Name: Author Spotlight: Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies
Uploaded: 2023-09-15T14:10:00
Description: Watch this Scientific Journal Video about Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies at JoVE.com

تم دعم هذا العمل من قبل المؤسسة الوطنية للعلوم الطبيعية في الصين (82160550).

1. قاعدة بيانات أطلس جينوم السرطان (TCGA)
ملاحظة: تحتوي قاعدة بيانات أطلس جينوم السرطان (TCGA) على بيانات تسلسل الجينات في أنسجة الورم المختلفة14. تم استخراج بيانات RNA-seq في TCGA لدراسة TMEM200A نسخة لكل جزء في المليون (TPM) من موقع UCSC Xena <sup class="xref"...

TMEM200A: A Novel Oncogene Regulating EMT and PI3K/AKT in Gastric Cancer

<ol>
	<li>Torre, L. A., Siegel, R. L., Ward, E. M., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+cancer+incidence+and+mortality+rates+and+trends--an+update.">Global cancer incidence and mortality rates and trends--an update.</a> Cancer Epidemiol Biomarkers Prev. 25 (1), 16-27 (2016).</li><li>Long, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+of+malignant+tumors+-+Yichang+City,+Hubei+Province,+China,+2019.">Economic burden of malignant tumors - Yichang City, Hubei Province, China, 2019.</a> China CDC Wkly. 4 (15), 312-316 (2022).</li><li>Harbeck, N., Gnant, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breast+cancer.">Breast cancer.</a> Lancet. 389 (10074), 1134-1150 (2017).</li><li>Bagchi, S., Yuan, R., Engleman, E. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+the+treatment+of+cancer:+clinical+impact+and+mechanisms+of+response+and+resistance.">Immune checkpoint inhibitors for the treatment of cancer: clinical impact and mechanisms of response and resistance.</a> Annu Rev Pathol. 16, 223-249 (2021).</li><li>Lam, G. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pitfalls+in+cutaneous+melanoma+diagnosis+and+the+need+for+new+reliable+markers.">Pitfalls in cutaneous melanoma diagnosis and the need for new reliable markers.</a> Mol Diagn Ther. 27 (1), 49-60 (2023).</li><li>Gromiha, M. M., Ou, Y. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatics+approaches+for+functional+annotation+of+membrane+proteins.">Bioinformatics approaches for functional annotation of membrane proteins.</a> Brief Bioinform. 15 (2), 155-168 (2014).</li><li>Schmit, K., Michiels, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TMEM+proteins+in+cancer:+a+review.">TMEM proteins in cancer: a review.</a> Front Pharmacol. 9, 1345 (2018).</li><li>Marx, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmembrane+(TMEM)+protein+family+members:+Poorly+characterized+even+if+essential+for+the+metastatic+process.">Transmembrane (TMEM) protein family members: Poorly characterized even if essential for the metastatic process.</a> Semin Cancer Biol. 60, 96-106 (2020).</li><li>Fu, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+transmembrane+protein+168+in+the+mouse+nucleus+accumbens+induces+anxiety+and+sensorimotor+gating+deficit.">Overexpression of transmembrane protein 168 in the mouse nucleus accumbens induces anxiety and sensorimotor gating deficit.</a> PLoS One. 12 (12), e0189006 (2017).</li><li>Cuajungco, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+accumulation+of+human+transmembrane+(TMEM)-176A+and+176B+proteins+is+associated+with+cancer+pathology.">Abnormal accumulation of human transmembrane (TMEM)-176A and 176B proteins is associated with cancer pathology.</a> Acta Histochem. 114 (7), 705-712 (2012).</li><li>Zhang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TMEM116+is+required+for+lung+cancer+cell+motility+and+metastasis+through+PDK1+signaling+pathway.">TMEM116 is required for lung cancer cell motility and metastasis through PDK1 signaling pathway.</a> Cell Death Dis. 12 (12), 1086 (2021).</li><li>Zhang, N., Pan, H., Liang, X., Xie, J., Han, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+roles+of+transmembrane+family+proteins+in+the+regulation+of+store-operated+Ca(2+)+entry.">The roles of transmembrane family proteins in the regulation of store-operated Ca(2+) entry.</a> Cell Mol Life Sci. 79 (2), 118 (2022).</li><li>Zhang, X., Zheng, P., Li, Z., Gao, S., Liu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+somatic+mutation+landscape+and+RNA+prognostic+markers+in+stomach+adenocarcinoma.">The somatic mutation landscape and RNA prognostic markers in stomach adenocarcinoma.</a> Onco Targets Ther. 13, 7735-7746 (2020).</li><li>Jia, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mining+TCGA+database+for+genes+of+prognostic+value+in+glioblastoma+microenvironment.">Mining TCGA database for genes of prognostic value in glioblastoma microenvironment.</a> Aging (Albany NY). 10 (4), 592-605 (2018).</li><li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UCSCXenaShiny:+an+R/CRAN+package+for+interactive+analysis+of+UCSC+Xena+data.">UCSCXenaShiny: an R/CRAN package for interactive analysis of UCSC Xena data.</a> Bioinformatics. 38 (2), 527-529 (2022).</li><li>Li, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TIMER2.0+for+analysis+of+tumor-infiltrating+immune+cells.">TIMER2.0 for analysis of tumor-infiltrating immune cells.</a> Nucleic Acids Res. 48 (W1), W509-W514 (2020).</li><li>Thul, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+subcellular+map+of+the+human+proteome.">A subcellular map of the human proteome.</a> Science. 356 (6340), eaal3321 (2017).</li><li>Li, Y., Ge, D., Lu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SMART+App:+an+interactive+web+application+for+comprehensive+DNA+methylation+analysis+and+visualization.">The SMART App: an interactive web application for comprehensive DNA methylation analysis and visualization.</a> Epigenetics Chromatin. 12 (1), 71 (2019).</li><li>Chandrashekar, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UALCAN:+An+update+to+the+integrated+cancer+data+analysis+platform.">UALCAN: An update to the integrated cancer data analysis platform.</a> Neoplasia. 25, 18-27 (2022).</li><li>Tate, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=COSMIC:+the+Catalogue+Of+Somatic+Mutations+In+Cancer.">COSMIC: the Catalogue Of Somatic Mutations In Cancer.</a> Nucleic Acids Res. 47 (D1), D941-D947 (2019).</li><li>Gao, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+complex+cancer+genomics+and+clinical+profiles+using+the+cBioPortal.">Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal.</a> Sci Signal. 6 (269), pl1 (2013).</li><li>Shen, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sangerbox:+A+comprehensive,+interaction-friendly+clinical+bioinformatics+analysis+platform.">Sangerbox: A comprehensive, interaction-friendly clinical bioinformatics analysis platform.</a> iMeta. 1 (3), e36 (2022).</li><li>Ru, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TISIDB:+an+integrated+repository+portal+for+tumor-immune+system+interactions.">TISIDB: an integrated repository portal for tumor-immune system interactions.</a> Bioinformatics. 35 (20), 4200-4202 (2019).</li><li>Yuan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CancerSEA:+a+cancer+single-cell+state+atlas.">CancerSEA: a cancer single-cell state atlas.</a> Nucleic Acids Res. 47 (D1), D900-D908 (2019).</li><li>Sun, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TISCH:+a+comprehensive+web+resource+enabling+interactive+single-cell+transcriptome+visualization+of+tumor+microenvironment.">TISCH: a comprehensive web resource enabling interactive single-cell transcriptome visualization of tumor microenvironment.</a> Nucleic Acids Res. 49 (D1), D1420-D1430 (2021).</li><li>Warde-Farley, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GeneMANIA+prediction+server:+biological+network+integration+for+gene+prioritization+and+predicting+gene+function.">The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function.</a> Nucleic Acids Res. 38, W214-W220 (2010).</li><li>Zhu, Y., Feng, S., Song, Z., Wang, Z., Chen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+immunological+characteristics+and+immune+subtypes+based+on+single-sample+gene+set+enrichment+analysis+algorithm+in+lower-grade+glioma.">Identification of immunological characteristics and immune subtypes based on single-sample gene set enrichment analysis algorithm in lower-grade glioma.</a> Front Genet. 13, 894865 (2022).</li><li>Mueller Bustin, S. A., R, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+reverse+transcription+PCR+(qRT-PCR)+and+its+potential+use+in+clinical+diagnosis.">Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis.</a> Clin Sci (Lond). 109 (4), 365-379 (2005).</li><li>Sun, L., Zhang, H., Gao, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+reprogramming+and+epigenetic+modifications+on+the+path+to+cancer.">Metabolic reprogramming and epigenetic modifications on the path to cancer.</a> Protein Cell. 13 (12), 877-919 (2022).</li><li>Ntontsi, P., Photiades, A., Zervas, E., Xanthou, G., Samitas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+and+epigenetics+in+asthma.">Genetics and epigenetics in asthma.</a> Int J Mol Sci. 22 (5), 2412 (2021).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+metabolism:+looking+forward.">Cancer metabolism: looking forward.</a> Nat Rev Cancer. 21 (10), 669-680 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PremPS:+Predicting+the+impact+of+missense+mutations+on+protein+stability.">PremPS: Predicting the impact of missense mutations on protein stability.</a> PLoS Comput Biol. 16 (12), e1008543 (2020).</li><li>Li, M., Petukh, M., Alexov, E., Panchenko, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+the+impact+of+missense+mutations+on+protein-protein+binding+affinity.">Predicting the impact of missense mutations on protein-protein binding affinity.</a> J Chem Theory Comput. 10 (4), 1770-1780 (2014).</li><li>Hirsch, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+responses+to+PD-1+inhibition+and+their+molecular+characterization+in+six+patients+with+mismatch+repair-deficient+metastatic+cancer+of+the+digestive+system.">Clinical responses to PD-1 inhibition and their molecular characterization in six patients with mismatch repair-deficient metastatic cancer of the digestive system.</a> J Cancer Res Clin Oncol. 147 (1), 263-273 (2021).</li><li>Poulogiannis, G., Frayling, I. M., Arends, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+mismatch+repair+deficiency+in+sporadic+colorectal+cancer+and+Lynch+syndrome.">DNA mismatch repair deficiency in sporadic colorectal cancer and Lynch syndrome.</a> Histopathology. 56 (2), 167-179 (2010).</li><li>Chintamani, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+mismatched+repair+genes+and+their+correlation+with+clinicopathological+parameters+and+response+to+neo-adjuvant+chemotherapy+in+breast+cancer.">The expression of mismatched repair genes and their correlation with clinicopathological parameters and response to neo-adjuvant chemotherapy in breast cancer.</a> Int Semin Surg Oncol. 4, 5 (2007).</li><li>Deng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+expression+of+TMEM200A+is+associated+with+a+poor+prognosis+and+immune+infiltration+in+gastric+cancer.">High expression of TMEM200A is associated with a poor prognosis and immune infiltration in gastric cancer.</a> Pathol Oncol Res. 29, 1610893 (2023).</li><li>Stemmler, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cadherins+in+development+and+cancer.">Cadherins in development and cancer.</a> Mol Biosyst. 4 (8), 835-850 (2008).</li><li>Bill, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ANO1/TMEM16A+interacts+with+EGFR+and+correlates+with+sensitivity+to+EGFR-targeting+therapy+in+head+and+neck+cancer.">ANO1/TMEM16A interacts with EGFR and correlates with sensitivity to EGFR-targeting therapy in head and neck cancer.</a> Oncotarget. 6 (11), 9173-9188 (2015).</li><li>De Las Rivas, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+drug+resistance+induced+by+EMT:+novel+therapeutic+strategies.">Cancer drug resistance induced by EMT: novel therapeutic strategies.</a> Arch Toxicol. 95 (7), 2279-2297 (2021).</li><li>Tian, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SERPINH1+regulates+EMT+and+gastric+cancer+metastasis+via+the+Wnt/&#946;-catenin+signaling+pathway.">SERPINH1 regulates EMT and gastric cancer metastasis via the Wnt/&#946;-catenin signaling pathway.</a> Aging (Albany NY). 12 (4), 3574-3593 (2020).</li></ol>

ينتمي TMEM200A إلى عائلة من TMEMs الضرورية لتكاثر الخلايا السرطانية38. حظي التعبير المتغير عن TMEM200A في الأورام الخبيثة المختلفة باهتمام أقل ، ولا يوجد تحقيق شامل في جميع أنحاء السرطان. ومع ذلك ، تستمر الأدلة في التراكم ، مما يدل على أن عائلة بروتين TMEM عبر الغشاء قد تكون مهمة ?...

برز السرطان كقضية صحية عامة مستمرة تعرض صحة الإنسان للخطر على مستوىالعالم 1بسبب ارتفاع معدلات المراضة والوفيات في جميع أنحاء العالم ، مما يشكل عبئا ماليا وطبيا ثقيلا على المجتمع2. تم تحقيق تقدم كبير في علاج السرطان في السنوات الأخيرة بفضل اكتشاف علامات السرطان3 ، وطور الباحثون طرقا تشخيصية جديدة وعقاقير جديدة لعلاج السرطان. ومع ذلك ، لا يزال بعض مرضى السرطان يعانون من توقعات سيئة بسبب عوامل مثل مقاومة الأدوية والآثار الجانبية للأدوية والحساسية الكيميائية4. لذلك ، هناك حاجة ملحة لتحديد مؤشرات حيوية جديدة لفحص وعلاج السرطانات في المراحل المبكرة5.
البروتينات الغشائية هي بروتينات يمكن أن ترتبط وتندمج في الخلايا وأغشية العضيات6. يمكن تجميعها في ثلاث فئات اعتمادا على قوة الارتباط بالغشاء وموقعها: البروتينات المثبتة على الدهون ، والبروتينات المتكاملة ، وبروتينات الغشاء المحيطي 7,8. البروتين عبر الغشاء (TMEM) هو بروتين غشائي متكامل يتكون من جزء واحد على الأقل عبر الغشاء9 ، والذي يمر إما كليا أو جزئيا عبر الغشاء البيولوجي.
على الرغم من أن آليات عمل البروتينات التي تنتمي إلى عائلة TMEM ليست مفهومة جيدا ، فمن المعروف أن هذه البروتينات تشارك في عدة أنواع من السرطانات10. ترتبط العديد من بروتينات TMEM بالأنماط الظاهرية المهاجرة والتكاثرية والغازية ، وغالبا ما يرتبط تعبيرها بتشخيص المريض11. لذلك ، أصبح أفراد عائلة TMEM هدفا للبحث. كشفت مراجعة شاملة للتقارير الحالية حول TMEM أنها ترتبط في الغالب بالإشارات بين الخلاياوداخلها 12 ، والأمراض المرتبطة بالمناعة ، وتكوين الأورام10. تمتلك العديد من TMEMs أيضا وظائف فسيولوجية مهمة ، على سبيل المثال ، القنوات الأيونية في غشاء البلازما ، وتفعيل مسارات نقل الإشارات ، بالإضافة إلى وساطة الانجذاب الكيميائي للخلايا ، والالتصاق ، وموت الخلايا المبرمج ، والالتهام الذاتي10. لذلك ، افترضنا أن بروتينات TMEM قد تكون علامات تنبؤية مهمة في اكتشاف الأورام وعلاجها.
TMEM200A التعبير مرتفع بشكل ملحوظ في سرطان المعدة (GC). تم ربط التعبير الأعلى عن TMEM200A 13 ، والذي يحتوي على ثمانية إكسونات وطول كامل يبلغ 77.536 كيلو بايت على الكروموسوم 6q23.1 ، بسوء تشخيص البقاء على قيد الحياة بشكل عام (OS) في حالات GC. ومع ذلك ، نادرا ما تم الإبلاغ عن التغييرات في تعبيره في دراسات الأورام. تقارن هذه المقالة وتحلل فائدة TMEM200A كهدف علاجي وعلامة تشخيصية للورم في دراسات السرطان المختلفة باستخدام مجموعات بيانات مختلفة متاحة للجمهور. قمنا بتقييم فعالية TMEM200A كمؤشر حيوي تشخيصي وتنبؤي للسرطان بالإضافة إلى مستويات تعبيره في أنواع مختلفة من السرطان البشري باستخدام بيانات RNA-seq من قواعد بيانات UCSC Xena و TCGA ، وكذلك عن طريق تفاعل البوليميراز المتسلسل الكمي في الوقت الفعلي (qRT-PCR) والنشاف الغربي.
تم التحقيق في تأثير مستويات التعبير TMEM200A على معدلات الطفرات ، والعمليات التنظيمية ، وتشخيص الورم والتشخيص ، وتسلل المناعة ، والعلاج المناعي باستخدام مزيج من الأدوات الحسابية ومواقع مجموعة البيانات. تم استخدام CBioPortal وكتالوج الطفرات الجسدية في الخلايا السرطانية (COSMIC) لفحص الطفرات في TMEM200A. تم استخدام مواقع Sangerbox و TISIDB لفهم كيفية تأثير TMEM200A على تسلل المناعة. تم استخدام أداة مركز الخلية الواحدة المناعية للورم (TISCH) عبر الإنترنت وقاعدة بيانات CancerSEA للتحقيق في وظيفة TMEM200A. أخيرا ، لتقييم تأثير TMEM200A على السلوك الخبيث ووظيفة تطور الورم لخلايا GC ، أجريت تجربة فقدان الوظيفة في فحص في المختبر . بالإضافة إلى ذلك ، تم إجراء النشاف الغربي لتقييم كيفية تأثير ضربة قاضية TMEM200A على مسار إشارات PI3K / AKT والانتقال الظهاري الوسيط-الوسيطة (EMT) في GC.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Anti-AKT antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>60203-2-Ig</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-E-cadherin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>20874-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>10494-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-N-cadherin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>22018-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-P-AKT antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>66444-1-Ig</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-snail antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>13099-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Vimentin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>10366-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>AxyPrepMultisourceTotalRNAMini- 
			prep Kit</td>
			<td>Suzhou Youyi Landi Biotechnology Co., Ltd</td>
			<td>UEL-UE-MN-MS-RNA-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>BCA Protein Assay Kit</td>
			<td>Epizyme Biotech</td>
			<td>ZJ101L</td>
			<td></td>
		</tr>
		<tr>
			<td>CCK-8 reagent</td>
			<td>MedChemExpress</td>
			<td>HY-K0301-500T</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>CYAGEN BIOSCIENCES (GUANGZHOU) INC</td>
			<td>FBSSR-01021</td>
			<td></td>
		</tr>
		<tr>
			<td>GAPDH primer</td>
			<td>Sangon Biotech (Shanghai) Co., Ltd.</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): TGACATCAAGAAGGTG 
			GTGAAGCAG; Reverse primer (5&#8217;-3&#8217;): GTGTCGCTGTTGAAG 
			TCAGAGGAG</td>
		</tr>
		<tr>
			<td>HighGene plus Transfection reagent</td>
			<td>ABclonal</td>
			<td>RM09014P</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP-conjugated Affinipure Goat Anti-Mouse lgG (H+L)</td>
			<td>Proteintech Group, Inc</td>
			<td>SA00001-1</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP-conjugated Affinipure Goat Anti-Rabbit lgG (H+L)</td>
			<td>Proteintech Group, Inc</td>
			<td>SA00001-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Human gastric mucosal epithelial GES-1 cells</td>
			<td>Guangzhou Cellcook Biotech Co.,Ltd.</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Human STAD HGC-27 cells</td>
			<td>Procell Life Science&#38;Technology Co.,Ltd</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Human STAD SGC-7901 cells</td>
			<td>Procell Life Science&#38;Technology Co.,Ltd</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MonAmp SYBR Green qPCR Mix (None ROX)</td>
			<td>Mona (Suzhou) Biotechnology Co., Ltd</td>
			<td>MQ10101S</td>
			<td></td>
		</tr>
		<tr>
			<td>MonScript RTIII All-in-One Mix with dsDNase&#160;&#160;</td>
			<td>Mona (Suzhou) Biotechnology Co., Ltd</td>
			<td>MR05101M</td>
			<td></td>
		</tr>
		<tr>
			<td>Omni-ECL Femto Light Chemiluminescence Kit</td>
			<td>Epizyme Biotech</td>
			<td>SQ201</td>
			<td></td>
		</tr>
		<tr>
			<td>PAGE Gel Fast Preparationb Kit&#160;</td>
			<td>Epizyme Biotech</td>
			<td>PG111</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-streptomycin (Pen-Strep)</td>
			<td>Beijing Solarbio Science &#38; Technology Co.,Ltd</td>
			<td>P1400-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyvinylidene difluoride (PVDF) membrane</td>
			<td>Merck KGaA</td>
			<td>IPVH00010-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein Free Rapid Blocking Buffer</td>
			<td>Epizyme Biotech</td>
			<td>PS108P</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis solution</td>
			<td>Beijing Solarbio Science &#38; Technology Co., Ltd</td>
			<td>R0010</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 complete medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>C11875500BT</td>
			<td></td>
		</tr>
		<tr>
			<td>Skimmed milk</td>
			<td>Campina: Elk</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>TBST buffer solution</td>
			<td>Beijing Solarbio Science &#38; Technology Co., Ltd</td>
			<td>T1082</td>
			<td></td>
		</tr>
		<tr>
			<td>The protein loading buffer</td>
			<td>Epizyme Biotech</td>
			<td>LT101S</td>
			<td></td>
		</tr>
		<tr>
			<td>TMEM200A knockdown plasmid</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>TMEM200A primer</td>
			<td>Sangon Biotech (Shanghai) Co., Ltd.</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): AAGGCGGTGTGGTGGTTCG; Reverse primer (5&#8217;-3&#8217;): GATTTTGGTCTCTTTGTCACGGTT</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA1</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): ACAACTGATGATAAGACCAG; Reverse primer (5&#8217;-3&#8217;): TGTTGACTACTATTCTGGTC</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA2</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): CGTGTGAATGTCAATGACTG; Reverse primer (5&#8217;-3&#8217;): GCACACTTACAGTTACTGAC</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA3</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): ACAACCACAACATCTGCCCG; Reverse primer (5&#8217;-3&#8217;): TGTTGGTGTTGTAGACGGGC</td>
		</tr>
		<tr>
			<td>Transmembrane protein 200A Antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>48081-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CO2 cell culture incubator</td>
			<td>Haier Group</td>
			<td>PYXE-80IR</td>
			<td></td>
		</tr>
		<tr>
			<td>Electrophoresis instrument</td>
			<td>Bio-RAD</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence quantitative PCR instrument</td>
			<td>Bio-RAD</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gel Imaging System (Tanon 5200)</td>
			<td>Tanon Science &#38; Technology Co., Ltd</td>
			<td>LAB-0002-0007-SHTN</td>
			<td></td>
		</tr>
		<tr>
			<td>Multifunctional Enzyme Labeler</td>
			<td>Berthold</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

multiomics analysis of tmem200a as a pan-cancer biomarker

TMEM200A ، من المعروف أن البروتين عبر الغشاء مرتبط بالسرطانات البشرية والتسلل المناعي. هنا ، قمنا بتقييم وظيفة TMEM200A في السرطانات الشائعة عن طريق تحليل multiomics واستخدامها في مزارع الخلايا المختبرية لخلايا المعدة للتحقق من النتائج. تم تقييم التعبير عن TMEM200A في العديد من أنواع السرطان البشري باستخدام بيانات RNA-seq من قاعدة بيانات UCSC Xena . كشف تحليل المعلوماتية الحيوية عن دور محتمل ل TMEM200A كعلامة حيوية تشخيصية وتنبؤية.
نمت مزارع خطوط خلايا المعدة والسرطان الطبيعية وتم هدم TMEM200A . تم قياس مستويات التعبير عن TMEM200A باستخدام تفاعل البلمرة المتسلسل الكمي في الوقت الفعلي والنشاف الغربي. ثم تم استخدام دراسات فقدان الوظيفة في المختبر لتحديد أدوار TMEM200A في السلوك الخبيث وتكوين الورم لخلايا سرطان المعدة (GC). تم استخدام البقع الغربية لتقييم تأثير ضربة قاضية على الانتقال الظهاري الوسيطة (EMT) ومسار إشارات PI3K / AKT في GC. أظهر تحليل المعلوماتية الحيوية أنه تم التعبير عن TMEM200A بمستويات عالية في GC. 
تم تثبيط تكاثر خلايا GC عن طريق ضربة قاضية TMEM200A ، والتي قللت أيضا من بروتينات vimentin و N-cadherin و Snai ، وتثبط فسفرة AKT. كما يبدو أن مسار إشارات PI3K / AKT يشارك في التنظيم بوساطة TMEM200A لتطوير GC. تشير النتائج المقدمة هنا إلى أن TMEM200A ينظم البيئة المكروية للورم من خلال التأثير على EMT. قد يؤثر TMEM200A أيضا على EMT من خلال إشارات PI3K / AKT ، وبالتالي التأثير على البيئة المكروية للورم. لذلك ، في السرطانات الشاملة ، وخاصة GC ، قد يكون TMEM200A علامة حيوية محتملة وجين ورمي.

Cancer has emerged as a persistent public health issue endangering human health globally1due to its high morbidity and mortality rates worldwide, posing a heavy financial and medical burden to society2. Significant advancements in cancer therapy have been achieved in recent years thanks to the discovery of cancer markers3, and researchers have developed novel diagnostic methods and new drugs to treat cancer. However, some patients with cancer still have poor prognoses because of factors such as medication resistance, side effects of drugs, and chemical sensitivity4. Therefore, there is an urgent need for identifying new biomarkers for screening and treating early-stage cancers5.
Membrane proteins are proteins that can bind and integrate into cells and organelle membranes6. These can be grouped into three categories depending on the strength of binding to the membrane and their location: lipid-anchored proteins, integral proteins, and peripheral membrane proteins7,8. A transmembrane (TMEM) protein is an integral membrane protein that consists of at least one transmembrane segment9, which passes either completely or partially through the biological membrane. 
Although the mechanisms of action of proteins belonging to the TMEM family are not well understood, these proteins are known to be involved in several types of cancers10. Several TMEM proteins are associated with migratory, proliferative, and invasive phenotypes, and their expression is often associated with a patient's prognosis11. Therefore, TMEM family members have become the target of research. A comprehensive review of existing reports on TMEM revealed that they are mostly associated with inter- and intracellular signaling12, immune-related diseases, and tumorigenesis10. Many TMEMs also possess important physiological functions, for example, ion channels in the plasma membrane, activation of signal transduction pathways, as well as the mediation of cell chemotaxis, adhesion, apoptosis, and autophagy10. Therefore, we hypothesized that TMEM proteins may be important prognostic markers in the detection and treatment of tumors.
TMEM200A expression is significantly elevated in gastric cancer (GC). Higher expression of TMEM200A13, which has eight exons and a full length of 77.536 kb on chromosome 6q23.1, has been linked to a poor prognosis for overall survival (OS) in cases of GC. Yet the changes in its expression have rarely been reported in oncology studies. This article compares and analyzes the usefulness of TMEM200A as a therapeutic target and tumor diagnostic marker in various cancer studies using different publicly available datasets. We assessed the effectiveness of TMEM200A as a pan-cancer diagnostic and prognostic biomarker as well as its expression levels in various human cancer types using RNA-seq data from the UCSC Xena and TCGA databases, as well as by real-time quantitative polymerase chain reaction (qRT-PCR) and western blotting. 
The effect of TMEM200A expression levels on mutation rates, regulatory processes, tumor diagnosis and prognosis, immune infiltration, and immunotherapy was further investigated using a mix of computational tools and dataset websites. CBioPortal and the Catalog of Somatic Mutations in Cancer Cells (COSMIC) databases were used to examine mutations in TMEM200A. Sangerbox and TISIDB websites were utilized to understand how TMEM200A influences immune infiltration. The Tumor Immune Single Cell Center (TISCH) online tool and CancerSEA database were used to investigate the function of TMEM200A. Finally, to assess the impact of TMEM200A on the malignant behavior and tumor development function of GC cells, a loss-of-function experiment was conducted in an in vitro assay. Additionally, western blotting was performed to assess how TMEM200A knockdown affected the PI3K/AKT signaling pathway and the epithelial-mesenchymal transition (EMT) in GC.

Author Spotlight: Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies 

تحليل Multiomics ل TMEM200A كمؤشر حيوي شامل للسرطان

التعبير عن TMEM200A في أنواع مختلفة من السرطان كما هو موضح في الشكل 1 ، قمنا أولا بتحليل مستويات التعبير التفاضلي ل TMEM200A في أنواع مختلفة من السرطان من خلال قواعد بيانات مختلفة. كان التعبير TMEM200A مرتفعا في سرطان القنوات الصفراوية (CHOL) ، وسرطان ال...

Watch this Scientific Journal Video about Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies at JoVE.com

هنا ، يتم تقديم بروتوكول يتم فيه الجمع بين أدوات المعلوماتية الحيوية المتعددة لدراسة الوظائف البيولوجية TMEM200A في السرطان. بالإضافة إلى ذلك ، نقوم أيضا بالتحقق تجريبيا من صحة تنبؤات المعلوماتية الحيوية.

The transmembrane protein, TMEM200A, is known to be associated with human cancers and immune infiltration. Here, we assessed the function of TMEM200A in ...

تم إحراز تقدم كبير في التحقيق في المؤشرات الحيوية للسرطان. ومع ذلك ، فإن وظيفة استخراج المسائل المتعلقة بالورم المرتبطة بعائلة البروتين عبر الغشاء لا تزال غير محددة. نتيجة لذلك ، ولدت أبحاثنا حول TMEM200A في سرطان المعدة اتجاهات بحثية جديدة للخلايا ذات الصلة.في هذه الدراسة ، استخدمنا مزيجا من التنبؤ بقاعدة البيانات عبر الإنترنت والتحقق من صحة التقنية التجريبية ، مما يبسط خطوات البحث وتكلفة الخلايا الجذعية للتجربة في مجال ذي صلة. في المستقبل ، سيركز مختبرنا على استكشاف الآلية المحددة للورم في سرطان المعدة ، والبحث عن العلاقة بين تعديل الغليكوزيل والتسجيل الأيضي ، وتحديد أهداف جديدة لعلاج سرطان المعدة.