Name: 저자 스포트라이트: Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol (고농축 유전자좌 특이적 크로마틴 분리 프로토콜로 크로마틴 연구 발전 및 한계 극복)
Uploaded: 2023-11-17T13:20:00
Description: Watch this Scientific Journal Video about Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol at JoVE.com

S.H. 실험실에서의 작업은 SFB1064(프로젝트 ID 213249687), 유럽 연구 위원회(ERC Starting Grant 852798 ConflictResolution) 및 Helmholtz Gesellschaft를 통해 DFG의 지원을 받았습니다.

이 프로토콜에 사용된 모든 재료 및 도구와 관련된 자세한 내용은 재료 표를 참조하십시오. 표 1 에서 사용된 솔루션, 버퍼 및 매체 목록을 참조하십시오.
1. 재조합 효모 균주 구성
<ol><li>재조합 적격 효모 균주를 구축하기 위해, SbfI-소화된 플라스미드 K238을 관심 유전자좌(13,14)에 통합된 LexA-?...

효모 세포에서 locus-specific Chromatin 분리

<ol>
	<li>Kornberg, R. D., Lorch, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty-five+years+of+the+nucleosome,+fundamental+particle+of+the+eukaryote+chromosome.">Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome.</a> Cell. 98 (3), 285-294 (1999).</li><li>Gauchier, M., van Mierlo, G., Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+enrichment+of+specific+chromatin+loci.">Purification and enrichment of specific chromatin loci.</a> Nature Methods. 17 (4), 380-389 (2020).</li><li>Korthout, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoding+the+chromatin+proteome+of+a+single+genomic+locus+by+DNA+sequencing.">Decoding the chromatin proteome of a single genomic locus by DNA sequencing.</a> PLoS Biology. 16 (7), e2005542 (2018).</li><li>Ant&#227;o, J. M., Mason, J. M., D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+landscape+at+Drosophila+melanogaster+telomere-associated+sequence+repeats.">Protein landscape at Drosophila melanogaster telomere-associated sequence repeats.</a> Molecular and Cellular Biology. 32 (12), 2170-2182 (2012).</li><li>D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+proteins+associated+with+specific+genomic+loci.">Purification of proteins associated with specific genomic loci.</a> Cell. 136 (1), 175-186 (2009).</li><li>Ide, S., Dejardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=End-targeting+proteomics+of+isolated+chromatin+segments+of+a+mammalian+ribosomal+RNA+gene+promoter.">End-targeting proteomics of isolated chromatin segments of a mammalian ribosomal RNA gene promoter.</a> Nature Communications. 6, 6674 (2015).</li><li>Unnikrishnan, A., Gafken, P. R., Tsukiyama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+changes+in+histone+acetylation+regulate+origins+of+DNA+replication.">Dynamic changes in histone acetylation regulate origins of DNA replication.</a> Nature Structural &amp;amp; Molecular Biology. 17 (4), 430 (2010).</li><li>Buxton, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+protein-DNA+interactions+in+human+alphoid+chromatin+via+hybridization+capture+and+mass+spectrometry.">Elucidating protein-DNA interactions in human alphoid chromatin via hybridization capture and mass spectrometry.</a> Journal of Proteome Research. 16 (9), 3433-3442 (2017).</li><li>Kennedy-Darling, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+chromatin-associated+proteins+via+sequence-specific+capture+and+mass+spectrometric+protein+identification+in+Saccharomyces+cerevisiae.">Discovery of chromatin-associated proteins via sequence-specific capture and mass spectrometric protein identification in Saccharomyces cerevisiae.</a> Journal of Proteome Research. 13 (8), 3810-3825 (2014).</li><li>Liu, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRi-based+genome-scale+identification+of+functional+long+noncoding+RNA+loci+in+human+cells.">CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells.</a> Science. 355, 7111 (2017).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+specific+chromatin+domains+from+single-copy+gene+loci+in+Saccharomyces+cerevisiae.">Purification of specific chromatin domains from single-copy gene loci in Saccharomyces cerevisiae.</a> Functional Analysis of DNA and Chromatin. 1094, 329-341 (2014).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compositional+and+structural+analysis+of+selected+chromosomal+domains+from+Saccharomyces+cerevisiae.">Compositional and structural analysis of selected chromosomal domains from Saccharomyces cerevisiae.</a> Nucleic Acids Research. 42 (1), 2 (2014).</li><li>Wei&#946;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-copy+locus+proteomics+of+early-+and+late-firing+DNA+replication+origins+identifies+a+role+of+Ask1/DASH+complex+in+replication+timing+control.">Single-copy locus proteomics of early- and late-firing DNA replication origins identifies a role of Ask1/DASH complex in replication timing control.</a> Cell Reports. 42 (2), 112045 (2023).</li><li>Gietz, R. D., Schiestl, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+yeast+transformation+using+the+LiAc/SS+carrier+DNA/PEG+method.">High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method.</a> Nature Protocols. 2 (1), 31-34 (2007).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Towbin, H., Staehelin, T., Gordon, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+transfer+of+proteins+from+polyacrylamide+gels+to+nitrocellulose+sheets:+procedure+and+some+applications.">Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (9), 4350-4354 (1979).</li><li>Western blot membrane stripping for restaining protocol. Abcam Available from: <a target="_blank" href="https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol">https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol</a> (2023)</li><li>Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Locus-specific+chromatin+isolation.">Locus-specific chromatin isolation.</a> Nature Reviews. Molecular Cell Biology. 21 (5), 249-250 (2020).</li></ol>

특정 표적 게놈 영역의 인자 및 염색질 지형을 식별하는 것은 염색질 연구에서 계속해서 주요 과제를 제기하고 있다18. 이 프로토콜은 효모 염색체에서 뚜렷한 염색질 도메인을 특이적으로 절제하고 정제하는 효율적인 시스템을 설명합니다. 우리가 아는 한, 이 단일 단계 정제의 순도와 수율은 유전자좌 특이적 염색질 정제 방법의 많은 한계를 극복하여 다른 관련 없는 게놈 영?...

진핵생물 게놈을 염색질로 역동적으로 조직하면 DNA가 핵의 한계 내에 맞도록 압축되는 동시에 유전자 발현을 위한 충분한 역학과 조절 인자에 대한 접근성을 보장합니다. 부분적으로, 이 다재다능함은 히스톤 옥타머1 주위에 ~1.7배 감싼 DNA의 147 bp를 가진 핵심 입자를 포함하는 염색질의 기본 단위인 뉴클레오솜에 의해 매개됩니다. 뉴클레오솜은 N- 및 C-말단 히스톤 꼬리에 수많은 히스톤 변이체와 번역 후 변형(PTM)이 있는 구성과 관련하여 매우 역동적인 구조입니다. 또한 진핵 염색질은 전사 인자, DNA 및 RNA 처리 기계, 건축 단백질, 염색질 리모델링 및 변형에 관여하는 효소, 염색질과 관련된 RNA 분자와 같은 다양한 다른 필수 구성 요소와 상호 작용합니다. 전사, 복제 및 복구와 관련된 이러한 중요한 기계는 모두 이러한 과정의 천연 기질 역할을 하는 크로마틴에 대한 접근이 필요합니다. 결과적으로, 이러한 DNA 거래의 기초가 되는 분자 메커니즘을 이해하려면 이러한 기계가 수렴하고 생물학적 반응을 촉진하는 특정 게놈 영역에서 염색질 구조의 집합적 변화를 정확하게 정의해야 합니다.
유전학 및 단백질-단백질 상호 작용 연구를 통해 수많은 염색질 인자를 식별했음에도 불구하고 특정 게놈 부위에서 염색질 상호 작용에 대한 직접적이고 편향되지 않은 포괄적인 분석을 수행하는 것은 중요한 장애물로 남아 있습니다 2,3. 초기에는 게놈의 매우 풍부한 영역(즉, 반복적 유전자좌) 또는 다중 복제 플라스미드만 관련 단백질 4,5,6,7의 질량 분석 식별을 위해 충분한 양과 순도로 분리할 수 있었습니다. 크로마틴화된 DNA에 대한 포획 프로브의 직접 하이브리드화, CRISPR-dCas9 시스템을 사용한 근접 비오틴화 또는 염기서열 특이적 어댑터 단백질을 관심 유전자좌에 결합하는 것을 기반으로 하는 일련의 새로운 접근 방식은 효모 및 포유류 게놈 8,9,10에서 단일 복제 유전자좌의 단백질체를 풀기 시작했습니다. 그러나 이러한 모든 방법은 단백질-DNA 상호 작용을 안정화하기 위해 포름 알데히드 교차 결합과 후속 정제를 위해 염색질을 용해시키기 위해 초음파 처리가 필요합니다. 두 조작 모두 정제된 크로마틴의 후속 구조적 및 기능적 연구 가능성을 배제합니다.
이러한 한계를 극복하기 위해 우리는 이전에 효모11,12에서 표적 염색체 도메인을 추출하기 위해 부위 특이적 재조합을 사용하는 방법론을 고안했습니다. 본질적으로, 관심의 게놈 영역은 Zygosaccharomyces rouxi의 부위 특이적 R-재조합효소에 대한 인식 부위(RS)로 둘러싸여 있으며, 동시에 동일한 영역 내에서 원핵생물 전사 억제제 LexA 단백질(LexA)에 대한 3개의 DNA 결합 부위 그룹을 통합합니다. 효모 세포에는 R-재조합효소의 동시 발현을 위한 발현 카세트와 탠덤 친화성 정제(TAP) 태그에 융합된 LexA 단백질이 포함되어 있습니다. R-재조합효소의 유도 후, 효소는 원형 염색질 도메인의 형태로 염색체에서 표적 영역을 효율적으로 절제합니다. 이 도메인은 LexA DNA 결합 부위와 친화성 지지체에 결합하는 LexA-TAP 어댑터 단백질을 통해 정제할 수 있습니다. 이 방법은 효모 염색체 III13의 선택된 복제 기원을 포함하는 뚜렷한 염색질 도메인을 분리하는 데 최근에 사용되었습니다.
이 생체 외 접근법의 주요 장점 중 하나는 분리된 물질의 기능적 분석이 가능하다는 것입니다. 예를 들어, 이 방법으로 정제된 복제 기원 도메인은 in vitro 복제 분석을 통해 native in vivo 조립 염색질 템플릿으로부터 시험관에서 기원 발화의 효율성을 평가할 수 있습니다. 궁극적으로, 분리된 물질의 생화학적 및 기능적 특성화는 천연 염색질 주형과 함께 정제된 단백질을 사용하여 핵 공정의 재구성을 허용할 수 있습니다. 요약하면, 이 방법론은 특정 염색체 거래를 겪는 특정 게놈 영역의 집합적 구성 및 구조적 염색질 변화를 추적할 수 있기 때문에 염색질 연구에서 흥미로운 길을 열어줍니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Yeast strains</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Control Strain: MATa; ura3&#916;0; leu2&#916;0; his3&#916;1; met15&#916;0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td>
			<td></td>
			<td></td>
			<td>Section 1, see references 13 and 14</td>
		</tr>
		<tr>
			<td>Recombination Strain: MATa; ura3&#916;0; leu2&#916;0; his3&#916;1; met15&#916;0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td>
			<td></td>
			<td></td>
			<td>Section 1, see reference 13 and 14</td>
		</tr>
		<tr>
			<td>Plasmid</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>K238 plasmid</td>
			<td></td>
			<td></td>
			<td>Section 1, see reference 13 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>K071 Spike-in plasmid DNA</td>
			<td></td>
			<td></td>
			<td>Section 7.1, see reference 13 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Acetone</td>
			<td>Carl Roth</td>
			<td>5025.1</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium acetate (NH4Ac)</td>
			<td>Sigma Aldrich</td>
			<td>A7262</td>
			<td>Section 6 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium solution (NH4OH) 25%</td>
			<td>Merck Millipore</td>
			<td>533003</td>
			<td>Section 6 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium sulfate</td>
			<td>Santa Cruz</td>
			<td>Sc-29085</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Bacto agar</td>
			<td>BD (VWR)</td>
			<td>90000-760</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Bacto peptone</td>
			<td>BD (VWR)</td>
			<td>211820</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>&#946;-Mercaptoethanol</td>
			<td>Sigma Aldrich</td>
			<td>07604</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Chemiluminescent substrate kit</td>
			<td>ThermoFisher</td>
			<td>34580</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Di-Sodium Hydrogen phosphate dodecahydrate</td>
			<td>Merck</td>
			<td>1.06579.1000</td>
			<td>Section 2 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>ThermoFisher</td>
			<td>15508013</td>
			<td>Section 4 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Merck</td>
			<td>100983</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid (EDTA)</td>
			<td>Sigma Aldrich</td>
			<td>ED</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Galactose (20% (w/v) stock)</td>
			<td>Sigma Aldrich</td>
			<td>G0625-1KG&#160; /&#160; 5KG</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Gel loading dye (6x)</td>
			<td>BioLabs</td>
			<td>B7024A</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Glusose</td>
			<td>Sigma-Aldrich</td>
			<td>G8270</td>
			<td>Section 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Carl Roth</td>
			<td>.0079.4</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Glycogen (5 mg/mL)</td>
			<td>Invitrogen</td>
			<td>AM9510</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Hydrochloric acid (HCl)</td>
			<td>PanReac AppliChem</td>
			<td>182109.1211</td>
			<td>Section 2, 4 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Magnesium Acetate (MgAc)</td>
			<td>Bernd Kraft</td>
			<td>15274.2600/C035</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Magnesium chloride (MgCl2)</td>
			<td>Sigma Aldrich</td>
			<td>M8266</td>
			<td>Section 6 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Nu PAGE LDS sample buffer (4x)</td>
			<td>Invitrogen</td>
			<td>2399549</td>
			<td>Section 7.2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)</td>
			<td>Invitrogen</td>
			<td>15593-031</td>
			<td>Section 7.1 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Potassium chloride (KCl)</td>
			<td>Sigma</td>
			<td>P9541</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Radioactively labeled &#945;-32P dATP (3,000 Ci/mmol, 10 mCi/mL)</td>
			<td>Hartmann Analytic</td>
			<td>SRP-203</td>
			<td>Section 7.1 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>RadPrime labeling system</td>
			<td>ThermoFisher</td>
			<td>18428-011</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Raffinose (20% (w/v) stock)</td>
			<td>SERVA</td>
			<td>34140.03</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium chloride (NaCl)</td>
			<td>Merck</td>
			<td>K53710504142</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium citrate (Na3C6H5O7)</td>
			<td>Sigma-Aldrich</td>
			<td>71402</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium hydroxide (NaOH)</td>
			<td>Sigma Aldrich</td>
			<td>S5881</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )</td>
			<td>Alfa Aesar</td>
			<td>A11183</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium phosphate monobasic</td>
			<td>Sigma-Aldrich</td>
			<td>71496</td>
			<td>Section 2 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium&#160;azide</td>
			<td>Santa Cruz&#160;Biotechnology</td>
			<td>sc-208393</td>
			<td>Section 2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>&#160;Triethylamine</td>
			<td>Sigma Aldrich</td>
			<td>90340</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Tris base</td>
			<td>Chem Cruz</td>
			<td>SC-3715B</td>
			<td>Section 2 and 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td>X100</td>
			<td>Section 2 and 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Tween-20</td>
			<td>Bernd Kraft</td>
			<td>18014332</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>BD (VWR)</td>
			<td>212720</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Yeast mating factor alpha (1 &#181;g/mL stock )</td>
			<td>&#160;Biomol</td>
			<td>Y2016.5</td>
			<td>Section 3 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Yeast Synthetic Drop-out medium Supplements without LEUCINE</td>
			<td>Sigma Aldrich</td>
			<td>Y1376</td>
			<td>Section 1, see reference 14</td>
		</tr>
		<tr>
			<td>Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HpaI restriction enzyme (5,000 U/mL)</td>
			<td>NEB</td>
			<td>R0105S</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Protease and Phosphatase Inhibitor Cocktail (100x)</td>
			<td>ThermoFisher Scientific</td>
			<td>78446</td>
			<td>Section 4 
			Storage: Store at4 &#176;C</td>
		</tr>
		<tr>
			<td>Proteinase K (10 mg/mL)</td>
			<td>SERVA</td>
			<td>33756</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>RNase A (10 mg/mL)</td>
			<td>&#160;ThermoFisher</td>
			<td>EN0531</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>TEV protease (10000 U/&#181;L)</td>
			<td>NEB</td>
			<td>P8112S</td>
			<td>Section 5 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BcMag Epoxy-Activated Magnetic Beads</td>
			<td>Bioclone Inc.</td>
			<td>FC-102</td>
			<td>Section 2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Dry ice</td>
			<td></td>
			<td></td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Low-binding centrifuge tubes 2.0 mL</td>
			<td>Eppendorf</td>
			<td>22431102</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Microspin&#160;G-25 Columns</td>
			<td>Cytiva</td>
			<td>27-5325-01</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>Merck</td>
			<td>P7793</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Positive nylon membrane</td>
			<td>Biozol</td>
			<td>11MEMP0001</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>PVDF transfer membrane</td>
			<td>Immobilon-Merck Millipore</td>
			<td>IPVH00010</td>
			<td>Section 7.2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)</td>
			<td>Invitrogen</td>
			<td>&#160;NP0336BOX</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Syringe (25 mL) with luer fitting</td>
			<td>Henke Sass Wolf</td>
			<td>4200-000V0</td>
			<td>Section 3</td>
		</tr>
		<tr>
			<td>Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)</td>
			<td>Cytiva</td>
			<td>3030-917</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody</td>
			<td>Merck Millipore</td>
			<td>06-719</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate</td>
			<td>Invitrogen</td>
			<td>G21234</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins</td>
			<td>Sigma Aldrich</td>
			<td>P1291-500UL</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Rabbit IgG antibodies</td>
			<td>Sigma</td>
			<td>I5006-100MG</td>
			<td>Section 2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Primers (10 &#181;M)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ARS316: fwd 5&#39;- CGGCATTATCGTACACAACCT, rev 5&#39;- GTTCTTCGTTGCCTACATTTTCT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>K071 Spike-in plasmid DNA: fwd: 5&#39;-TTTTCGCTGCTTGTCCTTTT, rev 5&#39;- CATTTTCGTCCTCCCAACAT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>PCR fragment from yeast genomic DNA as a template &#160;for ARS316 amplification (for southern blot): fwd 5&#8217;- AAATTCTGCCCTTGATTCGT&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; rev 5&#8217;- TTTGTTTATCTCATCACTAAT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>PDC1: fwd 5&#39;- CATGATCAGATGGGGCTTCA, rev 5&#39;-ACCGGTGGTAGCGACTCTGT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Coffee grinder</td>
			<td>Gastroback</td>
			<td>42601</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Dewar flask</td>
			<td>NAL GENE</td>
			<td>4150-2000</td>
			<td>Section 3</td>
		</tr>
		<tr>
			<td>DynaMag TM-2 magnetic rack</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>Section 4, 5 and 6</td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Hybaid Mini10</td>
			<td>Ri418</td>
			<td>Section 2</td>
		</tr>
		<tr>
			<td>Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5424R</td>
			<td>Section 4 and 7.1</td>
		</tr>
		<tr>
			<td>UV-crosslinker</td>
			<td>Analytikjena</td>
			<td>95-0174-02</td>
			<td>Section 7.1</td>
		</tr>
	</tbody>
</table>

single-copy gene locus chromatin purification in saccharomyces cerevisiae

진핵 염색질의 기본 조직 단위는 뉴클레오솜 코어 입자 (NCP)이며, 이는 히스톤 옥타머 주위에 ~ 1.7 배 감싼 DNA로 구성됩니다. 크로마틴은 NCP와 전사 인자, 염색질 리모델링 및 변형 효소를 포함한 수많은 다른 단백질 복합체의 실체로 정의됩니다. 이러한 단백질-DNA 상호 작용이 세포주기의 여러 단계에서 특정 게놈 위치 수준에서 어떻게 조정되는지는 아직 불분명합니다. 이는 주로 현재의 기술적 한계로 인해 이러한 동적 상호 작용의 정확한 측정값을 얻기가 어렵기 때문입니다. 여기서는 부위 특이적 재조합과 효율적인 단일 단계 친화성 정제 프로토콜을 결합하여 네이티브 염색질 상태에서 단일 복제 관심 유전자 자리를 분리하는 개선된 방법을 설명합니다. 이 방법은 게놈 크로마틴에 대한 표적 자리의 강력한 농축을 허용하므로 이 기술은 질량 분석법과 같은 편향되지 않고 체계적인 방식으로 단백질 상호 작용을 식별하고 정량화하기 위한 효과적인 전략이 됩니다. 이러한 조성 분석에 더하여, 이 방법에 의해 정제된 천연 염색질은 뉴클레오솜 위치 지정 및 히스톤 변형에 관한 생체 내 상황을 반영할 가능성이 높으며, 따라서 효모의 거의 모든 게놈 유전자좌에서 유래한 염색질의 추가 구조 및 생화학적 분석에 적합합니다.

The dynamic organization of eukaryotic genomes into chromatin compacts the DNA to fit within the confines of the nucleus while ensuring sufficient dynamics for gene expression and accessibility for regulatory factors. In part, this versatility is mediated by the nucleosome, the basic unit of chromatin, which comprises a core particle with 147 bp of DNA wrapped ~1.7 times around the histone octamer1. The nucleosome is a highly dynamic structure with respect to its composition, with numerous histone variants and posttranslational modifications (PTMs) on the N- and C-terminal histone tails. Furthermore, eukaryotic chromatin interacts with a multitude of other essential components, such as transcription factors, DNA and RNA processing machinery, architectural proteins, enzymes involved in chromatin remodeling and modification, and RNA molecules associated with chromatin. These crucial machineries involved in transcription, replication, and repair all require access to chromatin, which serves as the natural substrate for these processes. Consequently, comprehending the molecular mechanisms underlying these DNA transactions necessitates a precise definition of the collective alterations in chromatin structure at the specific genomic regions where these machineries converge and facilitate biological reactions.
Despite the identification of numerous chromatin factors through genetics and protein-protein interaction studies, performing direct, unbiased, and comprehensive analyses of chromatin interactions at particular genomic sites has remained a significant obstacle2,3. Initially, only highly abundant regions of the genome (i.e., repetitive loci) or multi-copy plasmids could be isolated in sufficient amounts and purity for mass spectrometric identification of the associated proteins4,5,6,7. A series of new approaches based on the direct hybridization of capture probes to chromatinized DNA, proximity biotinylation using the CRISPR-dCas9 system, or the binding of sequence-specific adapter proteins to the locus of interest have started to unravel the proteome of single-copy loci from yeast and mammalian genomes8,9,10. However, all these methods require formaldehyde crosslinking to stabilize the protein-DNA interactions and sonication to solubilize the chromatin for subsequent purification. Together, both manipulations exclude the possibility of subsequent structural and functional studies of the purified chromatin.
To overcome these limitations, we previously devised a methodology that employs site-specific recombination to extract targeted chromosomal domains from yeast11,12. In essence, the genomic region of interest is surrounded by recognition sites (RS) for the site-specific R-recombinase from Zygosaccharomyces rouxi while simultaneously incorporating a group of three DNA binding sites for the prokaryotic transcriptional repressor LexA protein (LexA) within the same region. The yeast cells contain an expression cassette for the simultaneous expression of R-recombinase and a LexA protein fused to a tandem affinity purification (TAP) tag. After the induction of R-recombinase, the enzyme efficiently excises the targeted region from the chromosome in the form of a circular chromatin domain. This domain can be purified via the LexA-TAP adapter protein, which binds to the LexA DNA binding sites, as well as to an affinity support. This method has been recently used to isolate distinct chromatin domains containing selected replication origins of yeast chromosome III13.
One major advantage of this ex vivo approach is that it allows for functional analyses of the isolated material. For example, replication origin domains purified with this method can be subjected to in vitro replication assays to assess the efficiency of origin firing in a test tube from native in vivo assembled chromatin templates. Ultimately, the biochemical and functional characterization of the isolated material may allow the reconstitution of nuclear processes using purified proteins together with the native chromatin template. In summary, this methodology opens an exciting avenue in chromatin research, as it will be possible to follow the collective compositional and structural chromatin changes of a specific genomic region undergoing a certain chromosomal transaction.

저자 스포트라이트: Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol (고농축 유전자좌 특이적 크로마틴 분리 프로토콜로 크로마틴 연구 발전 및 한계 극복) 

Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae (맥주효모균의 단일 복제 유전자 자리, 염색질 정제)

A eukaryotic nucleus is very crowded with many biological processes occurring simultaneously. The scope of our research is to understand how all of these processes are coordinated on our genomes without major accidents that would otherwise lead to genomic instability and human diseases. This protocol allows us to purify a specific locus of the genome in its native state, allowing both the compositional and functional characterization of the isolated material, such as the measurements of protein DNA interactions.This protocol enables an enormous level of enrichment of a targeted locus, which overcomes many current limitations of locus-specific chromatin isolation. The material has not been cross-linked. That also allows many downstream functional analysis, such as in vitro transcription or in vitro replication.This protocol enabled us to excise and purify distinct replication origins from yeast chromosomes, allowing us to perform a proteomic analysis and identify novel origin interacting chromatin factors, and therefore, advance the research field of DNA replication. This protocol enables in vitro replication studies using the purified origin material to examine chromatin states, histone modifications, and perform structural analysis on the native nucleosomal templates from endogenous chromosomes, advancing chromatin research.

~1.4kb ARS316 크로마틴 도메인의 정제는 구성적으로 발현된 LexA-TAP 어댑터 단백질에 의해 매개되었습니다. 음성 대조군으로 사용하기 위해 LexA-TAP을 발현하지만 통합 RS 및 LexA 결합 부위를 포함하지 않는 동종 균주를 사용하여 정제를 수행했습니다. 그림 3 은 ARS316 유전자좌를 표적으로 하는 대조군과 재조합 가능 균주 모두에 대해 수행된 표준 정제 실험의 DNA 분석 결과를 보여...

Watch this Scientific Journal Video about Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol at JoVE.com

이 프로토콜은 신진 효모인 맥주효모균(Saccharomyces cerevisiae)에서 네이티브 염색질 맥락에서 관심 있는 단일 복제 유전자 자리를 정제하기 위해 부위 특이적 재조합을 기반으로 하는 유전자좌 특이적 염색질 분리 방법을 제시합니다.

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone ...

진핵 핵은 동시에 발생하는 많은 생물학적 과정으로 매우 붐비고 있습니다. 우리 연구의 범위는 이러한 모든 과정이 게놈 불안정성과 인간 질병으로 이어질 수 있는 큰 사고 없이 게놈에서 어떻게 조정되는지 이해하는 것입니다. 이 프로토콜을 사용하면 원래 상태에서 게놈의 특정 유전자좌를 정제할 수 있으므로 단백질 DNA 상호 작용 측정과 같은 분리된 물질의 구성 및 기능적 특성을 모두 수행할 수 있습니다.이 프로토콜은 표적 유전자좌의 엄청난 수준의 농축을 가능하게 하여 유전자좌 특이적 염색질 분리의 많은 현재 한계를 극복합니다. 재료가 가교되지 않았습니다. 또한 in vitro transcription 또는 in vitro replication과 같은 많은 다운스트림 기능 분석이 가능합니다.이 프로토콜을 통해 효모 염색체에서 뚜렷한 복제 기원을 절제 및 정제할 수 있어 단백질체 분석을 수행하고 염색질 인자와 상호 작용하는 새로운 기원을 식별할 수 있으므로 DNA 복제 연구 분야를 발전시킬 수 있습니다. 이 프로토콜은 정제된 기원 물질을 사용하여 염색질 상태, 히스톤 변형을 검사하고 내인성 염색체의 천연 뉴클레오솜 템플릿에 대한 구조 분석을 수행하여 염색질 연구를 발전시키는 시험관 내 복제 연구를 가능하게 합니다.

single-copy-gene-locus-chromatin-purification-saccharomyces

Research

JoVE Journal

Biochemistry

Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone octamer. Chromatin is defined as the entity of NCPs and numerous other protein complexes, including transcription factors, chromatin remodeling and modifying enzymes. It is still unclear how these protein-DNA interactions are orchestrated at the level of specific genomic loci during different stages of the cell cycle. This is mainly due to the current technical limitations, which make it challenging to obtain precise measurements of such dynamic interactions. Here, we describe an improved method combining site-specific recombination with an efficient single-step affinity purification protocol to isolate a single-copy gene locus of interest in its native chromatin state. The method allows for the robust enrichment of the target locus over genomic chromatin, making this technique an effective strategy for identifying and quantifying protein interactions in an unbiased and systematic manner, for example by mass spectrometry. Further to such compositional analyses, native chromatin purified by this method likely reflects the in vivo situation regarding nucleosome positioning and histone modifications and is, therefore, amenable to further structural and biochemical analyses of chromatin derived from virtually any genomic locus in yeast.

This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.

연구

생화학

Yeast Cell Culture and Cell Harvesting for Single-Copy Gene Locus Chromatin Purification

Begin by inoculating the control and recombination competent yeast strains from YPD plates into five milliliters of YPR medium, and grow the culture overnight at 30 degrees Celsius and 200 RPM. Next, scale up the culture by inoculating two milliliters into 100 milliliters of fresh YPR medium and growing it overnight at 30 degrees Celsius and 200 RPM. For each strain, dispense 1, 800 milliliters of autoclave yeast Peptone medium, and 200 milliliters of autoclave 20%raffinose solution into two 5 liter Erlenmeyer flasks.Inoculate each yeast strain with 0.2 optical density at 600 nanometers in the respective medium, and incubate for about six hours at 200 RPM, or until the cells reach the desired 1.0 optical density. Add 200 milliliters of 2%galactose and 110 microliters of yeast mating factor alpha or YMFA simultaneously to arrest cells in the G1 phase and incubate it for two hours. Transfer the cell suspension into one liter centrifuge buckets and centrifuge the bucket at 6, 000 G and four degrees Celsius for 10 minutes.Discard the supernatant and resuspend the cell pellets in 10 to 15 milliliters of distilled water. Next, seal a 25 milliliter syringe with a lure plug and place it inside a 50 milliliter conical tube filled with water. Transfer the cell suspension to the syringe assembly.Wash the centrifuge buckets with five milliliters of distilled water to collect the remaining cells. Then, centrifuge the assembly at 2, 397 G for 10 minutes at room temperature and discard the supernatant. Then remove the lure plug from the syringe and extrude the cells into liquid nitrogen to form cell spaghetti.Lastly, transfer the frozen cell spaghetti into a 50 milliliter conical tube and store it at minus 80 degrees Celsius until further use.

단일 복제 유전자 자리(Single-copy Gene Locus Chromatin) 정제를 위한 효모 세포 배양 및 세포 수확

Locus-Specific Chromatin Purification from Saccharomyces cerevisiae

Locus-Specific Chromatin Purification from Saccharomyces cerevisiae  

Begin cooling a commercial coffee grinder by grinding approximately 30 to 50 grams of dry ice twice, for 30 seconds each time. Discard the dry ice powder and mix three grams of frozen yeast cell spaghetti with approximately 30 to 50 grams of dry ice in the pre-cooled coffee grinder. Seal the junction between the cap and the grinder with Parafilm.Mix the yeast cell dry ice mix 10 times, for 30 seconds each, allowing 30-second intervals between every round. Transfer the resulting yeast cell dry ice powder to a plastic beaker, using a clean and dry spatula. After dry ice evaporation, add 2.25 milliliters of magnetic bead, or MB buffer, with protease and phosphatase inhibitors, to the yeast cell powder.After vigorously pipetting the cell buffer mixture, transfer the cell suspension to a 15-milliliter conical tube. Next, store 0.1%samples from the crude cell extracts for DNA, and 0.05%samples for protein analysis, at minus-20 degrees Celsius. Transfer the remaining cell suspension into low-binding two-milliliter reaction tubes, and separate cell debris by centrifuging the tubes.Once done, pull all supernatants into one 15-milliliter conical tube. Again, store 0.1%of the supernatant at minus-20 degrees Celsius for DNA, and 0.05%of the supernatant for protein analysis. Next, wash 500 microliters of immunoglobulin G-coupled magnetic bead slurry with 500 microliters of cold MB buffer, containing protease and phosphatase inhibitors, two times, for five minutes each, at four degrees Celsius, on rotation at 20 RPM.Incubate the magnetic beads in 500 microliters of cold MB buffer for one hour at four degrees Celsius, on rotation at 20 RPM, before removing the supernatant from the beads using a magnetic rack. Mix the equilibrated magnetic bead slurry with the cell lysate obtained earlier and pulled into a 15-milliliter conical tube. After incubating for two hours at four degrees Celsius and 20 RPM, transfer the complete magnetic bead cell lysate suspension to low-binding reaction tubes.Separate the magnetic beads carrying the chromatin rings of interest from the cell lysate, using a magnetic rack. Transfer the remaining flow-through from each tube to a fresh 15-milliliter conical tube, before storing some samples at minus-20 degrees Celsius for DNA and protein analysis. Next, suspend the magnetic bead from each 15-milliliter conical tube in 300 microliters of cold MB buffer, and combine the beads into one reaction tube.Perform five washes of 10 minutes each, using 750 microliters of cold MB buffer, containing protease and phosphatase inhibitors, at four degrees Celsius, while rotating at 20 RPM. Next, conduct the final wash with 750 microliters of cold MB buffer without protease and phosphatase inhibitors. Suspend the prepared beads in 40 microliters of cold MB buffer without protease and phosphatase inhibitors.

맥주효모균(Saccharomyces cerevisiae)의 로커스 특이적 염색질 정제

TEV Protease-Mediated Elution and Denaturation Elution of the Chromatin Locus Purified from Saccharomyces cerevisiae

TEV Protease-Mediated Elution and Denaturation Elution of the Chromatin Locus Purified from Saccharomyces cerevisiae  

Release the lexA CBP chromatin ring complexes from the magnetic beads used to purify chromatin single-copy gene locus by incubating the bees with two microliters of 6xHis-tagged recombinant tobacco etch virus or TEV protease. After separating the bees from the final eluate using a magnetic rack transfer, the eluate containing cleaved chromatin rings to a new 1.5-milliliter reaction tube. Again, place the tubes on a magnetic rack to separate residual beads from the final eluate.Resuspend the beads in 750 microliters of cold ammonium carbonate buffer before storing some samples at 20 Celsius for DNA and protein analysis. From the final eluate, take out the samples and store them at 20 degrees Celsius for DNA and protein analysis. Further, take samples from the residual beads.Begin the denaturation elution by washing the magnetic beads two times in 750 microliters of cold ammonium carbonate buffer for 20 minutes each, four degrees Celsius rotating at 20 revolutions per minute. Next, add 500 microliters of 0.5 molar ammonium hydroxide to the beads to extract bound lexA chromatin complexes and incubate for 30 minutes at room temperature. Separate the beads from the suspension using a magnetic rack and transfer the eluate to a low binding reaction tube.Incubate the low binding reaction tube at room temperature for 30 minutes and separate the beads from the suspension using a magnetic rack. Once done, transfer the eluate to a low binding reaction tube. Resuspend the beads in 750 microliters of deionized water and collect samples for DNA and protein analysis.Lastly, obtain DNA and protein analysis samples from the final eluate. In the study, the purification efficiency of the ARS316 locus and the recombination strain was quantified and compared to the control locus PDC1. The ARS316 locus showed lower recovery in the flow through compared to PDC1.Although a fraction of chromatin rings remained bound to the TEV beads due to incomplete TEV protease cleavage, denaturation elution resulted in 80 to 90%ARS316 locus recovery. This corresponds to the high enrichment of ARS316 molecules in TEV beads and denaturation elution fractions when factoring in the size of the yeast genome compared to the control strain that showed no enrichment of ARS316 locus in any of the quantified fractions. After TEV elution, the beads showed a higher recovery percentage of the ARS316 locus as the TEV cleavage efficiency was not 100%This resulted in a fraction of chromatin rings remaining bound to the beads.However, the denaturing elusion showed 80 to 90%recovery of the ARS316 locus and the recombination strain corresponding to the high enrichment of ARS316 molecules when factoring in the size of the yeast genome.