Name: Autor im Rampenlicht: Weiterentwicklung der Chromatinforschung und Überwindung von Einschränkungen mit einem Locus-spezifischen Isolationsprotokoll mit hoher Anreicherung
Uploaded: 2023-11-17T13:20:00
Description: Watch this Scientific Journal Video about Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol at JoVE.com

Die Arbeiten im S.H.-Labor wurden von der DFG durch SFB1064 (Projekt-ID 213249687), den Europäischen Forschungsrat (ERC Starting Grant 852798 ConflictResolution) und die Helmholtz Gesellschaft unterstützt.

In der Materialtabelle finden Sie Einzelheiten zu allen Materialien und Instrumenten, die in diesem Protokoll verwendet werden. In Tabelle 1 finden Sie eine Liste der verwendeten Lösungen, Puffer und Medien.
1. Rekombinanter Hefestammaufbau
<ol><li>Um einen rekombinationskompetenten Hefestamm zu konstruieren, transformieren Sie das SbfI-verdaute Plasmid K238 in einen Hefestamm mit integrierten LexA-Bindungsstellen und RS-Rekombinationsstell...

Locus-spezifische Chromatinisolierung aus Hefezellen

<ol>
	<li>Kornberg, R. D., Lorch, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty-five+years+of+the+nucleosome,+fundamental+particle+of+the+eukaryote+chromosome.">Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome.</a> Cell. 98 (3), 285-294 (1999).</li><li>Gauchier, M., van Mierlo, G., Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+enrichment+of+specific+chromatin+loci.">Purification and enrichment of specific chromatin loci.</a> Nature Methods. 17 (4), 380-389 (2020).</li><li>Korthout, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoding+the+chromatin+proteome+of+a+single+genomic+locus+by+DNA+sequencing.">Decoding the chromatin proteome of a single genomic locus by DNA sequencing.</a> PLoS Biology. 16 (7), e2005542 (2018).</li><li>Ant&#227;o, J. M., Mason, J. M., D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+landscape+at+Drosophila+melanogaster+telomere-associated+sequence+repeats.">Protein landscape at Drosophila melanogaster telomere-associated sequence repeats.</a> Molecular and Cellular Biology. 32 (12), 2170-2182 (2012).</li><li>D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+proteins+associated+with+specific+genomic+loci.">Purification of proteins associated with specific genomic loci.</a> Cell. 136 (1), 175-186 (2009).</li><li>Ide, S., Dejardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=End-targeting+proteomics+of+isolated+chromatin+segments+of+a+mammalian+ribosomal+RNA+gene+promoter.">End-targeting proteomics of isolated chromatin segments of a mammalian ribosomal RNA gene promoter.</a> Nature Communications. 6, 6674 (2015).</li><li>Unnikrishnan, A., Gafken, P. R., Tsukiyama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+changes+in+histone+acetylation+regulate+origins+of+DNA+replication.">Dynamic changes in histone acetylation regulate origins of DNA replication.</a> Nature Structural &amp;amp; Molecular Biology. 17 (4), 430 (2010).</li><li>Buxton, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+protein-DNA+interactions+in+human+alphoid+chromatin+via+hybridization+capture+and+mass+spectrometry.">Elucidating protein-DNA interactions in human alphoid chromatin via hybridization capture and mass spectrometry.</a> Journal of Proteome Research. 16 (9), 3433-3442 (2017).</li><li>Kennedy-Darling, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+chromatin-associated+proteins+via+sequence-specific+capture+and+mass+spectrometric+protein+identification+in+Saccharomyces+cerevisiae.">Discovery of chromatin-associated proteins via sequence-specific capture and mass spectrometric protein identification in Saccharomyces cerevisiae.</a> Journal of Proteome Research. 13 (8), 3810-3825 (2014).</li><li>Liu, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRi-based+genome-scale+identification+of+functional+long+noncoding+RNA+loci+in+human+cells.">CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells.</a> Science. 355, 7111 (2017).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+specific+chromatin+domains+from+single-copy+gene+loci+in+Saccharomyces+cerevisiae.">Purification of specific chromatin domains from single-copy gene loci in Saccharomyces cerevisiae.</a> Functional Analysis of DNA and Chromatin. 1094, 329-341 (2014).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compositional+and+structural+analysis+of+selected+chromosomal+domains+from+Saccharomyces+cerevisiae.">Compositional and structural analysis of selected chromosomal domains from Saccharomyces cerevisiae.</a> Nucleic Acids Research. 42 (1), 2 (2014).</li><li>Wei&#946;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-copy+locus+proteomics+of+early-+and+late-firing+DNA+replication+origins+identifies+a+role+of+Ask1/DASH+complex+in+replication+timing+control.">Single-copy locus proteomics of early- and late-firing DNA replication origins identifies a role of Ask1/DASH complex in replication timing control.</a> Cell Reports. 42 (2), 112045 (2023).</li><li>Gietz, R. D., Schiestl, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+yeast+transformation+using+the+LiAc/SS+carrier+DNA/PEG+method.">High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method.</a> Nature Protocols. 2 (1), 31-34 (2007).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Towbin, H., Staehelin, T., Gordon, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+transfer+of+proteins+from+polyacrylamide+gels+to+nitrocellulose+sheets:+procedure+and+some+applications.">Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (9), 4350-4354 (1979).</li><li>Western blot membrane stripping for restaining protocol. Abcam Available from: <a target="_blank" href="https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol">https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol</a> (2023)</li><li>Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Locus-specific+chromatin+isolation.">Locus-specific chromatin isolation.</a> Nature Reviews. Molecular Cell Biology. 21 (5), 249-250 (2020).</li></ol>

Die Identifizierung der Faktoren und der Chromatinlandschaft einer bestimmten genomischen Zielregion stellt nach wie vor eine große Herausforderung in der Chromatinforschungdar 18. Dieses Protokoll beschreibt ein effizientes System zur gezielten Exzision und Reinigung bestimmter Chromatindomänen aus Hefechromosomen. Unseres Wissens nach überwinden die Reinheit und Ausbeute dieser einstufigen Aufreinigung viele der Einschränkungen von Locus-spezifischen Chromatin-Aufreinigungsmethoden, wodurch ...

Die dynamische Organisation eukaryotischer Genome in Chromatin verdichtet die DNA, um in die Grenzen des Zellkerns zu passen, während gleichzeitig eine ausreichende Dynamik für die Genexpression und die Zugänglichkeit für regulatorische Faktoren gewährleistet wird. Diese Vielseitigkeit wird zum Teil durch das Nukleosom vermittelt, die Grundeinheit des Chromatins, das aus einem Kernpartikel mit 147 bp DNA besteht, das ~1,7-mal um das Histon-Oktamer1 gewickelt ist. Das Nukleosom ist eine hochdynamische Struktur in Bezug auf seine Zusammensetzung, mit zahlreichen Histonvarianten und posttranslationalen Modifikationen (PTMs) an den N- und C-terminalen Histonschwänzen. Darüber hinaus interagiert das eukaryotische Chromatin mit einer Vielzahl anderer essentieller Komponenten, wie z. B. Transkriptionsfaktoren, DNA- und RNA-Verarbeitungsmaschinen, Architekturproteinen, Enzymen, die am Umbau und der Modifikation von Chromatin beteiligt sind, und RNA-Molekülen, die mit Chromatin assoziiert sind. Diese wichtigen Mechanismen, die an der Transkription, Replikation und Reparatur beteiligt sind, benötigen alle Zugang zu Chromatin, das als natürliches Substrat für diese Prozesse dient. Um die molekularen Mechanismen zu verstehen, die diesen DNA-Transaktionen zugrunde liegen, ist daher eine genaue Definition der kollektiven Veränderungen in der Chromatinstruktur in den spezifischen Genomregionen erforderlich, in denen diese Maschinerien konvergieren und biologische Reaktionen erleichtern.
Trotz der Identifizierung zahlreicher Chromatinfaktoren durch genetische und Protein-Protein-Interaktionsstudien ist die Durchführung direkter, unvoreingenommener und umfassender Analysen von Chromatininteraktionen an bestimmten genomischen Stellen nach wie vor ein erhebliches Hindernis 2,3. Ursprünglich konnten nur sehr häufig vorkommende Regionen des Genoms (d.h. repetitive Loci) oder Multikopienplasmide in ausreichender Menge und Reinheit für die massenspektrometrische Identifizierung der assoziierten Proteine isoliertwerden 4,5,6,7. Eine Reihe neuer Ansätze, die auf der direkten Hybridisierung von Fängersonden mit chromatinisierter DNA, der Proximity-Biotinylierung mit dem CRISPR-dCas9-System oder der Bindung sequenzspezifischer Adapterproteine an den interessierenden Locus basieren, haben begonnen, das Proteom von Einzelkopien-Loci aus Hefe- und Säugetiergenomen zu entschlüsseln 8,9,10. Alle diese Methoden erfordern jedoch eine Formaldehydvernetzung, um die Protein-DNA-Wechselwirkungen zu stabilisieren, und eine Beschallung, um das Chromatin für die anschließende Reinigung zu lösen. Beide Manipulationen zusammen schließen die Möglichkeit nachfolgender struktureller und funktioneller Studien des gereinigten Chromatins aus.
Um diese Einschränkungen zu überwinden, haben wir zuvor eine Methode entwickelt, die ortsspezifische Rekombination verwendet, um gezielte chromosomale Domänen aus Hefe zu extrahieren11,12. Im Wesentlichen ist die interessierende genomische Region von Erkennungsstellen (RS) für die ortsspezifische R-Rekombinase aus Zygosaccharomyces rouxi umgeben, während gleichzeitig eine Gruppe von drei DNA-Bindungsstellen für den prokaryotischen Transkriptionsrepressor LexA-Protein (LexA) innerhalb derselben Region eingebaut wird. Die Hefezellen enthalten eine Expressionskassette für die gleichzeitige Expression von R-Rekombinase und einem LexA-Protein, das mit einem Tandem-Affinitätsreinigungstag (TAP) fusioniert ist. Nach der Induktion der R-Rekombinase schneidet das Enzym die Zielregion in Form einer zirkulären Chromatindomäne effizient aus dem Chromosom heraus. Diese Domäne kann über das LexA-TAP-Adapterprotein, das an die LexA-DNA-Bindungsstellen bindet, sowie an einen Affinitätsträger gereinigt werden. Diese Methode wurde kürzlich verwendet, um verschiedene Chromatindomänen zu isolieren, die ausgewählte Replikationsursprünge des Hefechromosoms III13 enthalten.
Ein großer Vorteil dieses Ex-vivo-Ansatzes besteht darin, dass er funktionelle Analysen des isolierten Materials ermöglicht. Zum Beispiel können Replikationsursprungsdomänen, die mit dieser Methode gereinigt wurden, In-vitro-Replikationsassays unterzogen werden, um die Effizienz des Ursprungsfeuers in einem Reagenzglas aus nativen in vivo assemblierten Chromatin-Matrizen zu bewerten. Letztendlich könnte die biochemische und funktionelle Charakterisierung des isolierten Materials die Rekonstitution von Kernprozessen unter Verwendung von gereinigten Proteinen zusammen mit dem nativen Chromatin-Template ermöglichen. Zusammenfassend lässt sich sagen, dass diese Methodik einen spannenden Weg in der Chromatinforschung eröffnet, da es möglich sein wird, die kollektiven Veränderungen der Zusammensetzung und der Struktur des Chromatins einer bestimmten Genomregion zu verfolgen, die eine bestimmte chromosomale Transaktion durchläuft.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Yeast strains</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Control Strain: MATa; ura3&#916;0; leu2&#916;0; his3&#916;1; met15&#916;0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td>
			<td></td>
			<td></td>
			<td>Section 1, see references 13 and 14</td>
		</tr>
		<tr>
			<td>Recombination Strain: MATa; ura3&#916;0; leu2&#916;0; his3&#916;1; met15&#916;0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td>
			<td></td>
			<td></td>
			<td>Section 1, see reference 13 and 14</td>
		</tr>
		<tr>
			<td>Plasmid</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>K238 plasmid</td>
			<td></td>
			<td></td>
			<td>Section 1, see reference 13 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>K071 Spike-in plasmid DNA</td>
			<td></td>
			<td></td>
			<td>Section 7.1, see reference 13 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Acetone</td>
			<td>Carl Roth</td>
			<td>5025.1</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium acetate (NH4Ac)</td>
			<td>Sigma Aldrich</td>
			<td>A7262</td>
			<td>Section 6 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium solution (NH4OH) 25%</td>
			<td>Merck Millipore</td>
			<td>533003</td>
			<td>Section 6 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium sulfate</td>
			<td>Santa Cruz</td>
			<td>Sc-29085</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Bacto agar</td>
			<td>BD (VWR)</td>
			<td>90000-760</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Bacto peptone</td>
			<td>BD (VWR)</td>
			<td>211820</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>&#946;-Mercaptoethanol</td>
			<td>Sigma Aldrich</td>
			<td>07604</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Chemiluminescent substrate kit</td>
			<td>ThermoFisher</td>
			<td>34580</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Di-Sodium Hydrogen phosphate dodecahydrate</td>
			<td>Merck</td>
			<td>1.06579.1000</td>
			<td>Section 2 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>ThermoFisher</td>
			<td>15508013</td>
			<td>Section 4 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Merck</td>
			<td>100983</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid (EDTA)</td>
			<td>Sigma Aldrich</td>
			<td>ED</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Galactose (20% (w/v) stock)</td>
			<td>Sigma Aldrich</td>
			<td>G0625-1KG&#160; /&#160; 5KG</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Gel loading dye (6x)</td>
			<td>BioLabs</td>
			<td>B7024A</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Glusose</td>
			<td>Sigma-Aldrich</td>
			<td>G8270</td>
			<td>Section 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Carl Roth</td>
			<td>.0079.4</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Glycogen (5 mg/mL)</td>
			<td>Invitrogen</td>
			<td>AM9510</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Hydrochloric acid (HCl)</td>
			<td>PanReac AppliChem</td>
			<td>182109.1211</td>
			<td>Section 2, 4 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Magnesium Acetate (MgAc)</td>
			<td>Bernd Kraft</td>
			<td>15274.2600/C035</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Magnesium chloride (MgCl2)</td>
			<td>Sigma Aldrich</td>
			<td>M8266</td>
			<td>Section 6 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Nu PAGE LDS sample buffer (4x)</td>
			<td>Invitrogen</td>
			<td>2399549</td>
			<td>Section 7.2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)</td>
			<td>Invitrogen</td>
			<td>15593-031</td>
			<td>Section 7.1 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Potassium chloride (KCl)</td>
			<td>Sigma</td>
			<td>P9541</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Radioactively labeled &#945;-32P dATP (3,000 Ci/mmol, 10 mCi/mL)</td>
			<td>Hartmann Analytic</td>
			<td>SRP-203</td>
			<td>Section 7.1 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>RadPrime labeling system</td>
			<td>ThermoFisher</td>
			<td>18428-011</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Raffinose (20% (w/v) stock)</td>
			<td>SERVA</td>
			<td>34140.03</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium chloride (NaCl)</td>
			<td>Merck</td>
			<td>K53710504142</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium citrate (Na3C6H5O7)</td>
			<td>Sigma-Aldrich</td>
			<td>71402</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium hydroxide (NaOH)</td>
			<td>Sigma Aldrich</td>
			<td>S5881</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )</td>
			<td>Alfa Aesar</td>
			<td>A11183</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium phosphate monobasic</td>
			<td>Sigma-Aldrich</td>
			<td>71496</td>
			<td>Section 2 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium&#160;azide</td>
			<td>Santa Cruz&#160;Biotechnology</td>
			<td>sc-208393</td>
			<td>Section 2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>&#160;Triethylamine</td>
			<td>Sigma Aldrich</td>
			<td>90340</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Tris base</td>
			<td>Chem Cruz</td>
			<td>SC-3715B</td>
			<td>Section 2 and 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td>X100</td>
			<td>Section 2 and 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Tween-20</td>
			<td>Bernd Kraft</td>
			<td>18014332</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>BD (VWR)</td>
			<td>212720</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Yeast mating factor alpha (1 &#181;g/mL stock )</td>
			<td>&#160;Biomol</td>
			<td>Y2016.5</td>
			<td>Section 3 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Yeast Synthetic Drop-out medium Supplements without LEUCINE</td>
			<td>Sigma Aldrich</td>
			<td>Y1376</td>
			<td>Section 1, see reference 14</td>
		</tr>
		<tr>
			<td>Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HpaI restriction enzyme (5,000 U/mL)</td>
			<td>NEB</td>
			<td>R0105S</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Protease and Phosphatase Inhibitor Cocktail (100x)</td>
			<td>ThermoFisher Scientific</td>
			<td>78446</td>
			<td>Section 4 
			Storage: Store at4 &#176;C</td>
		</tr>
		<tr>
			<td>Proteinase K (10 mg/mL)</td>
			<td>SERVA</td>
			<td>33756</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>RNase A (10 mg/mL)</td>
			<td>&#160;ThermoFisher</td>
			<td>EN0531</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>TEV protease (10000 U/&#181;L)</td>
			<td>NEB</td>
			<td>P8112S</td>
			<td>Section 5 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BcMag Epoxy-Activated Magnetic Beads</td>
			<td>Bioclone Inc.</td>
			<td>FC-102</td>
			<td>Section 2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Dry ice</td>
			<td></td>
			<td></td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Low-binding centrifuge tubes 2.0 mL</td>
			<td>Eppendorf</td>
			<td>22431102</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Microspin&#160;G-25 Columns</td>
			<td>Cytiva</td>
			<td>27-5325-01</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>Merck</td>
			<td>P7793</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Positive nylon membrane</td>
			<td>Biozol</td>
			<td>11MEMP0001</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>PVDF transfer membrane</td>
			<td>Immobilon-Merck Millipore</td>
			<td>IPVH00010</td>
			<td>Section 7.2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)</td>
			<td>Invitrogen</td>
			<td>&#160;NP0336BOX</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Syringe (25 mL) with luer fitting</td>
			<td>Henke Sass Wolf</td>
			<td>4200-000V0</td>
			<td>Section 3</td>
		</tr>
		<tr>
			<td>Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)</td>
			<td>Cytiva</td>
			<td>3030-917</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody</td>
			<td>Merck Millipore</td>
			<td>06-719</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate</td>
			<td>Invitrogen</td>
			<td>G21234</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins</td>
			<td>Sigma Aldrich</td>
			<td>P1291-500UL</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Rabbit IgG antibodies</td>
			<td>Sigma</td>
			<td>I5006-100MG</td>
			<td>Section 2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Primers (10 &#181;M)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ARS316: fwd 5&#39;- CGGCATTATCGTACACAACCT, rev 5&#39;- GTTCTTCGTTGCCTACATTTTCT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>K071 Spike-in plasmid DNA: fwd: 5&#39;-TTTTCGCTGCTTGTCCTTTT, rev 5&#39;- CATTTTCGTCCTCCCAACAT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>PCR fragment from yeast genomic DNA as a template &#160;for ARS316 amplification (for southern blot): fwd 5&#8217;- AAATTCTGCCCTTGATTCGT&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; rev 5&#8217;- TTTGTTTATCTCATCACTAAT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>PDC1: fwd 5&#39;- CATGATCAGATGGGGCTTCA, rev 5&#39;-ACCGGTGGTAGCGACTCTGT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Coffee grinder</td>
			<td>Gastroback</td>
			<td>42601</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Dewar flask</td>
			<td>NAL GENE</td>
			<td>4150-2000</td>
			<td>Section 3</td>
		</tr>
		<tr>
			<td>DynaMag TM-2 magnetic rack</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>Section 4, 5 and 6</td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Hybaid Mini10</td>
			<td>Ri418</td>
			<td>Section 2</td>
		</tr>
		<tr>
			<td>Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5424R</td>
			<td>Section 4 and 7.1</td>
		</tr>
		<tr>
			<td>UV-crosslinker</td>
			<td>Analytikjena</td>
			<td>95-0174-02</td>
			<td>Section 7.1</td>
		</tr>
	</tbody>
</table>

single-copy gene locus chromatin purification in saccharomyces cerevisiae

Die grundlegende Organisationseinheit des eukaryotischen Chromatins ist das Nukleosomenkernpartikel (NCP), das aus DNA besteht, die ~1,7-mal um ein Histon-Oktamer gewickelt ist. Chromatin ist definiert als die Entität von NCPs und zahlreichen anderen Proteinkomplexen, einschließlich Transkriptionsfaktoren, Chromatin-Remodeling und modifizierenden Enzymen. Es ist noch unklar, wie diese Protein-DNA-Interaktionen auf der Ebene spezifischer genomischer Loci in verschiedenen Stadien des Zellzyklus orchestriert werden. Dies ist vor allem auf die derzeitigen technischen Einschränkungen zurückzuführen, die es schwierig machen, präzise Messungen solcher dynamischen Wechselwirkungen zu erhalten. Hier beschreiben wir eine verbesserte Methode, die ortsspezifische Rekombination mit einem effizienten einstufigen Affinitätsreinigungsprotokoll kombiniert, um einen Genlocus von Interesse in seinem nativen Chromatinzustand zu isolieren. Die Methode ermöglicht die robuste Anreicherung des Zielortes über genomisches Chromatin, was diese Technik zu einer effektiven Strategie zur unvoreingenommenen und systematischen Identifizierung und Quantifizierung von Proteininteraktionen macht, z. B. durch Massenspektrometrie. Zusätzlich zu solchen Zusammensetzungsanalysen spiegelt natives Chromatin, das mit dieser Methode gereinigt wurde, wahrscheinlich die In-vivo-Situation in Bezug auf Nukleosomenpositionierung und Histonmodifikationen wider und ist daher für weitere strukturelle und biochemische Analysen von Chromatin zugänglich, das von praktisch jedem genomischen Locus in Hefe stammt.

The dynamic organization of eukaryotic genomes into chromatin compacts the DNA to fit within the confines of the nucleus while ensuring sufficient dynamics for gene expression and accessibility for regulatory factors. In part, this versatility is mediated by the nucleosome, the basic unit of chromatin, which comprises a core particle with 147 bp of DNA wrapped ~1.7 times around the histone octamer1. The nucleosome is a highly dynamic structure with respect to its composition, with numerous histone variants and posttranslational modifications (PTMs) on the N- and C-terminal histone tails. Furthermore, eukaryotic chromatin interacts with a multitude of other essential components, such as transcription factors, DNA and RNA processing machinery, architectural proteins, enzymes involved in chromatin remodeling and modification, and RNA molecules associated with chromatin. These crucial machineries involved in transcription, replication, and repair all require access to chromatin, which serves as the natural substrate for these processes. Consequently, comprehending the molecular mechanisms underlying these DNA transactions necessitates a precise definition of the collective alterations in chromatin structure at the specific genomic regions where these machineries converge and facilitate biological reactions.
Despite the identification of numerous chromatin factors through genetics and protein-protein interaction studies, performing direct, unbiased, and comprehensive analyses of chromatin interactions at particular genomic sites has remained a significant obstacle2,3. Initially, only highly abundant regions of the genome (i.e., repetitive loci) or multi-copy plasmids could be isolated in sufficient amounts and purity for mass spectrometric identification of the associated proteins4,5,6,7. A series of new approaches based on the direct hybridization of capture probes to chromatinized DNA, proximity biotinylation using the CRISPR-dCas9 system, or the binding of sequence-specific adapter proteins to the locus of interest have started to unravel the proteome of single-copy loci from yeast and mammalian genomes8,9,10. However, all these methods require formaldehyde crosslinking to stabilize the protein-DNA interactions and sonication to solubilize the chromatin for subsequent purification. Together, both manipulations exclude the possibility of subsequent structural and functional studies of the purified chromatin.
To overcome these limitations, we previously devised a methodology that employs site-specific recombination to extract targeted chromosomal domains from yeast11,12. In essence, the genomic region of interest is surrounded by recognition sites (RS) for the site-specific R-recombinase from Zygosaccharomyces rouxi while simultaneously incorporating a group of three DNA binding sites for the prokaryotic transcriptional repressor LexA protein (LexA) within the same region. The yeast cells contain an expression cassette for the simultaneous expression of R-recombinase and a LexA protein fused to a tandem affinity purification (TAP) tag. After the induction of R-recombinase, the enzyme efficiently excises the targeted region from the chromosome in the form of a circular chromatin domain. This domain can be purified via the LexA-TAP adapter protein, which binds to the LexA DNA binding sites, as well as to an affinity support. This method has been recently used to isolate distinct chromatin domains containing selected replication origins of yeast chromosome III13.
One major advantage of this ex vivo approach is that it allows for functional analyses of the isolated material. For example, replication origin domains purified with this method can be subjected to in vitro replication assays to assess the efficiency of origin firing in a test tube from native in vivo assembled chromatin templates. Ultimately, the biochemical and functional characterization of the isolated material may allow the reconstitution of nuclear processes using purified proteins together with the native chromatin template. In summary, this methodology opens an exciting avenue in chromatin research, as it will be possible to follow the collective compositional and structural chromatin changes of a specific genomic region undergoing a certain chromosomal transaction.

Autor im Rampenlicht: Weiterentwicklung der Chromatinforschung und Überwindung von Einschränkungen mit einem Locus-spezifischen Isolationsprotokoll mit hoher Anreicherung 

Einzelkopien-Genlocus-Chromatin-Aufreinigung in Saccharomyces cerevisiae

A eukaryotic nucleus is very crowded with many biological processes occurring simultaneously. The scope of our research is to understand how all of these processes are coordinated on our genomes without major accidents that would otherwise lead to genomic instability and human diseases. This protocol allows us to purify a specific locus of the genome in its native state, allowing both the compositional and functional characterization of the isolated material, such as the measurements of protein DNA interactions.This protocol enables an enormous level of enrichment of a targeted locus, which overcomes many current limitations of locus-specific chromatin isolation. The material has not been cross-linked. That also allows many downstream functional analysis, such as in vitro transcription or in vitro replication.This protocol enabled us to excise and purify distinct replication origins from yeast chromosomes, allowing us to perform a proteomic analysis and identify novel origin interacting chromatin factors, and therefore, advance the research field of DNA replication. This protocol enables in vitro replication studies using the purified origin material to examine chromatin states, histone modifications, and perform structural analysis on the native nucleosomal templates from endogenous chromosomes, advancing chromatin research.

Die Aufreinigung der ~1,4 kb ARS316 Chromatindomäne wurde durch das konstitutiv exprimierte LexA-TAP Adapterprotein vermittelt. Um als Negativkontrolle zu dienen, führten wir Aufreinigungen mit einem isogenen Stamm durch, der LexA-TAP exprimiert, aber keine integrierten RS- und LexA-Bindungsstellen enthält. Abbildung 3 zeigt das Ergebnis der DNA-Analyse eines Standard-Aufreinigungsexperiments, das sowohl an der Kontrolle als auch an einem rekombinationskompetenten Stamm durchgeführt wurd...

Watch this Scientific Journal Video about Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol at JoVE.com

Dieses Protokoll stellt eine Locus-spezifische Chromatin-Isolierungsmethode vor, die auf ortsspezifischer Rekombination basiert, um einen interessierenden Single-Copy-Genlocus in seinem nativen Chromatinkontext aus knospender Hefe, Saccharomyces cerevisiae, zu reinigen.

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone ...

Ein eukaryotischer Kern ist sehr überfüllt und viele biologische Prozesse laufen gleichzeitig ab. Ziel unserer Forschung ist es, zu verstehen, wie all diese Prozesse auf unseren Genomen koordiniert werden, ohne dass es zu größeren Unfällen kommt, die sonst zu genomischer Instabilität und menschlichen Krankheiten führen würden. Dieses Protokoll ermöglicht es uns, einen bestimmten Locus des Genoms in seinem nativen Zustand zu reinigen, was sowohl die Zusammensetzung als auch die funktionelle Charakterisierung des isolierten Materials ermöglicht, wie z. B. die Messung von Protein-DNA-Interaktionen.Dieses Protokoll ermöglicht ein enormes Maß an Anreicherung eines Ziellocus, wodurch viele derzeitige Einschränkungen der locusspezifischen Chromatinisolierung überwunden werden. Das Material wurde nicht vernetzt. Dies ermöglicht auch viele nachgelagerte Funktionsanalysen, wie z. B. die In-vitro-Transkription oder die In-vitro-Replikation.Dieses Protokoll ermöglichte es uns, unterschiedliche Replikationsursprünge aus Hefechromosomen herauszuschneiden und zu reinigen, was es uns ermöglichte, eine proteomische Analyse durchzuführen und neuartige interagierende Chromatinfaktoren zu identifizieren und somit das Forschungsfeld der DNA-Replikation voranzutreiben. Dieses Protokoll ermöglicht In-vitro-Replikationsstudien mit dem gereinigten Ursprungsmaterial, um Chromatinzustände und Histonmodifikationen zu untersuchen und Strukturanalysen an den nativen nukleosomalen Templates von endogenen Chromosomen durchzuführen, wodurch die Chromatinforschung vorangebracht wird.

single-copy-gene-locus-chromatin-purification-saccharomyces

Research

JoVE Journal

Biochemistry

Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone octamer. Chromatin is defined as the entity of NCPs and numerous other protein complexes, including transcription factors, chromatin remodeling and modifying enzymes. It is still unclear how these protein-DNA interactions are orchestrated at the level of specific genomic loci during different stages of the cell cycle. This is mainly due to the current technical limitations, which make it challenging to obtain precise measurements of such dynamic interactions. Here, we describe an improved method combining site-specific recombination with an efficient single-step affinity purification protocol to isolate a single-copy gene locus of interest in its native chromatin state. The method allows for the robust enrichment of the target locus over genomic chromatin, making this technique an effective strategy for identifying and quantifying protein interactions in an unbiased and systematic manner, for example by mass spectrometry. Further to such compositional analyses, native chromatin purified by this method likely reflects the in vivo situation regarding nucleosome positioning and histone modifications and is, therefore, amenable to further structural and biochemical analyses of chromatin derived from virtually any genomic locus in yeast.

This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.

Forschung

Biochemie

Yeast Cell Culture and Cell Harvesting for Single-Copy Gene Locus Chromatin Purification

Begin by inoculating the control and recombination competent yeast strains from YPD plates into five milliliters of YPR medium, and grow the culture overnight at 30 degrees Celsius and 200 RPM. Next, scale up the culture by inoculating two milliliters into 100 milliliters of fresh YPR medium and growing it overnight at 30 degrees Celsius and 200 RPM. For each strain, dispense 1, 800 milliliters of autoclave yeast Peptone medium, and 200 milliliters of autoclave 20%raffinose solution into two 5 liter Erlenmeyer flasks.Inoculate each yeast strain with 0.2 optical density at 600 nanometers in the respective medium, and incubate for about six hours at 200 RPM, or until the cells reach the desired 1.0 optical density. Add 200 milliliters of 2%galactose and 110 microliters of yeast mating factor alpha or YMFA simultaneously to arrest cells in the G1 phase and incubate it for two hours. Transfer the cell suspension into one liter centrifuge buckets and centrifuge the bucket at 6, 000 G and four degrees Celsius for 10 minutes.Discard the supernatant and resuspend the cell pellets in 10 to 15 milliliters of distilled water. Next, seal a 25 milliliter syringe with a lure plug and place it inside a 50 milliliter conical tube filled with water. Transfer the cell suspension to the syringe assembly.Wash the centrifuge buckets with five milliliters of distilled water to collect the remaining cells. Then, centrifuge the assembly at 2, 397 G for 10 minutes at room temperature and discard the supernatant. Then remove the lure plug from the syringe and extrude the cells into liquid nitrogen to form cell spaghetti.Lastly, transfer the frozen cell spaghetti into a 50 milliliter conical tube and store it at minus 80 degrees Celsius until further use.

Hefezellkultur und Zellernte für die Einzelkopie-Chromatin-Reinigung des Genlocus

Locus-Specific Chromatin Purification from Saccharomyces cerevisiae

Locus-Specific Chromatin Purification from Saccharomyces cerevisiae  

Begin cooling a commercial coffee grinder by grinding approximately 30 to 50 grams of dry ice twice, for 30 seconds each time. Discard the dry ice powder and mix three grams of frozen yeast cell spaghetti with approximately 30 to 50 grams of dry ice in the pre-cooled coffee grinder. Seal the junction between the cap and the grinder with Parafilm.Mix the yeast cell dry ice mix 10 times, for 30 seconds each, allowing 30-second intervals between every round. Transfer the resulting yeast cell dry ice powder to a plastic beaker, using a clean and dry spatula. After dry ice evaporation, add 2.25 milliliters of magnetic bead, or MB buffer, with protease and phosphatase inhibitors, to the yeast cell powder.After vigorously pipetting the cell buffer mixture, transfer the cell suspension to a 15-milliliter conical tube. Next, store 0.1%samples from the crude cell extracts for DNA, and 0.05%samples for protein analysis, at minus-20 degrees Celsius. Transfer the remaining cell suspension into low-binding two-milliliter reaction tubes, and separate cell debris by centrifuging the tubes.Once done, pull all supernatants into one 15-milliliter conical tube. Again, store 0.1%of the supernatant at minus-20 degrees Celsius for DNA, and 0.05%of the supernatant for protein analysis. Next, wash 500 microliters of immunoglobulin G-coupled magnetic bead slurry with 500 microliters of cold MB buffer, containing protease and phosphatase inhibitors, two times, for five minutes each, at four degrees Celsius, on rotation at 20 RPM.Incubate the magnetic beads in 500 microliters of cold MB buffer for one hour at four degrees Celsius, on rotation at 20 RPM, before removing the supernatant from the beads using a magnetic rack. Mix the equilibrated magnetic bead slurry with the cell lysate obtained earlier and pulled into a 15-milliliter conical tube. After incubating for two hours at four degrees Celsius and 20 RPM, transfer the complete magnetic bead cell lysate suspension to low-binding reaction tubes.Separate the magnetic beads carrying the chromatin rings of interest from the cell lysate, using a magnetic rack. Transfer the remaining flow-through from each tube to a fresh 15-milliliter conical tube, before storing some samples at minus-20 degrees Celsius for DNA and protein analysis. Next, suspend the magnetic bead from each 15-milliliter conical tube in 300 microliters of cold MB buffer, and combine the beads into one reaction tube.Perform five washes of 10 minutes each, using 750 microliters of cold MB buffer, containing protease and phosphatase inhibitors, at four degrees Celsius, while rotating at 20 RPM. Next, conduct the final wash with 750 microliters of cold MB buffer without protease and phosphatase inhibitors. Suspend the prepared beads in 40 microliters of cold MB buffer without protease and phosphatase inhibitors.

Locus-spezifische Chromatin-Aufreinigung aus Saccharomyces cerevisiae

TEV Protease-Mediated Elution and Denaturation Elution of the Chromatin Locus Purified from Saccharomyces cerevisiae

TEV Protease-Mediated Elution and Denaturation Elution of the Chromatin Locus Purified from Saccharomyces cerevisiae  

Release the lexA CBP chromatin ring complexes from the magnetic beads used to purify chromatin single-copy gene locus by incubating the bees with two microliters of 6xHis-tagged recombinant tobacco etch virus or TEV protease. After separating the bees from the final eluate using a magnetic rack transfer, the eluate containing cleaved chromatin rings to a new 1.5-milliliter reaction tube. Again, place the tubes on a magnetic rack to separate residual beads from the final eluate.Resuspend the beads in 750 microliters of cold ammonium carbonate buffer before storing some samples at 20 Celsius for DNA and protein analysis. From the final eluate, take out the samples and store them at 20 degrees Celsius for DNA and protein analysis. Further, take samples from the residual beads.Begin the denaturation elution by washing the magnetic beads two times in 750 microliters of cold ammonium carbonate buffer for 20 minutes each, four degrees Celsius rotating at 20 revolutions per minute. Next, add 500 microliters of 0.5 molar ammonium hydroxide to the beads to extract bound lexA chromatin complexes and incubate for 30 minutes at room temperature. Separate the beads from the suspension using a magnetic rack and transfer the eluate to a low binding reaction tube.Incubate the low binding reaction tube at room temperature for 30 minutes and separate the beads from the suspension using a magnetic rack. Once done, transfer the eluate to a low binding reaction tube. Resuspend the beads in 750 microliters of deionized water and collect samples for DNA and protein analysis.Lastly, obtain DNA and protein analysis samples from the final eluate. In the study, the purification efficiency of the ARS316 locus and the recombination strain was quantified and compared to the control locus PDC1. The ARS316 locus showed lower recovery in the flow through compared to PDC1.Although a fraction of chromatin rings remained bound to the TEV beads due to incomplete TEV protease cleavage, denaturation elution resulted in 80 to 90%ARS316 locus recovery. This corresponds to the high enrichment of ARS316 molecules in TEV beads and denaturation elution fractions when factoring in the size of the yeast genome compared to the control strain that showed no enrichment of ARS316 locus in any of the quantified fractions. After TEV elution, the beads showed a higher recovery percentage of the ARS316 locus as the TEV cleavage efficiency was not 100%This resulted in a fraction of chromatin rings remaining bound to the beads.However, the denaturing elusion showed 80 to 90%recovery of the ARS316 locus and the recombination strain corresponding to the high enrichment of ARS316 molecules when factoring in the size of the yeast genome.