Name: Yazar Spotlight: Kromatin Araştırmalarını Geliştirme ve Yüksek Zenginleştirme Locus'a Özgü Kromatin İzolasyon Protokolü ile Sınırlamaların Üstesinden Gelme
Uploaded: 2023-11-17T13:20:00
Description: Watch this Scientific Journal Video about Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol at JoVE.com

S.H. laboratuvarındaki çalışmalar, SFB1064 (proje kimliği 213249687), Avrupa Araştırma Konseyi (ERC Başlangıç Hibesi 852798 Çatışma Çözümü) ve Helmholtz Gesellschaft aracılığıyla DFG tarafından desteklenmiştir.

Bu protokolde kullanılan tüm malzeme ve aletlerle ilgili ayrıntılar için Malzeme Tablosuna bakın. Kullanılan çözümlerin, arabelleklerin ve ortamların listesi için Tablo 1'e bakın.
1. Rekombinant maya suşu yapısı
<ol><li>Rekombinasyona yetkin bir maya suşu oluşturmak için, SbfI ile sindirilmiş plazmid K238'i, ilgilenilen lokusta entegre LexA bağlanma bölgeleri ve RS rekombinasyon bölgeleri olan bir maya suşuna dönüş...

Maya Hücrelerinden Locus'a Özgü Kromatin İzolasyonu

<ol>
	<li>Kornberg, R. D., Lorch, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty-five+years+of+the+nucleosome,+fundamental+particle+of+the+eukaryote+chromosome.">Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome.</a> Cell. 98 (3), 285-294 (1999).</li><li>Gauchier, M., van Mierlo, G., Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+enrichment+of+specific+chromatin+loci.">Purification and enrichment of specific chromatin loci.</a> Nature Methods. 17 (4), 380-389 (2020).</li><li>Korthout, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoding+the+chromatin+proteome+of+a+single+genomic+locus+by+DNA+sequencing.">Decoding the chromatin proteome of a single genomic locus by DNA sequencing.</a> PLoS Biology. 16 (7), e2005542 (2018).</li><li>Ant&#227;o, J. M., Mason, J. M., D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+landscape+at+Drosophila+melanogaster+telomere-associated+sequence+repeats.">Protein landscape at Drosophila melanogaster telomere-associated sequence repeats.</a> Molecular and Cellular Biology. 32 (12), 2170-2182 (2012).</li><li>D&#233;jardin, J., Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+proteins+associated+with+specific+genomic+loci.">Purification of proteins associated with specific genomic loci.</a> Cell. 136 (1), 175-186 (2009).</li><li>Ide, S., Dejardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=End-targeting+proteomics+of+isolated+chromatin+segments+of+a+mammalian+ribosomal+RNA+gene+promoter.">End-targeting proteomics of isolated chromatin segments of a mammalian ribosomal RNA gene promoter.</a> Nature Communications. 6, 6674 (2015).</li><li>Unnikrishnan, A., Gafken, P. R., Tsukiyama, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+changes+in+histone+acetylation+regulate+origins+of+DNA+replication.">Dynamic changes in histone acetylation regulate origins of DNA replication.</a> Nature Structural &amp;amp; Molecular Biology. 17 (4), 430 (2010).</li><li>Buxton, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+protein-DNA+interactions+in+human+alphoid+chromatin+via+hybridization+capture+and+mass+spectrometry.">Elucidating protein-DNA interactions in human alphoid chromatin via hybridization capture and mass spectrometry.</a> Journal of Proteome Research. 16 (9), 3433-3442 (2017).</li><li>Kennedy-Darling, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+chromatin-associated+proteins+via+sequence-specific+capture+and+mass+spectrometric+protein+identification+in+Saccharomyces+cerevisiae.">Discovery of chromatin-associated proteins via sequence-specific capture and mass spectrometric protein identification in Saccharomyces cerevisiae.</a> Journal of Proteome Research. 13 (8), 3810-3825 (2014).</li><li>Liu, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRi-based+genome-scale+identification+of+functional+long+noncoding+RNA+loci+in+human+cells.">CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells.</a> Science. 355, 7111 (2017).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+specific+chromatin+domains+from+single-copy+gene+loci+in+Saccharomyces+cerevisiae.">Purification of specific chromatin domains from single-copy gene loci in Saccharomyces cerevisiae.</a> Functional Analysis of DNA and Chromatin. 1094, 329-341 (2014).</li><li>Hamperl, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Compositional+and+structural+analysis+of+selected+chromosomal+domains+from+Saccharomyces+cerevisiae.">Compositional and structural analysis of selected chromosomal domains from Saccharomyces cerevisiae.</a> Nucleic Acids Research. 42 (1), 2 (2014).</li><li>Wei&#946;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-copy+locus+proteomics+of+early-+and+late-firing+DNA+replication+origins+identifies+a+role+of+Ask1/DASH+complex+in+replication+timing+control.">Single-copy locus proteomics of early- and late-firing DNA replication origins identifies a role of Ask1/DASH complex in replication timing control.</a> Cell Reports. 42 (2), 112045 (2023).</li><li>Gietz, R. D., Schiestl, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+yeast+transformation+using+the+LiAc/SS+carrier+DNA/PEG+method.">High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method.</a> Nature Protocols. 2 (1), 31-34 (2007).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Towbin, H., Staehelin, T., Gordon, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+transfer+of+proteins+from+polyacrylamide+gels+to+nitrocellulose+sheets:+procedure+and+some+applications.">Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (9), 4350-4354 (1979).</li><li>Western blot membrane stripping for restaining protocol. Abcam Available from: <a target="_blank" href="https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol">https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol</a> (2023)</li><li>Vermeulen, M., D&#233;jardin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Locus-specific+chromatin+isolation.">Locus-specific chromatin isolation.</a> Nature Reviews. Molecular Cell Biology. 21 (5), 249-250 (2020).</li></ol>

Belirli bir hedef genomik bölgenin faktörlerinin ve kromatin manzarasının tanımlanması, kromatin araştırmalarında büyük bir zorluk oluşturmaya devam etmektedir18. Bu protokol, maya kromozomlarından farklı kromatin alanlarını spesifik olarak çıkarmak ve saflaştırmak için etkili bir sistemi tanımlar. Bildiğimiz kadarıyla, bu tek aşamalı saflaştırmanın saflığı ve verimi, lokusa özgü kromatin saflaştırma yöntemlerinin birçok sınırlamasının üstesinden gelir, b...

Ökaryotik genomların kromatine dinamik organizasyonu, DNA'yı çekirdeğin sınırlarına sığacak şekilde sıkıştırırken, gen ekspresyonu için yeterli dinamikleri ve düzenleyici faktörler için erişilebilirliği sağlar. Kısmen, bu çok yönlülüğe, histon oktamer1'in etrafına ~1.7 kez sarılmış 147 bp DNA'ya sahip bir çekirdek parçacığı içeren kromatinin temel birimi olan nükleozom aracılık eder. Nükleozom, N ve C terminal histon kuyruklarında çok sayıda histon varyantı ve posttranslasyonel modifikasyon (PTM'ler) ile bileşimine göre oldukça dinamik bir yapıdır. Ayrıca, ökaryotik kromatin, transkripsiyon faktörleri, DNA ve RNA işleme makineleri, mimari proteinler, kromatinin yeniden şekillenmesi ve modifikasyonunda yer alan enzimler ve kromatin ile ilişkili RNA molekülleri gibi çok sayıda başka temel bileşenle etkileşime girer. Transkripsiyon, replikasyon ve onarımda yer alan bu önemli makinelerin tümü, bu işlemler için doğal substrat görevi gören kromatine erişim gerektirir. Sonuç olarak, bu DNA işlemlerinin altında yatan moleküler mekanizmaların anlaşılması, bu makinelerin birleştiği ve biyolojik reaksiyonları kolaylaştırdığı spesifik genomik bölgelerdeki kromatin yapısındaki kolektif değişikliklerin kesin bir tanımını gerektirir.
Genetik ve protein-protein etkileşimi çalışmaları yoluyla çok sayıda kromatin faktörünün tanımlanmasına rağmen, belirli genomik bölgelerde kromatin etkileşimlerinin doğrudan, tarafsız ve kapsamlı analizlerinin yapılması önemli bir engel olarak kalmıştır 2,3. Başlangıçta, genomun yalnızca yüksek oranda bol bölgeleri (yani, tekrarlayan lokuslar) veya çok kopyalı plazmitler, ilişkili proteinlerinkütle spektrometrik tanımlaması için yeterli miktarda ve saflıkta izole edilebilirdi 4,5,6,7. Yakalama problarının kromatinize DNA'ya doğrudan hibridizasyonuna, CRISPR-dCas9 sistemi kullanılarak yakınlık biyotinilasyonuna veya diziye özgü adaptör proteinlerinin ilgilenilen lokusa bağlanmasına dayanan bir dizi yeni yaklaşım, maya ve memeli genomlarından tek kopya lokusların proteomunu çözmeye başlamıştır 8,9,10. Bununla birlikte, tüm bu yöntemler, protein-DNA etkileşimlerini stabilize etmek için formaldehit çapraz bağlama ve sonraki saflaştırma için kromatini çözündürmek için sonikasyon gerektirir. Birlikte, her iki manipülasyon da saflaştırılmış kromatinin müteakip yapısal ve fonksiyonel çalışmaları olasılığını dışlar.
Bu sınırlamaların üstesinden gelmek için, daha önce maya 11,12'den hedeflenen kromozomal alanları çıkarmak için bölgeye özgü rekombinasyon kullanan bir metodoloji tasarladık. Özünde, ilgilenilen genomik bölge, Zygosaccharomyces rouxi'den bölgeye özgü R-rekombinaz için tanıma bölgeleri (RS) ile çevrilidir ve aynı zamanda aynı bölgedeki prokaryotik transkripsiyonel baskılayıcı LexA proteini (LexA) için üç DNA bağlanma bölgesinden oluşan bir grup içerir. Maya hücreleri, R-rekombinazın eşzamanlı ekspresyonu için bir ekspresyon kaseti ve bir tandem afinite saflaştırma (TAP) etiketine kaynaşmış bir LexA proteini içerir. R-rekombinazın indüksiyonundan sonra, enzim hedeflenen bölgeyi kromozomdan dairesel bir kromatin alanı şeklinde verimli bir şekilde çıkarır. Bu alan, LexA DNA bağlanma bölgelerine ve ayrıca bir afinite desteğine bağlanan LexA-TAP adaptör proteini aracılığıyla saflaştırılabilir. Bu yöntem son zamanlarda maya kromozomu III13'ün seçilmiş replikasyon kökenlerini içeren farklı kromatin alanlarını izole etmek için kullanılmıştır.
Bu ex vivo yaklaşımın en büyük avantajlarından biri, izole edilmiş malzemenin fonksiyonel analizlerine izin vermesidir. Örneğin, bu yöntemle saflaştırılan replikasyon orijin alanları, doğal in vivo montajlı kromatin şablonlarından bir test tüpünde orijin ateşlemesinin verimliliğini değerlendirmek için in vitro replikasyon testlerine tabi tutulabilir. Sonuç olarak, izole edilmiş materyalin biyokimyasal ve fonksiyonel karakterizasyonu, doğal kromatin şablonu ile birlikte saflaştırılmış proteinler kullanılarak nükleer işlemlerin yeniden oluşturulmasına izin verebilir. Özetle, bu metodoloji, belirli bir kromozomal işlem geçiren belirli bir genomik bölgenin kolektif bileşimsel ve yapısal kromatin değişikliklerini takip etmek mümkün olacağından, kromatin araştırmalarında heyecan verici bir yol açar.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Yeast strains</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Control Strain: MATa; ura3&#916;0; leu2&#916;0; his3&#916;1; met15&#916;0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td>
			<td></td>
			<td></td>
			<td>Section 1, see references 13 and 14</td>
		</tr>
		<tr>
			<td>Recombination Strain: MATa; ura3&#916;0; leu2&#916;0; his3&#916;1; met15&#916;0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR</td>
			<td></td>
			<td></td>
			<td>Section 1, see reference 13 and 14</td>
		</tr>
		<tr>
			<td>Plasmid</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>K238 plasmid</td>
			<td></td>
			<td></td>
			<td>Section 1, see reference 13 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>K071 Spike-in plasmid DNA</td>
			<td></td>
			<td></td>
			<td>Section 7.1, see reference 13 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Acetone</td>
			<td>Carl Roth</td>
			<td>5025.1</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium acetate (NH4Ac)</td>
			<td>Sigma Aldrich</td>
			<td>A7262</td>
			<td>Section 6 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium solution (NH4OH) 25%</td>
			<td>Merck Millipore</td>
			<td>533003</td>
			<td>Section 6 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ammonium sulfate</td>
			<td>Santa Cruz</td>
			<td>Sc-29085</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Bacto agar</td>
			<td>BD (VWR)</td>
			<td>90000-760</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Bacto peptone</td>
			<td>BD (VWR)</td>
			<td>211820</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>&#946;-Mercaptoethanol</td>
			<td>Sigma Aldrich</td>
			<td>07604</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Chemiluminescent substrate kit</td>
			<td>ThermoFisher</td>
			<td>34580</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Di-Sodium Hydrogen phosphate dodecahydrate</td>
			<td>Merck</td>
			<td>1.06579.1000</td>
			<td>Section 2 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>ThermoFisher</td>
			<td>15508013</td>
			<td>Section 4 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Merck</td>
			<td>100983</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid (EDTA)</td>
			<td>Sigma Aldrich</td>
			<td>ED</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Galactose (20% (w/v) stock)</td>
			<td>Sigma Aldrich</td>
			<td>G0625-1KG&#160; /&#160; 5KG</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Gel loading dye (6x)</td>
			<td>BioLabs</td>
			<td>B7024A</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Glusose</td>
			<td>Sigma-Aldrich</td>
			<td>G8270</td>
			<td>Section 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Carl Roth</td>
			<td>.0079.4</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Glycogen (5 mg/mL)</td>
			<td>Invitrogen</td>
			<td>AM9510</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Hydrochloric acid (HCl)</td>
			<td>PanReac AppliChem</td>
			<td>182109.1211</td>
			<td>Section 2, 4 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Magnesium Acetate (MgAc)</td>
			<td>Bernd Kraft</td>
			<td>15274.2600/C035</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Magnesium chloride (MgCl2)</td>
			<td>Sigma Aldrich</td>
			<td>M8266</td>
			<td>Section 6 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Nu PAGE LDS sample buffer (4x)</td>
			<td>Invitrogen</td>
			<td>2399549</td>
			<td>Section 7.2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)</td>
			<td>Invitrogen</td>
			<td>15593-031</td>
			<td>Section 7.1 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Potassium chloride (KCl)</td>
			<td>Sigma</td>
			<td>P9541</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Radioactively labeled &#945;-32P dATP (3,000 Ci/mmol, 10 mCi/mL)</td>
			<td>Hartmann Analytic</td>
			<td>SRP-203</td>
			<td>Section 7.1 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>RadPrime labeling system</td>
			<td>ThermoFisher</td>
			<td>18428-011</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Raffinose (20% (w/v) stock)</td>
			<td>SERVA</td>
			<td>34140.03</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium chloride (NaCl)</td>
			<td>Merck</td>
			<td>K53710504142</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium citrate (Na3C6H5O7)</td>
			<td>Sigma-Aldrich</td>
			<td>71402</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium hydroxide (NaOH)</td>
			<td>Sigma Aldrich</td>
			<td>S5881</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )</td>
			<td>Alfa Aesar</td>
			<td>A11183</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium phosphate monobasic</td>
			<td>Sigma-Aldrich</td>
			<td>71496</td>
			<td>Section 2 and 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Sodium&#160;azide</td>
			<td>Santa Cruz&#160;Biotechnology</td>
			<td>sc-208393</td>
			<td>Section 2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>&#160;Triethylamine</td>
			<td>Sigma Aldrich</td>
			<td>90340</td>
			<td>Section 2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Tris base</td>
			<td>Chem Cruz</td>
			<td>SC-3715B</td>
			<td>Section 2 and 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td>X100</td>
			<td>Section 2 and 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Tween-20</td>
			<td>Bernd Kraft</td>
			<td>18014332</td>
			<td>Section 4 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>BD (VWR)</td>
			<td>212720</td>
			<td>Section 3 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Yeast mating factor alpha (1 &#181;g/mL stock )</td>
			<td>&#160;Biomol</td>
			<td>Y2016.5</td>
			<td>Section 3 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Yeast Synthetic Drop-out medium Supplements without LEUCINE</td>
			<td>Sigma Aldrich</td>
			<td>Y1376</td>
			<td>Section 1, see reference 14</td>
		</tr>
		<tr>
			<td>Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HpaI restriction enzyme (5,000 U/mL)</td>
			<td>NEB</td>
			<td>R0105S</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Protease and Phosphatase Inhibitor Cocktail (100x)</td>
			<td>ThermoFisher Scientific</td>
			<td>78446</td>
			<td>Section 4 
			Storage: Store at4 &#176;C</td>
		</tr>
		<tr>
			<td>Proteinase K (10 mg/mL)</td>
			<td>SERVA</td>
			<td>33756</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>RNase A (10 mg/mL)</td>
			<td>&#160;ThermoFisher</td>
			<td>EN0531</td>
			<td>Section 7.1 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>TEV protease (10000 U/&#181;L)</td>
			<td>NEB</td>
			<td>P8112S</td>
			<td>Section 5 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Materials</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BcMag Epoxy-Activated Magnetic Beads</td>
			<td>Bioclone Inc.</td>
			<td>FC-102</td>
			<td>Section 2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Dry ice</td>
			<td></td>
			<td></td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Low-binding centrifuge tubes 2.0 mL</td>
			<td>Eppendorf</td>
			<td>22431102</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Microspin&#160;G-25 Columns</td>
			<td>Cytiva</td>
			<td>27-5325-01</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>Merck</td>
			<td>P7793</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Positive nylon membrane</td>
			<td>Biozol</td>
			<td>11MEMP0001</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>PVDF transfer membrane</td>
			<td>Immobilon-Merck Millipore</td>
			<td>IPVH00010</td>
			<td>Section 7.2 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)</td>
			<td>Invitrogen</td>
			<td>&#160;NP0336BOX</td>
			<td>Section 7.2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Syringe (25 mL) with luer fitting</td>
			<td>Henke Sass Wolf</td>
			<td>4200-000V0</td>
			<td>Section 3</td>
		</tr>
		<tr>
			<td>Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)</td>
			<td>Cytiva</td>
			<td>3030-917</td>
			<td>Section 7.1 
			Storage: Store at room temperature</td>
		</tr>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody</td>
			<td>Merck Millipore</td>
			<td>06-719</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate</td>
			<td>Invitrogen</td>
			<td>G21234</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins</td>
			<td>Sigma Aldrich</td>
			<td>P1291-500UL</td>
			<td>Section 7.2 
			Storage: Store at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Rabbit IgG antibodies</td>
			<td>Sigma</td>
			<td>I5006-100MG</td>
			<td>Section 2 
			Storage: Store at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Primers (10 &#181;M)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ARS316: fwd 5&#39;- CGGCATTATCGTACACAACCT, rev 5&#39;- GTTCTTCGTTGCCTACATTTTCT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>K071 Spike-in plasmid DNA: fwd: 5&#39;-TTTTCGCTGCTTGTCCTTTT, rev 5&#39;- CATTTTCGTCCTCCCAACAT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>PCR fragment from yeast genomic DNA as a template &#160;for ARS316 amplification (for southern blot): fwd 5&#8217;- AAATTCTGCCCTTGATTCGT&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; rev 5&#8217;- TTTGTTTATCTCATCACTAAT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>PDC1: fwd 5&#39;- CATGATCAGATGGGGCTTCA, rev 5&#39;-ACCGGTGGTAGCGACTCTGT</td>
			<td></td>
			<td></td>
			<td>Section 7.1</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Coffee grinder</td>
			<td>Gastroback</td>
			<td>42601</td>
			<td>Section 4</td>
		</tr>
		<tr>
			<td>Dewar flask</td>
			<td>NAL GENE</td>
			<td>4150-2000</td>
			<td>Section 3</td>
		</tr>
		<tr>
			<td>DynaMag TM-2 magnetic rack</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td>Section 4, 5 and 6</td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Hybaid Mini10</td>
			<td>Ri418</td>
			<td>Section 2</td>
		</tr>
		<tr>
			<td>Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5424R</td>
			<td>Section 4 and 7.1</td>
		</tr>
		<tr>
			<td>UV-crosslinker</td>
			<td>Analytikjena</td>
			<td>95-0174-02</td>
			<td>Section 7.1</td>
		</tr>
	</tbody>
</table>

single-copy gene locus chromatin purification in saccharomyces cerevisiae

Ökaryotik kromatinin temel organizasyon birimi, bir histon oktamerinin etrafına ~1.7 kez sarılmış DNA'yı içeren nükleozom çekirdek parçacığıdır (NCP). Kromatin, NCP'lerin ve transkripsiyon faktörleri, kromatin yeniden şekillenmesi ve modifiye edici enzimler dahil olmak üzere çok sayıda başka protein kompleksinin varlığı olarak tanımlanır. Bu protein-DNA etkileşimlerinin, hücre döngüsünün farklı aşamalarında spesifik genomik lokuslar düzeyinde nasıl düzenlendiği hala belirsizdir. Bunun başlıca nedeni, bu tür dinamik etkileşimlerin hassas ölçümlerini elde etmeyi zorlaştıran mevcut teknik sınırlamalardır. Burada, doğal kromatin durumunda ilgilenilen tek kopyalı bir gen lokusunu izole etmek için bölgeye özgü rekombinasyonu verimli bir tek adımlı afinite saflaştırma protokolü ile birleştiren geliştirilmiş bir yöntemi açıklıyoruz. Yöntem, hedef lokusun genomik kromatin üzerinde sağlam bir şekilde zenginleştirilmesine izin vererek, bu tekniği protein etkileşimlerini tarafsız ve sistematik bir şekilde, örneğin kütle spektrometrisi ile tanımlamak ve ölçmek için etkili bir strateji haline getirir. Bu tür bileşimsel analizlere ek olarak, bu yöntemle saflaştırılan doğal kromatin, muhtemelen nükleozom konumlandırma ve histon modifikasyonları ile ilgili in vivo durumu yansıtır ve bu nedenle, mayadaki hemen hemen her genomik lokustan türetilen kromatinin daha ileri yapısal ve biyokimyasal analizlerine uygundur.

The dynamic organization of eukaryotic genomes into chromatin compacts the DNA to fit within the confines of the nucleus while ensuring sufficient dynamics for gene expression and accessibility for regulatory factors. In part, this versatility is mediated by the nucleosome, the basic unit of chromatin, which comprises a core particle with 147 bp of DNA wrapped ~1.7 times around the histone octamer1. The nucleosome is a highly dynamic structure with respect to its composition, with numerous histone variants and posttranslational modifications (PTMs) on the N- and C-terminal histone tails. Furthermore, eukaryotic chromatin interacts with a multitude of other essential components, such as transcription factors, DNA and RNA processing machinery, architectural proteins, enzymes involved in chromatin remodeling and modification, and RNA molecules associated with chromatin. These crucial machineries involved in transcription, replication, and repair all require access to chromatin, which serves as the natural substrate for these processes. Consequently, comprehending the molecular mechanisms underlying these DNA transactions necessitates a precise definition of the collective alterations in chromatin structure at the specific genomic regions where these machineries converge and facilitate biological reactions.
Despite the identification of numerous chromatin factors through genetics and protein-protein interaction studies, performing direct, unbiased, and comprehensive analyses of chromatin interactions at particular genomic sites has remained a significant obstacle2,3. Initially, only highly abundant regions of the genome (i.e., repetitive loci) or multi-copy plasmids could be isolated in sufficient amounts and purity for mass spectrometric identification of the associated proteins4,5,6,7. A series of new approaches based on the direct hybridization of capture probes to chromatinized DNA, proximity biotinylation using the CRISPR-dCas9 system, or the binding of sequence-specific adapter proteins to the locus of interest have started to unravel the proteome of single-copy loci from yeast and mammalian genomes8,9,10. However, all these methods require formaldehyde crosslinking to stabilize the protein-DNA interactions and sonication to solubilize the chromatin for subsequent purification. Together, both manipulations exclude the possibility of subsequent structural and functional studies of the purified chromatin.
To overcome these limitations, we previously devised a methodology that employs site-specific recombination to extract targeted chromosomal domains from yeast11,12. In essence, the genomic region of interest is surrounded by recognition sites (RS) for the site-specific R-recombinase from Zygosaccharomyces rouxi while simultaneously incorporating a group of three DNA binding sites for the prokaryotic transcriptional repressor LexA protein (LexA) within the same region. The yeast cells contain an expression cassette for the simultaneous expression of R-recombinase and a LexA protein fused to a tandem affinity purification (TAP) tag. After the induction of R-recombinase, the enzyme efficiently excises the targeted region from the chromosome in the form of a circular chromatin domain. This domain can be purified via the LexA-TAP adapter protein, which binds to the LexA DNA binding sites, as well as to an affinity support. This method has been recently used to isolate distinct chromatin domains containing selected replication origins of yeast chromosome III13.
One major advantage of this ex vivo approach is that it allows for functional analyses of the isolated material. For example, replication origin domains purified with this method can be subjected to in vitro replication assays to assess the efficiency of origin firing in a test tube from native in vivo assembled chromatin templates. Ultimately, the biochemical and functional characterization of the isolated material may allow the reconstitution of nuclear processes using purified proteins together with the native chromatin template. In summary, this methodology opens an exciting avenue in chromatin research, as it will be possible to follow the collective compositional and structural chromatin changes of a specific genomic region undergoing a certain chromosomal transaction.

Yazar Spotlight: Kromatin Araştırmalarını Geliştirme ve Yüksek Zenginleştirme Locus'a Özgü Kromatin İzolasyon Protokolü ile Sınırlamaların Üstesinden Gelme 

Saccharomyces cerevisiae'de Tek Kopya Gen Lokus Kromatin Saflaştırması

A eukaryotic nucleus is very crowded with many biological processes occurring simultaneously. The scope of our research is to understand how all of these processes are coordinated on our genomes without major accidents that would otherwise lead to genomic instability and human diseases. This protocol allows us to purify a specific locus of the genome in its native state, allowing both the compositional and functional characterization of the isolated material, such as the measurements of protein DNA interactions.This protocol enables an enormous level of enrichment of a targeted locus, which overcomes many current limitations of locus-specific chromatin isolation. The material has not been cross-linked. That also allows many downstream functional analysis, such as in vitro transcription or in vitro replication.This protocol enabled us to excise and purify distinct replication origins from yeast chromosomes, allowing us to perform a proteomic analysis and identify novel origin interacting chromatin factors, and therefore, advance the research field of DNA replication. This protocol enables in vitro replication studies using the purified origin material to examine chromatin states, histone modifications, and perform structural analysis on the native nucleosomal templates from endogenous chromosomes, advancing chromatin research.

~ 1.4 kb ARS316 kromatin alanının saflaştırılmasına, yapısal olarak eksprese edilen LexA-TAP adaptör proteini aracılık etti. Negatif bir kontrol olarak hizmet etmek için, LexA-TAP'ı eksprese eden ancak entegre RS ve LexA bağlanma bölgeleri içermeyen izojenik bir suş kullanarak saflaştırmalar gerçekleştirdik. Şekil 3 , ARS316 lokusunu hedef alan hem kontrol hem de rekombinasyon yetkin bir suş üzerinde gerçekleştirilen standart bir saflaştırma deneyinden elde edilen ...

Watch this Scientific Journal Video about Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol at JoVE.com

Bu protokol, tomurcuklanan maya, Saccharomyces cerevisiae'den doğal kromatin bağlamında ilgilenilen tek kopyalı bir gen lokusunu saflaştırmak için bölgeye özgü rekombinasyona dayalı lokusa özgü bir kromatin izolasyon yöntemi sunar.

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone ...

Ökaryotik bir çekirdek, aynı anda meydana gelen birçok biyolojik süreçle çok kalabalıktır. Araştırmamızın kapsamı, tüm bu süreçlerin, aksi takdirde genomik kararsızlığa ve insan hastalıklarına yol açacak büyük kazalar olmadan genomlarımız üzerinde nasıl koordine edildiğini anlamaktır. Bu protokol, genomun belirli bir lokusunu doğal durumunda saflaştırmamıza izin vererek, protein DNA etkileşimlerinin ölçümleri gibi izole edilmiş materyalin hem bileşimsel hem de fonksiyonel karakterizasyonuna izin verir.Bu protokol, lokusa özgü kromatin izolasyonunun mevcut birçok sınırlamasının üstesinden gelen, hedeflenen bir lokusun muazzam düzeyde zenginleştirilmesini sağlar. Malzeme çapraz bağlanmamıştır. Bu aynı zamanda in vitro transkripsiyon veya in vitro replikasyon gibi birçok aşağı akış fonksiyonel analizine de izin verir.Bu protokol, maya kromozomlarından farklı replikasyon kökenlerini çıkarmamızı ve saflaştırmamızı sağlayarak, proteomik bir analiz yapmamıza ve yeni orijin etkileşimli kromatin faktörlerini tanımlamamıza ve dolayısıyla DNA replikasyonunun araştırma alanını ilerletmemize olanak sağladı. Bu protokol, kromatin durumlarını, histon modifikasyonlarını incelemek ve endojen kromozomlardan alınan doğal nükleozomal şablonlar üzerinde yapısal analiz yapmak için saflaştırılmış orijin materyalini kullanarak in vitro replikasyon çalışmalarını mümkün kılar ve kromatin araştırmalarını ilerletir.

single-copy-gene-locus-chromatin-purification-saccharomyces

Research

JoVE Journal

Biochemistry

Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone octamer. Chromatin is defined as the entity of NCPs and numerous other protein complexes, including transcription factors, chromatin remodeling and modifying enzymes. It is still unclear how these protein-DNA interactions are orchestrated at the level of specific genomic loci during different stages of the cell cycle. This is mainly due to the current technical limitations, which make it challenging to obtain precise measurements of such dynamic interactions. Here, we describe an improved method combining site-specific recombination with an efficient single-step affinity purification protocol to isolate a single-copy gene locus of interest in its native chromatin state. The method allows for the robust enrichment of the target locus over genomic chromatin, making this technique an effective strategy for identifying and quantifying protein interactions in an unbiased and systematic manner, for example by mass spectrometry. Further to such compositional analyses, native chromatin purified by this method likely reflects the in vivo situation regarding nucleosome positioning and histone modifications and is, therefore, amenable to further structural and biochemical analyses of chromatin derived from virtually any genomic locus in yeast.

This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.

Biyokimya

Yeast Cell Culture and Cell Harvesting for Single-Copy Gene Locus Chromatin Purification

Begin by inoculating the control and recombination competent yeast strains from YPD plates into five milliliters of YPR medium, and grow the culture overnight at 30 degrees Celsius and 200 RPM. Next, scale up the culture by inoculating two milliliters into 100 milliliters of fresh YPR medium and growing it overnight at 30 degrees Celsius and 200 RPM. For each strain, dispense 1, 800 milliliters of autoclave yeast Peptone medium, and 200 milliliters of autoclave 20%raffinose solution into two 5 liter Erlenmeyer flasks.Inoculate each yeast strain with 0.2 optical density at 600 nanometers in the respective medium, and incubate for about six hours at 200 RPM, or until the cells reach the desired 1.0 optical density. Add 200 milliliters of 2%galactose and 110 microliters of yeast mating factor alpha or YMFA simultaneously to arrest cells in the G1 phase and incubate it for two hours. Transfer the cell suspension into one liter centrifuge buckets and centrifuge the bucket at 6, 000 G and four degrees Celsius for 10 minutes.Discard the supernatant and resuspend the cell pellets in 10 to 15 milliliters of distilled water. Next, seal a 25 milliliter syringe with a lure plug and place it inside a 50 milliliter conical tube filled with water. Transfer the cell suspension to the syringe assembly.Wash the centrifuge buckets with five milliliters of distilled water to collect the remaining cells. Then, centrifuge the assembly at 2, 397 G for 10 minutes at room temperature and discard the supernatant. Then remove the lure plug from the syringe and extrude the cells into liquid nitrogen to form cell spaghetti.Lastly, transfer the frozen cell spaghetti into a 50 milliliter conical tube and store it at minus 80 degrees Celsius until further use.

Maya Hücre Kültürü ve Tek Kopyalı Gen Lokus Kromatin Saflaştırması için Hücre Toplama

Locus-Specific Chromatin Purification from Saccharomyces cerevisiae

Locus-Specific Chromatin Purification from Saccharomyces cerevisiae  

Begin cooling a commercial coffee grinder by grinding approximately 30 to 50 grams of dry ice twice, for 30 seconds each time. Discard the dry ice powder and mix three grams of frozen yeast cell spaghetti with approximately 30 to 50 grams of dry ice in the pre-cooled coffee grinder. Seal the junction between the cap and the grinder with Parafilm.Mix the yeast cell dry ice mix 10 times, for 30 seconds each, allowing 30-second intervals between every round. Transfer the resulting yeast cell dry ice powder to a plastic beaker, using a clean and dry spatula. After dry ice evaporation, add 2.25 milliliters of magnetic bead, or MB buffer, with protease and phosphatase inhibitors, to the yeast cell powder.After vigorously pipetting the cell buffer mixture, transfer the cell suspension to a 15-milliliter conical tube. Next, store 0.1%samples from the crude cell extracts for DNA, and 0.05%samples for protein analysis, at minus-20 degrees Celsius. Transfer the remaining cell suspension into low-binding two-milliliter reaction tubes, and separate cell debris by centrifuging the tubes.Once done, pull all supernatants into one 15-milliliter conical tube. Again, store 0.1%of the supernatant at minus-20 degrees Celsius for DNA, and 0.05%of the supernatant for protein analysis. Next, wash 500 microliters of immunoglobulin G-coupled magnetic bead slurry with 500 microliters of cold MB buffer, containing protease and phosphatase inhibitors, two times, for five minutes each, at four degrees Celsius, on rotation at 20 RPM.Incubate the magnetic beads in 500 microliters of cold MB buffer for one hour at four degrees Celsius, on rotation at 20 RPM, before removing the supernatant from the beads using a magnetic rack. Mix the equilibrated magnetic bead slurry with the cell lysate obtained earlier and pulled into a 15-milliliter conical tube. After incubating for two hours at four degrees Celsius and 20 RPM, transfer the complete magnetic bead cell lysate suspension to low-binding reaction tubes.Separate the magnetic beads carrying the chromatin rings of interest from the cell lysate, using a magnetic rack. Transfer the remaining flow-through from each tube to a fresh 15-milliliter conical tube, before storing some samples at minus-20 degrees Celsius for DNA and protein analysis. Next, suspend the magnetic bead from each 15-milliliter conical tube in 300 microliters of cold MB buffer, and combine the beads into one reaction tube.Perform five washes of 10 minutes each, using 750 microliters of cold MB buffer, containing protease and phosphatase inhibitors, at four degrees Celsius, while rotating at 20 RPM. Next, conduct the final wash with 750 microliters of cold MB buffer without protease and phosphatase inhibitors. Suspend the prepared beads in 40 microliters of cold MB buffer without protease and phosphatase inhibitors.

Saccharomyces cerevisiae'den Locus'a Özgü Kromatin Saflaştırması

TEV Protease-Mediated Elution and Denaturation Elution of the Chromatin Locus Purified from Saccharomyces cerevisiae

TEV Protease-Mediated Elution and Denaturation Elution of the Chromatin Locus Purified from Saccharomyces cerevisiae  

Release the lexA CBP chromatin ring complexes from the magnetic beads used to purify chromatin single-copy gene locus by incubating the bees with two microliters of 6xHis-tagged recombinant tobacco etch virus or TEV protease. After separating the bees from the final eluate using a magnetic rack transfer, the eluate containing cleaved chromatin rings to a new 1.5-milliliter reaction tube. Again, place the tubes on a magnetic rack to separate residual beads from the final eluate.Resuspend the beads in 750 microliters of cold ammonium carbonate buffer before storing some samples at 20 Celsius for DNA and protein analysis. From the final eluate, take out the samples and store them at 20 degrees Celsius for DNA and protein analysis. Further, take samples from the residual beads.Begin the denaturation elution by washing the magnetic beads two times in 750 microliters of cold ammonium carbonate buffer for 20 minutes each, four degrees Celsius rotating at 20 revolutions per minute. Next, add 500 microliters of 0.5 molar ammonium hydroxide to the beads to extract bound lexA chromatin complexes and incubate for 30 minutes at room temperature. Separate the beads from the suspension using a magnetic rack and transfer the eluate to a low binding reaction tube.Incubate the low binding reaction tube at room temperature for 30 minutes and separate the beads from the suspension using a magnetic rack. Once done, transfer the eluate to a low binding reaction tube. Resuspend the beads in 750 microliters of deionized water and collect samples for DNA and protein analysis.Lastly, obtain DNA and protein analysis samples from the final eluate. In the study, the purification efficiency of the ARS316 locus and the recombination strain was quantified and compared to the control locus PDC1. The ARS316 locus showed lower recovery in the flow through compared to PDC1.Although a fraction of chromatin rings remained bound to the TEV beads due to incomplete TEV protease cleavage, denaturation elution resulted in 80 to 90%ARS316 locus recovery. This corresponds to the high enrichment of ARS316 molecules in TEV beads and denaturation elution fractions when factoring in the size of the yeast genome compared to the control strain that showed no enrichment of ARS316 locus in any of the quantified fractions. After TEV elution, the beads showed a higher recovery percentage of the ARS316 locus as the TEV cleavage efficiency was not 100%This resulted in a fraction of chromatin rings remaining bound to the beads.However, the denaturing elusion showed 80 to 90%recovery of the ARS316 locus and the recombination strain corresponding to the high enrichment of ARS316 molecules when factoring in the size of the yeast genome.