Name: engineering and evolution of synthetic adeno-associated virus (aav) gene therapy vectors via dna family shuffling
Uploaded: 2012-04-02T12:00:00
Description: Watch this Scientific Journal Video about Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling at JoVE.com

The authors gratefully acknowledge outstanding support of their lab, team members and work by the Cluster of Excellence CellNetworks at Heidelberg University as well as by the Chica and Heinz Schaller (CHS) foundation. We appreciate that molecular AAV evolution via DNA family shuffling has become a very active field since our initial publication three years ago and therefore apologize to all authors of relevant publications whose work could not be quoted here due to space constraints.

1. Preparation of Plasmid Sets Encoding AAV Capsid Genes
<ol>
 <li>To facilitate routine preparation of sufficient amounts of the various AAV capsid (cap) genes for subsequent DNA shuffling, initially subclone these genes into a common plasmid backbone. It is important to include identical flanking sequences of &gt;20 nucleotides for later use as primer binding sites for nested PCR and for cloning (Fig. 2).</li>
 <li>Using appropriate primers (see Table for exemplary primers for AAV5), PCR amp...

<ol>
	<li>Grimm, D., Kay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+virus+evolution+to+vector+revolution:+use+of+naturally+occurring+serotypes+of+adeno-associated+virus+(AAV)+as+novel+vectors+for+human+gene+therapy.">From virus evolution to vector revolution: use of naturally occurring serotypes of adeno-associated virus (AAV) as novel vectors for human gene therapy.</a> Curr. Gene Ther. 3, 281-304 (2003).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+methods+for+gene+transfer+vectors+based+on+adeno-associated+virus+serotypes.">Production methods for gene transfer vectors based on adeno-associated virus serotypes.</a> Methods. 28, 146-157 (2002).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+gene+therapy+vector+evolution+via+multispecies+interbreeding+and+retargeting+of+adeno-associated+viruses.">In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses.</a> J. Virol. 82, 5887-5911 (2008).</li><li>Muller, O. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+peptide+libraries+displayed+on+adeno-associated+virus+to+select+for+targeted+gene+therapy+vectors.">Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors.</a> Nat. Biotechnol. 21, 1040-1046 (2003).</li><li>Perabo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+viral+vectors+with+modified+tropism:+the+adeno-associated+virus+display.">In vitro selection of viral vectors with modified tropism: the adeno-associated virus display.</a> Mol. Ther. 8, 151-157 (2003).</li><li>Zolotukhin, S., Potter, M., Hauswirth, W. W., Guy, J., Muzyczka, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+"humanized"+green+fluorescent+protein+cDNA+adapted+for+high-level+expression+in+mammalian+cells.">A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells.</a> J. Virol. 70, 4646-4654 (1996).</li><li>Wobus, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+against+the+adeno-associated+virus+type+2+(AAV-2)+capsid:+epitope+mapping+and+identification+of+capsid+domains+involved+in+AAV-2-cell+interaction+and+neutralization+of+AAV-2+infection.">Monoclonal antibodies against the adeno-associated virus type 2 (AAV-2) capsid: epitope mapping and identification of capsid domains involved in AAV-2-cell interaction and neutralization of AAV-2 infection.</a> J. Virol. 74, 9281-9293 (2000).</li><li>Grimm, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fatality+in+mice+due+to+oversaturation+of+cellular+microRNA/short+hairpin+RNA+pathways.">Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways.</a> Nature. 441, 537-541 (2006).</li><li>Nakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unrestricted+hepatocyte+transduction+with+adeno-associated+virus+serotype+8+vectors+in+mice.">Unrestricted hepatocyte transduction with adeno-associated virus serotype 8 vectors in mice.</a> J. Virol. 79, 214-224 (2005).</li><li>Koerber, J. T., Jang, J. H., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+shuffling+of+adeno-associated+virus+yields+functionally+diverse+viral+progeny.">DNA shuffling of adeno-associated virus yields functionally diverse viral progeny.</a> Mol. Ther. 16, 1703-1709 (2008).</li><li>Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+and+selection+of+shuffled+AAV+genomes:+a+new+strategy+for+producing+targeted+biological+nanoparticles.">Engineering and selection of shuffled AAV genomes: a new strategy for producing targeted biological nanoparticles.</a> Mol. Ther. 16, 1252-1260 (2008).</li><li>Ward, P., Walsh, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+AAV+Cap+sequences+alter+gene+transduction.">Chimeric AAV Cap sequences alter gene transduction.</a> Virology. 386, 237-248 (2009).</li><li>Yang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+myocardium+tropic+adeno-associated+virus+(AAV)+evolved+by+DNA+shuffling+and+in+vivo+selection.">A myocardium tropic adeno-associated virus (AAV) evolved by DNA shuffling and in vivo selection.</a> Proc. Natl. Acad. Sci. U.S.A. 106, 3946-3951 (2009).</li><li>Perabo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+engineering+of+a+gene+therapy+vector:+directed+evolution+of+adeno-associated+virus.">Combinatorial engineering of a gene therapy vector: directed evolution of adeno-associated virus.</a> J. Gene. Med. 8, 155-162 (2006).</li><li>Maheshri, N., Koerber, J. T., Kaspar, B. K., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+adeno-associated+virus+yields+enhanced+gene+delivery+vectors.">Directed evolution of adeno-associated virus yields enhanced gene delivery vectors.</a> Nat. Biotechnol. 24, 198-204 (2006).</li><li>Wu, Z., Asokan, A., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus+serotypes:+vector+toolkit+for+human+gene+therapy.">Adeno-associated virus serotypes: vector toolkit for human gene therapy.</a> Mol. Ther. 14, 316-327 (2006).</li><li>Kwon, I., Schaffer, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+gene+delivery+vectors:+molecular+engineering+and+evolution+of+adeno-associated+viral+vectors+for+enhanced+gene+transfer.">Designer gene delivery vectors: molecular engineering and evolution of adeno-associated viral vectors for enhanced gene transfer.</a> Pharm. Res. 25, 489-499 (2008).</li><li>Perabo, L., Huber, A., Marsch, S., Hallek, M., Buning, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Artificial+evolution+with+adeno-associated+viral+libraries.">Artificial evolution with adeno-associated viral libraries.</a> Comb. Chem. High. Throughput. Screen. 11, 118-126 (2008).</li><li>McCarty, D. M., Monahan, P. E., Samulski, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-complementary+recombinant+adeno-associated+virus+(scAAV)+vectors+promote+efficient+transduction+independently+of+DNA+synthesis.">Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis.</a> Gene Ther. 8, 1248-1254 (2001).</li></ol>

Here, we have outlined essential experimental steps and guidelines for AAV capsid engineering via DNA family shuffling and for evolution in cells or in animals. In essence, these protocols are standardized versions of the procedures we first reported within the AAV field in 20083. While a flurry of follow-up studies by others have reported numerous modifications e.g.,10-13, our present versions represent basic strategies yielding reproducible results while being amenable to up-scaling and a...

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent</td>
 <td>Company</td>
 <td>Catalogue number</td>
 </tr>
 <tr>
 <td>DNase I</td>
 <td>Invitrogen</td>
 <td>18068-015</td>
 </tr>
 <tr>
 <td>Polyethylenimine (PEI)</td>
 <td>Sigma-Aldrich</td>
 <td>408727</td>
 </tr>
 <tr>
 <td>Restriction enzymes</td>
 <td>NEB</td>
 <td>Various</td>
 </tr>
 <tr>
 <td>T4 DNA Ligase</td>
 <td>NEB</td>
 <td>M0202T</td>
 </tr>
 <tr>
 <td>Gel extraction kit</td>
 <td>Qiagen</td>
 <td>28704</td>
 </tr>
 <tr>
 <td>Phusion II polymerase Kit</td>
 <td>Finnzymes (NEB)</td>
 <td>F-540S</td>
 </tr>
 <tr>
 <td>HotStar Hifi polymerase Kit</td>
 <td>Qiagen</td>
 <td>202602</td>
 </tr>
 <tr>
 <td>DMSO</td>
 <td>Finnzymes (NEB)</td>
 <td>F-540S (part of kit)</td>
 </tr>
 <tr>
 <td>EDTA (25 mM)</td>
 <td>Invitrogen</td>
 <td>18068-015 (part of kit)</td>
 </tr>
 <tr>
 <td>Tris</td>
 <td>Roth</td>
 <td>4855.2</td>
 </tr>
 <tr>
 <td>Ampicilin sodium salt</td>
 <td>Roth</td>
 <td>K029.2</td>
 </tr>
 <tr>
 <td>dNTPs (10 mM, 100 &mu;l)</td>
 <td>Invitrogen</td>
 <td>18427013</td>
 </tr>
 <tr>
 <td>Iodixanol (OptiPrep)</td>
 <td>Axis-shield</td>
 <td>1114739</td>
 </tr>
 <tr>
 <td>Phenolred</td>
 <td>Merck</td>
 <td>107241</td>
 </tr>
 <tr>
 <td>Plasmid mega prep kit</td>
 <td>Qiagen</td>
 <td>12181</td>
 </tr>
 <tr>
 <td>Ultracentrifuge</td>
 <td>Beckman-Coulter</td>
 <td>Optima L90K</td>
 </tr>
 <tr>
 <td>Quick-Seal centrifuge tubes</td>
 <td>Beckman-Coulter</td>
 <td>342414</td>
 </tr>
 <tr>
 <td>Electroporation unit</td>
 <td>Bio-Rad</td>
 <td>GenePulserXcell</td>
 </tr>
 <tr>
 <td>Thermal cycler</td>
 <td>Eppendorf</td>
 <td>Vapo Protect</td>
 </tr>
 <tr>
 <td>Heating block</td>
 <td>BIOER</td>
 <td>MB-102</td>
 </tr>
 <tr>
 <td>Fluorescence microscope</td>
 <td>Olympus</td>
 <td>IX81</td>
 </tr>
 <tr>
 <td>FACS analyser</td>
 <td>Beckman-Coulter</td>
 <td>Cytomics FC500 MLP</td>
 </tr>
 <tr>
 <td>MegaX DH10B T1R cells</td>
 <td>Invitrogen</td>
 <td>C640003</td>
 </tr>
 <tr>
 <td>Benzonase</td>
 <td>Merck</td>
 <td>101695</td>
 </tr>
 <tr>
 <td>Adenovirus-5</td>
 <td>ATCC</td>
 <td>VR-5</td>
 </tr>
 <tr>
 <td>pBlueScript II KS(+) plasmid</td>
 <td>Stratagene</td>
 <td>212207</td>
 </tr>
 <tr>
 <td>cap5F (Pac I site in yellow, cap5-specific sequences in bold): 
 GACTCTTAATTAACAGGTATGTCTTTTGTTGATCACCCTCC</td>
 <td>IDTDNA</td>
 <td>Custom primer</td>
 </tr>
 <tr>
 <td>cap5R (Asc I site in green, cap5-specific sequences in bold): 
 GTGAGGGCGCGCCTTAAAGGGGTCGGGTAAGGTATC</td>
 <td>IDTDNA</td>
 <td>Custom primer</td>
 </tr>
 </tbody>
</table>

engineering and evolution of synthetic adeno-associated virus (aav) gene therapy vectors via dna family shuffling

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique combination of beneficial properties1. These include the apathogenicity of the underlying wildtype viruses and the highly advanced methodologies for production of high-titer, high-purity and clinical-grade recombinant vectors2. A further particular advantage of the AAV system over other viruses is the availability of a wealth of naturally occurring serotypes which differ in essential properties yet can all be easily engineered as vectors using a common protocol1,2. Moreover, a number of groups including our own have recently devised strategies to use these natural viruses as templates for the creation of synthetic vectors which either combine the assets of multiple input serotypes, or which enhance the properties of a single isolate. The respective technologies to achieve these goals are either DNA family shuffling3, i.e. fragmentation of various AAV capsid genes followed by their re-assembly based on partial homologies (typically &gt;80% for most AAV serotypes), or peptide display4,5, i.e. insertion of usually seven amino acids into an exposed loop of the viral capsid where the peptide ideally mediates re-targeting to a desired cell type. For maximum success, both methods are applied in a high-throughput fashion whereby the protocols are up-scaled to yield libraries of around one million distinct capsid variants. Each clone is then comprised of a unique combination of numerous parental viruses (DNA shuffling approach) or contains a distinctive peptide within the same viral backbone (peptide display approach). The subsequent final step is iterative selection of such a library on target cells in order to enrich for individual capsids fulfilling most or ideally all requirements of the selection process. The latter preferably combines positive pressure, such as growth on a certain cell type of interest, with negative selection, for instance elimination of all capsids reacting with anti-AAV antibodies. This combination increases chances that synthetic capsids surviving the selection match the needs of the given application in a manner that would probably not have been found in any naturally occurring AAV isolate. Here, we focus on the DNA family shuffling method as the theoretically and experimentally more challenging of the two technologies. We describe and demonstrate all essential steps for the generation and selection of shuffled AAV libraries (Fig. 1), and then discuss the pitfalls and critical aspects of the protocols that one needs to be aware of in order to succeed with molecular AAV evolution.

Watch this Scientific Journal Video about Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling at JoVE.com

Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling (Video) | JoVE

We demonstrate the basic technique to molecularly engineer and evolve synthetic Adeno-associated viral (AAV) gene therapy vectors via DNA family shuffling. Moreover, we provide general guidelines and representative examples for selection and analysis of individual chimeric capsids with enhanced properties on target cells in culture or in mice.

Engineering and Evolution of Synthetic Adeno-Associated Virus (AAV) Gene Therapy Vectors via DNA Family Shuffling

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique ...

Research

JoVE Journal

Immunology and Infection

Generation of Recombinant Influenza Virus from Plasmid DNA

Generation of Recombinant Influenza Virus from Plasmid DNA (Video) | JoVE

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant (Video) | JoVE

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography (Video) | JoVE

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Production and Titering of Recombinant Adeno-associated Viral Vectors

Production and Titering of Recombinant Adeno-associated Viral Vectors (Video) | JoVE

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Expanding Cytotoxic T Lymphocytes from Umbilical Cord Blood that Target Cytomegalovirus, Epstein-Barr Virus, and Adenovirus

Expanding Cytotoxic T Lymphocytes from Umbilical Cord Blood that Target Cytomegalovirus, Epstein-Barr Virus, and Adenovirus (Video) | JoVE

Virus infections after stem cell transplantation are among the most common causes of death, especially after cord blood (CB) transplantation (CBT) where ...

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells (Video) | JoVE

Lentiviral  vectors (LVs) are a powerful means of delivering genetic material to many types  of cells. Because of safety concerns associated with these ...

Cell-based Flow Cytometry Assay to Measure Cytotoxic Activity

Cell-based Flow Cytometry Assay to Measure Cytotoxic Activity (Video) | JoVE

Cytolytic activity of CD8+ T cells is rarely evaluated. We describe here a new cell-based assay to measure the capacity of antigen-specific CD8+ T cells ...

Propagation of Homalodisca coagulata virus-01 via Homalodisca vitripennis Cell Culture

Propagation of Homalodisca coagulata virus-01 via Homalodisca vitripennis Cell Culture (Video) | JoVE

The glassy-winged sharpshooter (Homalodisca vitripennis) is a highly vagile and polyphagous insect found throughout the southwestern United States. These ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors (Video) | JoVE

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy (Video) | JoVE

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...