Sign In

A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Representative Results
  • Discussion
  • Disclosures
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

Bacteria colonize host tissues that vary in oxygen and iron bioavailability, yet most approaches to studying bacteria use aerated, rich media. This protocol describes culturing the human pathogen Yersinia pseudotuberculosis under varying iron concentrations and oxygen tension, and quantifying activity of the Yersinia type III secretion system, which is an important virulence factor.

Abstract

A key virulence mechanism for many Gram-negative pathogens is the type III secretion system (T3SS), a needle-like appendage that translocates cytotoxic or immunomodulatory effector proteins into host cells. The T3SS is a target for antimicrobial discovery campaigns since it is accessible extracellularly and largely absent from non-pathogenic bacteria. Recent studies demonstrated that the T3SS of Yersinia and Salmonella are regulated by factors responsive to iron and oxygen, which are important niche-specific signals encountered during mammalian infection. Described here is a method for iron starvation of Yersinia pseudotuberculosis, with subsequent optional supplementation of inorganic iron. To assess the impact of oxygen availability, this iron starvation process is demonstrated under both aerobic and anaerobic conditions. Finally, incubating the cultures at the mammalian host temperature of 37 °C induces T3SS expression and allows quantification of Yersinia T3SS activity by visualizing effector proteins released into the supernatant. The steps detailed here offer an advantage over the use of iron chelators in the absence of iron starvation, which is insufficient for inducing robust iron starvation, presumably due to efficient Yersinia iron uptake and scavenging systems. Likewise, acid-washing laboratory glassware is detailed to ensure the removal of residual iron, which is essential for inducing robust iron starvation. Additionally, using a chelating agent is described to remove residual iron from media, and culturing the bacteria for several generations in the absence of iron to deplete bacterial iron stores. By incorporating standard protocols of trichloroacetic acid-induced protein precipitation, SDS-PAGE, and silver staining, this procedure demonstrates accessible ways to measure T3SS activity. While this procedure is optimized for Y. pseudotuberculosis, it offers a framework for studies in pathogens with similar robust iron uptake systems. In the age of antibiotic resistance, these methods can be expanded to assess the efficacy of antimicrobial compounds targeting the T3SS under host-relevant conditions.

Introduction

Many clinically relevant Gram-negative pathogens like Yersinia, Vibrio, Escherichia, Pseudomonas, and Shigella encode the type III secretion system (T3SS) to inject effector proteins into host cells1. In many bacterial species, the T3SS is under strict regulatory control2. For example, translocation of Yersinia T3SS effector proteins into target host cells is critical to subvert host defense mechanisms and enable bacterial colonization of host tissues. However, Yersinia T3SS activity is metabolically burdensome and can trigger recognition by host immune receptors....

Protocol

The details of the reagents, media composition, primer sequences, and equipment are listed in the Table of Materials. Figure 1 illustrates the overall experimental workflow.

1. Preparation of acid washed glassware and chelated M9 media

NOTE: Before starting, refer to the material section for the exact reagents and recipes that will be used. M9 media was first used for Yersinia T3SS assays in Cheng et al.11.

  1. Pour 100 mL of 6 N HCl into a 250 mL glass flask.
    CAUTION: HCl is extremely hazardous; ensure....

Representative Results

This method allows for the relative comparison of secreted Yops across various conditions relative to a reference condition of interest. The overall experimental workflow is depicted in Figure 1. Table 1 depicts a representation of how cell culture normalization would typically occur in the instance of each culture condition and the volume of TCA that would be added to each supernatant. Here, representative results are shown using wildtype (WT) Y. pseudotuberculosis.......

Discussion

The T3SS is an important virulence factor in many pathogenic bacteria; therefore, developing laboratory techniques to study its regulation is important for understanding pathogenesis and developing potential therapeutics1. Iron and oxygen are known to be important host cues sensed by bacterial pathogens to regulate T3SS expression5; therefore, this method presents a strategy for culturing Y. pseudotuberculosis under either anaerobic or aerobic conditions, with iron.......

Disclosures

The authors declare no competing financial interests.

Acknowledgements

Graphical Images created using BioRender.com. This study was supported by the National Institutes of Health (www.NIH.gov) grant R01AI119082.

....

Materials

NameCompanyCatalog NumberComments
10 mL Luer-Lok Tip syringeBD301029
10x SDS Running Buffer Home made0.25 M Tris base, 1.92 M Glycine, 1% SDS in 1 L volume
12.5% SDS-Page GelHome made
15 mL culture tubesFalcon352059For initial overnight 
15 mL Falcon tubesFalcom352196For supernatant collection
250 mL culture flaskBelco251000250
500 mL Filter SystemCorning431097
6 N Hydrochloric acid solutionFisher Scientific7732185
AcetoneFisher ChemicalA949-44 L
Bio Rad ChemiDoc MP Imaging SystemBio RadModel Number: Universal Hood III
Borosilicate glass culture tubesFisherbrand14-961-34For anaerobic culturing
Chelex 100 ResinBio Rad142-1253
Chelex M9 +0.9% Glucose mediaHome made6 g/L Na2HPO4, 3 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl, 1% casamino acids, 0.9% dextrose, 0.0005% thiamine, 5 g/L Chelex 100 Resin. Stir media for 18 h at room temp, filter using 500 mL Corning filtration unit, then add MgSO4 for 1 mM MgSO4 final solution
Final Sample Buffer (FSB)Home made0.1 M Tris-HCl, 4% SDS, 20% glycerol, 0.2% of Bromophenol Blue
FSB:DTT solutionHome madeFSB+0.2M DTT
Image Lab SoftwareBio Radhttps://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8ZSoftware
Isotemp Heat BlockFisher Scientific88860021
LB Agar PlatesHome made10 g Tryptone, 5 g Yeast extract, 10 g NaCl, 15 g Agar in 1 L total volume. Autoclaved
M9+0.2% Glucose MediaHome made6 g/L Na2HPO4, 3 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl, 1 mM MgSO4, 1 mg/L FeSO47H2O, 1% casamino acids, 0.2% dextrose, 0.0005% thiamine 
Millex-GP PES 0.22um filter attachment for syringeMilliporeSLGPR33RSFor FeSO47H2O filtration
Millex-GV PVDF 0.22um filter attachment for syringeMilliporeSLGVR33RSFor supernatant filtration
Precision Plus Protein Unstained StandardBio Rad1610363
SDS-PAGE Gel ApparatusBio RadModel Number: Mini PROTEAN Tetra Cell
SilverXpress Silver Staining Kit InvitrogenLC6100
The BellyDancer ShakerIBI ScientificBDRAA1155
Trichloroacetic acid solution 6.1NSigma AldrichT0699
Vinyl Anaerobic ChamberCoy Lab Productshttps://coylab.com/products/anaerobic-chambers/vinyl-anaerobic-chambers/#details
qPCR Primer sequences 
yfeA forward - CAC AGT CAG CAG ACC TTA TCT T
yfeA reverse - GGC AGA CGG GAC ATC TTT AAT A
bfd forward - ccagcatcagccccatacag
bfd reverse - tggcttgtcggatgcacttc
yopE forward - CCATAAACCGGTGGTGAC
yopE reverse - CTTGGCATTGAGTGATACTG

References

  1. Deng, W., et al. Assembly, structure, function regulation of type III secretion systems. Nat Rev Microbiol. 15 (6), 323-337 (2017).
  2. Springer International Publishing. . Bacterial Type III Protein Secretion Systems. 427, (2020).

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Explore More Articles

Yersinia PseudotuberculosisType III Secretion SystemT3SSIron StarvationAnaerobic GrowthEffector ProteinsProtein QuantificationSDS PAGESilver StainingAntimicrobial DiscoveryVirulence Factors

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved