the pre-cooled coffee grinder. Seal the junction between the cap and the grinder with Parafilm.Mix the yeast cell dry ice mix 10 times, for 30 seconds each, allowing 30-second intervals between every round. Transfer the resulting yeast cell dry ice powder to a plastic beaker, using a clean and dry spatula. After dry ice evaporation, add 2.25 milliliters of magnetic bead, or MB buffer, with protease and phosphatase inhibitors, to the yeast cell powder.After vigorously pipetting the cell buffer mixture, transfer the cell suspension to a 15-milliliter conical tube. Next, store 0.1%samples from the crude cell extracts for DNA, and 0.05%samples for protein analysis, at minus-20 degrees Celsius. Transfer the remaining cell suspension into low-binding two-milliliter reaction tubes, and separate cell debris by centrifuging the tubes.Once done, pull all supernatants into one 15-milliliter conical tube. Again, store 0.1%of the supernatant at minus-20 degrees Celsius for DNA, and 0.05%of the supernatant for protein analysis. Next, wash 500 microliters of immunoglobulin G-coupled magnetic bead slurry with 500 microliters of cold MB buffer, containing protease and phosphatase inhibitors, two times, for five minutes each, at four degrees Celsius, on rotation at 20 RPM.Incubate the magnetic beads in 500 microliters of cold MB buffer for one hour at four degrees Celsius, on rotation at 20 RPM, before removing the supernatant from the beads using a magnetic rack. Mix the equilibrated magnetic bead slurry with the cell lysate obtained earlier and pulled into a 15-milliliter conical tube. After incubating for two hours at four degrees Celsius and 20 RPM, transfer the complete magnetic bead cell lysate suspension to low-binding reaction tubes.Separate the magnetic beads carrying the chromatin rings of interest from the cell lysate, using a magnetic rack. Transfer the remaining flow-through from each tube to a fresh 15-milliliter conical tube, before storing some samples at minus-20 degrees Celsius for DNA and protein analysis. Next, suspend the magnetic bead from each 15-milliliter conical tube in 300 microliters of cold MB buffer, and combine the beads into one reaction tube.Perform five washes of 10 minutes each, using 750 microliters of cold MB buffer, containing protease and phosphatase inhibitors, at four degrees Celsius, while rotating at 20 RPM. Next, conduct the final wash with 750 microliters of cold MB buffer without protease and phosphatase inhibitors. Suspend the prepared beads in 40 microliters of cold MB buffer without protease and phosphatase inhibitors.

Locus-specifik kromatinoprensning fra Saccharomyces cerevisiae

TEV Protease-Mediated Elution and Denaturation Elution of the Chromatin Locus Purified from Saccharomyces cerevisiae

TEV Protease-Mediated Elution and Denaturation Elution of the Chromatin Locus Purified from Saccharomyces cerevisiae  

Release the lexA CBP chromatin ring complexes from the magnetic beads used to purify chromatin single-copy gene locus by incubating the bees with two microliters of 6xHis-tagged recombinant tobacco etch virus or TEV protease. After separating the bees from the final eluate using a magnetic rack transfer, the eluate containing cleaved chromatin rings to a new 1.5-milliliter reaction tube. Again, place the tubes on a magnetic rack to separate residual beads from the final eluate.Resuspend the beads in 750 microliters of cold ammonium carbonate buffer before storing some samples at 20 Celsius for DNA and protein analysis. From the final eluate, take out the samples and store them at 20 degrees Celsius for DNA and protein analysis. Further, take samples from the residual beads.Begin the denaturation elution by washing the magnetic beads two times in 750 microliters of cold ammonium carbonate buffer for 20 minutes each, four degrees Celsius rotating at 20 revolutions per minute. Next, add 500 microliters of 0.5 molar ammonium hydroxide to the beads to extract bound lexA chromatin complexes and incubate for 30 minutes at room temperature. Separate the beads from the suspension using a magnetic rack and transfer the eluate to a low binding reaction tube.Incubate the low binding reaction tube at room temperature for 30 minutes and separate the beads from the suspension using a magnetic rack. Once done, transfer the eluate to a low binding reaction tube. Resuspend the beads in 750 microliters of deionized water and collect samples for DNA and protein analysis.Lastly, obtain DNA and protein analysis samples from the final eluate. In the study, the purification efficiency of the ARS316 locus and the recombination strain was quantified and compared to the control locus PDC1. The ARS316 locus showed lower recovery in the flow through compared to PDC1.Although a fraction of chromatin rings remained bound to the TEV beads due to incomplete TEV protease cleavage, denaturation elution resulted in 80 to 90%ARS316 locus recovery. This corresponds to the high enrichment of ARS316 molecules in TEV beads and denaturation elution fractions when factoring in the size of the yeast genome compared to the control strain that showed no enrichment of ARS316 locus in any of the quantified fractions. After TEV elution, the beads showed a higher recovery percentage of the ARS316 locus as the TEV cleavage efficiency was not 100%This resulted in a fraction of chromatin rings remaining bound to the beads.However, the denaturing elusion showed 80 to 90%recovery of the ARS316 locus and the recombination strain corresponding to the high enrichment of ARS316 molecules when factoring in the size of the yeast genome.