وقد تم تمويل هذا العمل من قبل جمعية ماكس بلانك.

1. إعداد Matrigel المغلفة لوحات وسائل الإعلام <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> وقد وجد إعداد لوحات Matrigel Matrigel المغلفة لتكون ركيزة المفضل لمرفق التفرقة EBS وتعزز أيضا ثمرة كفاءة الخلايا العصبية من هذه 10. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تحسن 10 مل من Matrigel بين عشية وضحاها على الجليد. </li><li style=";text-align:right;direction:rtl"> اليوم التالي، تمييع الهلام مثل Matrigel مع مجلدين من الجليد الباردة DMEM/F-12 وإعداد مأخوذة من 1 مل مل في أنابيب prechilled المخروطية ال 15 التي يمكن تخزينها في -20 درجة تجمد C. </li><li style=";text-align:right;direction:rtl"> البت شكل لوحة للتمايز الخلايا العصبية. على سبيل المثال، كنقطة انطلاق، نوصي لإجراء الجولة الأولى من تمايز في شكل 12-أيضا. قبل باردة 4 12-وحات جيدة في C. ° 4 حل 1 قسامة من Matrigel المجمدة عن طريق إضافة 9 مل من قبل المبردة DMEM/F-12 تليها pipetting صعودا وهبوطا حتى كل Matrigel prediluted وإذابة والمنحل. </li><li style=";text-align:right;direction:rtl"> ثمونقل المحتويات إلى أنبوب جديد 50 مل تحتوي على 15 مل من DMEM/F-12 على الجليد (النهائي Matrigel التخفيف: 1:75). ثم، إضافة 0.5 مل من المخفف Matrigel إلى كل بئر من لوحات 12-جيدا قبل المبردة. لوحات التفاف مع Parafilm واسمحوا الوقوف بين عشية وضحاها في RT. </li><li style=";text-align:right;direction:rtl"> اليوم التالي، نقل إلى لوحات C. ° 4 ويمكن تخزين لوحات مغلفة لعدة أسابيع قبل الاستخدام. </li></ol></li><li style=";text-align:right;direction:rtl"> وسائل الإعلام </li></ol> EB المتوسطة تشكيل (~ 15 مل اللازمة لأداء التمايز في لوحة واحدة 96-جيدا - انظر الجدول (1) ومخطط في الشكل 2): DMEM/F-12 مع 0.4٪ (PVA) 1X N2 1X B27 0.05٪ BSA 20 نانوغرام / مل FGF2 10 ميكرومتر Y-27632 1X PenStrepGln متوسطة التمايز (~ 30 مل اللازمة لأداء التمايز في لوحة واحدة 96-حسنا، تليها تشكيل الخلايا العصبية في لوحة واحدة 12-Matrigel المغلفة جيدا، انظر الجدول 1): DMEM/F-12 1X N2 <br/&gt; 1X B27 0.05٪ BSA 0.5 ميكرومتر PD0325901 SB431542 ميكرومتر 15 0.5 ميكرومتر Dorsomorphin 1X PenStrepGln 2. اضطر EB تشكيل <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تنمو في ظل ظروف hPSCs الخاص المغذية خالية المفضل. نستخدم MEF مكيفة المتوسطة على لوحات 6 Matrigel المغلفة جيدا 15. ومع ذلك، ينبغي لنظم أخرى مثل الثقافة أو تجارية محلية الصنع وسائل الإعلام تعريف العمل أيضا. في وقت بدء تجربة التمايز، يجب أن يكون hPSCs شبه متموجة وبنشاط متزايد. </li><li style=";text-align:right;direction:rtl"> إزالة المستعمرات ميكانيكيا بشكل عفوي متباينة باستخدام ماصة معقمة تلميح البلاستيك تحت المجهر ستيريو. </li><li style=";text-align:right;direction:rtl"> غسل المستعمرات غير متمايزة المتبقية باستخدام PBS، وهضم للخلايا التي تحتوي على واحد باستخدام Accutase 1X Y-27632. بيليه الخلايا بواسطة الطرد المركزي واحد في 200 x ج لمدة 2 دقيقة، resuspend في وحدة تخزين صغيرة من تشكيل EB المتوسطة وتحديد عيار الخلايا باستخدام عدادة الكريات. </li><li style=";text-align:right;direction:rtl"> إضافة إلى قسامة من الخلاياتشكيل EB المتبقية المتوسطة أن يؤدي إلى ما بين 40،000 عيار و 80،000 خلية لكل مل. </li><li style=";text-align:right;direction:rtl"> باستخدام ماصة الأقنية، نقل 100 ميكرولتر لكل بئر لوحة 96V القاع، مما أدى إلى 8،000 في 4،000 خلايا لكل بئر. تدور بشكل جيد 96-وحة لوحة أجهزة الطرد المركزي في أرجوحة المغادرة في 400 x ج لمدة 1 دقيقة لجمع الخلايا في أسفل الآبار، ونقل إلى الخلية الحاضنة الثقافة. سوف تشكل EBS بين عشية وضحاها، كما هو مبين في الشكل 1. </li></ol> 3. الأديم الظاهر العصبي الحث <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> اليوم التالي (يوم 0)، وجمع من EBS وحة 96V تحت المجهر ستيريو، ونقل في وحدة تخزين صغيرة في طبق البكتيرية التي تحتوي على 3.5 سم 2 مل من المتوسط ​​التمايز. تستنهض الهمم بلطف طبق لعدة ثوان لغسل EBS. </li><li style=";text-align:right;direction:rtl"> إضافة 100 ميكرولتر من تمايز المتوسطة لكل بئر من أسفل-U-البالغة الانخفاض المرفقات 96-وحة جيدا. تحت stereomicroscope، EBS نقل كميات صغيرة في طبق الغسيل من 96U في الآبار (واحد لكل EB نحنليرة لبنانية). لوحة 96U مكان في الخلية الحاضنة الثقافة لمدة 4 أيام للسماح بتشكيل الأديم الظاهر العصبي. </li></ol> 4. الخلايا العصبية تشكيل <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> في يوم 4، إعداد طبق الغسيل كما في الخطوة 3.1 و استبدال بالإضافة إلى ذلك DMEM/F-12 في لوحة قبل تحسنت 12-Matrigel المغلفة جيدا بواسطة متوسطة التمايز (1 مل لكل بئر). </li><li style=";text-align:right;direction:rtl"> الطلاء من EBS <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> جمع EBS من لوحة 96U، وغسل هذه البذور على النحو الوارد أعلاه، وبعناية واحدا تلو الآخر في بئر من لوحة 12-Matrigel المغلفة جيدا (حوالي 8 EBS لكل بئر): يجب EBS موزعة بالتساوي داخل الآبار للسماح ثمرة من دون عائق الخلايا العصبية خلال الأيام القليلة المقبلة (انظر &quot;اليوم 5&quot; الصورة في الشكل 2). </li><li style=";text-align:right;direction:rtl"> قبل نقل الجزء الخلفي لوحة 12-جيدا في الحاضنة، والسماح لEBS إرفاق فضفاضة لحوالي 10 دقيقة في RT. ثم، بعناية نقل 12-وحة جيدا إلى الخلية الحاضنة الثقافة. سوف تنمو الخلايا العصبية الخروج من EBS مطلي بطريقة شعاعي داخل 4 أيام القادمة، كما SHOWN في الشكل 2 (&quot;يوم 8&quot; الصورة على اليمين). </li></ol></li></ol> 5. الخلايا العصبية وتشكيل Monolayers <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> كبديل للخطوات النقطة 4)، في يوم 4 من هذا الإجراء، جمع EBS في طبق البكتيرية التي تحتوي على 3.5 سم 2 مل من المتوسط ​​التمايز، ثم نقل EBS في حجم صغير لطبق PBS المحتوية على، ومن ثم إلى طبق آخر يحتوي على Accutase. </li><li style=";text-align:right;direction:rtl"> السماح لخلايا الهضم واحدة، الطرد المركزي في 200 x ج لمدة 2 دقيقة، resuspend في وحدة تخزين صغيرة من متوسطة التمايز وتحديد عيار الخلايا باستخدام عدادة الكريات. ضبط عيار إلى الخلايا 6 1-2X10 لكل مل باستخدام المتوسطة التمايز (بدون Y-27632). </li><li style=";text-align:right;direction:rtl"> لوحة الخلايا في مرحلة ما قبل حرارة 12-وحة Matrigel المغلفة جيدا (1 مل لكل بئر)، ونقل إلى الخلية الحاضنة الثقافة. ولوحظ تشكيل الخلايا العصبية كما monolayers بين 7 أيام إلى 8 (الشكل 3C). وتجدر الإشارة، مع ذلك، أن هذا البديل أحادي الطبقة منلم يتم إجراء الأمثل تماما فيما يتعلق بقاء الخلية والركيزة أكثر ملائمة. </li></ol>

<ol>
	<li>Thomson, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell+lines+derived+from+human+blastocysts.">Embryonic stem cell lines derived from human blastocysts.</a> Science. 282, 1145-1147 (1998).</li><li>Takahashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+adult+human+fibroblasts+by+defined+factors.">Induction of pluripotent stem cells from adult human fibroblasts by defined factors.</a> Cell. 131, 861-872 (2007).</li><li>Koch, P., Opitz, T., Steinbeck, J. A., Ladewig, J., Brustle, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rosette-type,+self-renewing+human+ES+cell-derived+neural+stem+cell+with+potential+for+in+vitro+instruction+and+synaptic+integration.">A rosette-type, self-renewing human ES cell-derived neural stem cell with potential for in vitro instruction and synaptic integration.</a> Proc. Natl. Acad. Sci. U.S.A. 106, 3225-3230 (2009).</li><li>Chambers, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+neural+conversion+of+human+ES+and+iPS+cells+by+dual+inhibition+of+SMAD+signaling.">Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling.</a> Nat. Biotechnol. 27, 275-280 (2009).</li><li>Lee, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+directed+differentiation+of+neural+crest+stem+cells+derived+from+human+embryonic+stem+cells.">Isolation and directed differentiation of neural crest stem cells derived from human embryonic stem cells.</a> Nat. Biotechnol. 25, 1468-1475 (2007).</li><li>Li, X. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specification+of+motoneurons+from+human+embryonic+stem+cells.">Specification of motoneurons from human embryonic stem cells.</a> Nat. Biotechnol. 23, 215-221 (2005).</li><li>Pera, M. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+human+embryonic+stem+cell+differentiation+by+BMP-2+and+its+antagonist+noggin.">Regulation of human embryonic stem cell differentiation by BMP-2 and its antagonist noggin.</a> J. Cell Sci. 117, 1269-1280 (2004).</li><li>Smith, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Activin/Nodal+signaling+promotes+specification+of+human+embryonic+stem+cells+into+neuroectoderm.">Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm.</a> Dev. Biol. 313, 107-117 (2008).</li><li>Greber, B., Lehrach, H., Adjaye, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+early+fate+decisions+in+human+ES+cells+by+distinct+states+of+TGFbeta+pathway+activity.">Control of early fate decisions in human ES cells by distinct states of TGFbeta pathway activity.</a> Stem Cells Dev. 17, 1065-1077 (2008).</li><li>Greber, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FGF+signalling+inhibits+neural+induction+in+human+embryonic+stem+cells.">FGF signalling inhibits neural induction in human embryonic stem cells.</a> EMBO J. 30, 4874-4884 (2011).</li><li>Anderson, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Familial+dysautonomia+is+caused+by+mutations+of+the+IKAP+gene.">Familial dysautonomia is caused by mutations of the IKAP gene.</a> Am. J. Hum. Genet. 68, 753-758 (2001).</li><li>Lee, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+pathogenesis+and+treatment+of+familial+dysautonomia+using+patient-specific+iPSCs.">Modelling pathogenesis and treatment of familial dysautonomia using patient-specific iPSCs.</a> Nature. 461, 402-406 (2009).</li><li>Burridge, P. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+human+embryonic+stem+cell+embryoid+body+homogeneity+and+cardiomyocyte+differentiation+from+a+novel+V-96+plate+aggregation+system+highlights+interline+variability.">Improved human embryonic stem cell embryoid body homogeneity and cardiomyocyte differentiation from a novel V-96 plate aggregation system highlights interline variability.</a> Stem Cells. 25, 929-938 (2007).</li><li>Watanabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ROCK+inhibitor+permits+survival+of+dissociated+human+embryonic+stem+cells.">A ROCK inhibitor permits survival of dissociated human embryonic stem cells.</a> Nat. Biotechnol. 25, 681-686 (2007).</li><li>Xu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Feeder-free+growth+of+undifferentiated+human+embryonic+stem+cells.">Feeder-free growth of undifferentiated human embryonic stem cells.</a> Nat. Biotechnol. 19, 971-974 (2001).</li><li>Burridge, P. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+universal+system+for+highly+efficient+cardiac+differentiation+of+human+induced+pluripotent+stem+cells+that+eliminates+interline+variability.">A universal system for highly efficient cardiac differentiation of human induced pluripotent stem cells that eliminates interline variability.</a> PLoS One. 6, e18293 (2011).</li></ol>

الإعلان عن أي تضارب في المصالح.

وتستند معظم البروتوكولات التي تنطوي على تمييز تشكيل EB من hPSCs، بما في ذلك إجراء نشرت سابقا لدينا 10، على الخط أو بمساعدة إنزيم حصاد hESCs والمجاميع، الأمر الذي يؤدي حتما إلى عدم التجانس في أحجام EB. هذه الحقيقة يؤدي إلى التباين في كفاءة تمايز مع بعض خطوط الخلايا، مما يجعل من الصعب تحليل منهجي، لا سيما على نطاق والإنتاجية المتوسطة. وعلاوة على ذلك، الدليل هو تشريح كثيفة العمالة والتي في حد ذاته يضر تطويره. في المقابل، تقوم الطريقة الموضحة هنا على تكوين الخلايا واحدة من EB، مما يسهل التعامل مع الخلايا ويقلل من التباين بين العينات. الأهم من ذلك، علينا أن نظهر أن القدرة الإجمالية التمايز إلى خلايا عصبية لا يبدو أن تتأثر الشروع في بروتوكول مع EBS زيادة ونقصان. وعلاوة على ذلك، والحفاظ على EBS الفردية فصلها عن بعضها البعض عن طريق استخدام لوحات التعليق 96-T يمنع جيداتنحنح من تجميع مع بعضها البعض في نظام التعليق - الذي يعرض آخر العيب من الإجراء التقليدية 10. ونتيجة لذلك، فإن كمية المدخلات hPSCs اللازمة لبدء تجربة معينة منخفضة في آن واحد تقريبا جيدا 6 جيدا مع لوحة المستعمرات hPSC subconfluent وعادة ما يكفي للبدء في المفاضلة لوحات 96-جيدا اثنين. وأخيرا، فإن تقنية EB تدور تمكن رقابة مشددة على أحجام EB. وفقا لملاحظاتنا، ومستويات التعبير عن علامات العصبية تميل إلى زيادة إلى حد ما مع أحجام متزايدة من EBS مطلي (الشكل 3A). من ناحية أخرى، EBS كبيرة جدا تميل إلى عرض مراكز نخرية بعد الطلاء. وبالتالي، كحل وسط، وجدنا EBS من 4،000 إلى 8،000 الخلايا لتكون مجموعة مناسبة. نظرا لكفاءتها العالية، بساطة، السرعة، والفعالية من حيث التكلفة، فإننا نتوقع الطريقة الموضحة لتكون منبرا مفيدا للدراسات الفنية، التي تتطلب النمذجة للأمراض البشرية لياليensory الخلايا العصبية، أو متوسطة الإنتاجية المستندة إلى الخلايا المقايسات الدوائية تتطلب الخلايا العصبية من أي نوع. فيما يتعلق بتطبيق هذه الأخيرة، فإن التوافق مع التحليل الآلي مثل عالية المحتوى التصوير يكون من المرغوب فيه. هذا، ومع ذلك، قد يكون خطر بسبب حقيقة أنه يمكن تحليل الخلايا العصبية فقط تعدى في محيط EBS مطلي. للتحايل على هذه العقبة، ونحن أيضا حاول أن تولد monolayers الخلايا العصبية بسبب الانفصال EBS في يوم 4 من البروتوكول والطلاء خارج الخلايا واحدة. والواقع أن البيانات في الشكل 3C تشير إلى أن الخلايا العصبية في تشكيل كفاءة معقولة من حوالي 60٪. ومع ذلك، لاحظنا انخفاضا في بقاء الخلية في ظل هذه الظروف، مما يوحي بأن هذا الاختلاف قد يكون من البروتوكول مواصلة استكشاف والأمثل، على سبيل المثال باستخدام الركيزة المرفقات مختلفة. (لم إضافة Y-27632 على الطلاء على خلايا-4 اليوم في الخطوة 5.2 تعزيز بقاء الخلية بعد الطلاء ولكن يبدو أيضا أن يتدخل ثولذلك ينبغي التفريق إيث العصبية اللاحقة ويمكن حذفها.) وعلاوة على ذلك، سيكون من المثير للاهتمام أيضا للتحقيق في ما إذا كان يمكن أن تتولد أنواع أخرى من الخلايا العصبية مع هذا النظام الأساسي، من خلال تغيير التركيبة المتوسطة في المرحلة الثانية من البروتوكول. وعلاوة على ذلك، فيما يتعلق بنقل EBS من 96V إلى 96U على شكل آبار في اليوم 0، سيكون من المرغوب فيه وضع الداخلي على أساس pipetting متعددة، في نهاية المطاف لتحقيق الإنتاجية العالية من التوافق على طريقة وصفها.

hPSCs، تضم الجنين المستمدة من الخلايا الجذعية الجنينية البشرية (hESCs) والخلايا الجذعية المحفزة التي يسببها (hiPSCs)، هي معنى المحفزة التي يمكن أن تؤدي إلى خلية مختلف الأنساب في المختبر 1-2. وقد استمدت العديد من أنواع الخلايا المتمايزة من hESCs حتى الآن، مما يدعم فكرة أن هذه الخلايا تقديم أدوات قيمة للبحث العلمي والنهج القائم على الفحص الخلية، وتبشر الخلايا المستندة إلى التداوي. بروتوكولات تمايز الخلايا العصبية لوعادة ما تكون معقدة hESCs ومضيعة للوقت وتعتمد في كثير من الأحيان على مصير عموما لأول حمل العصبية، تليها عزلة دليل من الأسلاف العصبية، والتمايز النهائي لاحقة إلى نوع معين من الخلايا العصبية الفائدة 3-6. في بعض الصدد، هذا التعقيد ليس من المستغرب وحتمية بالنظر إلى أن مثل هذه الدولة من بين الفن بروتوكولات توجيه التمايز التدريجي تميل إلى تقليد التنمية البشرية في وقت مبكر، حركتيح هو في حد ذاته في غاية التعقيد. من ناحية أخرى، قد يكون في جزء تعكس أيضا افتقارنا إلى فهم العمليات الجزيئية الكامنة، مما أدى إلى تمايز البروتوكولات التي لا تزال بعيدة عن الأمثل تماما. فيما يتعلق بتحويل hPSCs غير متمايزة في الأديم الظاهر العصبي، بيرا وآخرون. وجدت أن قمع BMP / SMAD1/5/8 الإشارات العصبية من تحريض يعزز hESCs 7. وعلاوة على ذلك، فقد تبين من تعطيل SMAD2 / 3 إشارات لتعزيز تشكيل الأديم الظاهر العصبي 8. وبناء عليه، تعطيل الجمع بين هذه المسارات من 2 يميل إلى أن يؤدي إلى تحريض العصبية أكثر كفاءة من hPSCs 4،9. وفي الآونة الأخيرة، وقد أظهرت لنا أن مسار الإشارات الثالث، FGF / ERK، بمثابة كاظمة قوية من أقرب الخطوات التزام عصبي في hESCs. وعلى العكس، القمع المتزامن لجميع المسارات الثلاثة هذه تؤدي إلى شبه متجانسة تحويل hESCs في الأديم الظاهر العصبي معفي الأيام الأربعة فقط 10. بعد ذلك، لوحظ كفاءة عالية التمايز إلى خلايا عصبية طرفية وظيفية في غضون ثمانية أيام. وكانت الخلايا العصبية التي تم الحصول عليها من المرجح أن تكون الخلايا العصبية الحسية في الجهاز العصبي المحيطي، والتي قد تساهم جزئيا في تفسير اشتقاقها السريع 10. ويعتبر وجود عيوب في الصيانة الخلايا العصبية الحسية سببا للاضطرابات بشرية معينة مثل خلل الوظائف المستقلة العائلية 11. لنمذجة هذه الأمراض يعتمد على التكنولوجيا hiPSC 12، لتوصيف وظيفي أخرى، وكذلك لأغراض تطبيق لا تتطلب أي نوع معين من الخلايا العصبية، قد يكون هذا الإجراء التمايز تقديم أساسا مفيدا. ومع ذلك، أدت استراتيجية التمايز استخدمناها في الأصل تشكيل الهيئات المعنية الجنينية (EBS) من كتل من المستعمرات hESC 10، وهذا في درجة لا بأس به من عدم التجانس فيما يتعلق بأحجام EB، وأيضا ظهرت لتقديم تنازلات الخلايا العصبية في بعض الكفاءة تشكيل مليرة لبنانية خطوط. وعلاوة على ذلك، ونظرا لعدم التجانس في أحجام EB، يبدو أن القدرة على اختبار منهجية آثار عوامل النمو إضافية أو جزيئات صغيرة أثناء وبعد تشكيل الخلايا العصبية ليكون مرتبك بعض الشيء. في هذا التقرير، وتكييفها ونحن لدينا الإجراء السابق إلى وسيلة الإنتاجية المتوافقة مع تقنية التجميع على أساس أجبروا على توليد EBS بطريقة حجم تسيطر عليها إلى حد كبير، كما هو مبين أيضا في سياقات أخرى 13. وبعد ذلك، EBS ولدت في الخامس على شكل لوحات الآبار 96-جيدا ونقل إلى مرفق منخفضة للغاية على شكل U 96-وحات جيدة، لبدء تشكيل الأديم الظاهر العصبي في التعليق. بعد أربعة أيام، يمكن أن يصفح عن EBS من الخلايا العصبية مما يؤدي إلى التمييز في شفائهم عالية الكفاءة والتجانس. بدلا من ذلك، كانت يوم EBS-4 فصلها إلى خلايا واحد ومطلي من هذا النحو، مما أدى إلى انخفاض الكثافة monolayers من الخلايا العصبية البشرية. وبالتالي النتائج التي تم الحصول عليها حتى الآن متماسكة مع دي مستقل 2خطوط hESC rived، وHuES6 NCL3. كشرط مسبق، كانت ناجحة تشكيل EB تعتمد بشكل صارم على استخدام البوليمر الاصطناعية، وبولي فينيل الكحول (PVA)، جنبا إلى جنب مع مثبط ROCK Y-27632 المعروفة لتعزيز بقاء hESC 13-14. وتعززت بشكل كبير نتيجة لذلك، تجانس EBS التي تشكلت في 96-V-لوحات مقارنة تشكيل EBS، لأن الحضارات الشامل على أساس تقنيات تقسيم عشوائي. هذا النظام يوفر بالتالي منصة تحسنت بشكل ملحوظ عن تشكيل الأديم الظاهر العصبي في الثقافة التعليق، تليها تشكيل الخلايا العصبية تسيطر عليها في ظل ظروف غاية ملتصقة.

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> اسم كاشف </td><td> شركة </td><td> كتالوج رقم </td><td> تعليقات </td></tr><tr><td> Matrigel HC </td><td> بيكتون ديكنسون </td><td> 354263 </td><td> انظر النص للحصول على تفاصيل حول التعامل مع </td></tr><tr><td> DMEM/F-12 </td><td> الحياة تكنولوجيز </td><td> 21331-020 </td><td></td></tr><tr><td> بولي (فينيل الكحول) </td><td> سيجما </td><td> 363170 </td><td> حل عند 0.4٪ في DMEM/F-12 باستخدام الموجات فوق الصوتية بالحمام المائي / تجنب ارتفاع درجة الحرارة / يمكن أن تظل في 4 درجات مئوية لعدة أسابيع </td></tr><tr><td> N2 الملحق </td><td> الحياة تكنولوجيز </td><td> 17502-048 </td><td> 100X، وتخزين مأخوذة المجمدة </td></tr><tr><td> B27 الملحق </td><td> الحياة تكنولوجيز </td><td> 12587-010 </td><td> 50X، المخزن كما مأخوذة المجمدة </td></tr><tr><td> الأبقار مصل الزلال </td><td> سيجما </td><td> A1595 </td><td> 10٪ = 500X، المخزن كما مأخوذة المجمدة </td></tr><tr><td> الجلوتامين L-البنسلين / الستربتوميسين </td><td> PAA </td><td> P11-013 </td><td> أو ما يعادلها </td></tr><tr><td> FGF2 </td><td> Peprotech </td><td> 100-18B </td><td> حل في 10 ميكروغرام / مل في 0.1٪ BSA / PBS = 1000X، المخزن كما مأخوذة المجمدة </td></tr><tr><td> ROCK المانع Y-27632 </td><td> abcamBiochemicals </td><td> ASC-129 </td><td> حل بنسبة 10 ملم في DMSO = مخزن، كما 1000X مأخوذة المجمدة </td></tr><tr><td> PBS </td><td> PAA </td><td> H15-002 </td><td> أو ما يعادلها </td></tr><tr><td> Accutase </td><td> PAA </td><td> L11-007 </td><td></td></tr><tr><td> 96-V-أسفل جيدا لوحات </td><td> نونك </td><td> 277143 </td><td></td></tr><tr><td> PD0325901 </td><td> محور عصبي Medchem </td><td> محور عصبي 1408 </td><td> حل عند 0.5 ملم في DMSO = مخزن، كما 1000X مأخوذة المجمدة </td></tr><tr><td> SB431542 </td><td> abcamBiochemicals </td><td> ASC-163 </td><td> حل في 15 ملم في DMSO = مخزن، كما 1000X مأخوذة المجمدة </td></tr><tr><td> Dorsomorphin </td><td> سانتا كروز </td><td> SC-200689 </td><td> حل عند 0.5 ملم في DMSO = مخزن، كما 1000X مأخوذة المجمدة </td></tr><tr><td> 96-U-أسفل جيدا لوحات المرفقات منخفضة للغاية </td><td> كورنينج </td><td> 7007 </td><td></td></tr><tr><td> بيتا-III الأجسام المضادة تويولين (الماوس) </td><td> سيجما </td><td> T8660 </td><td> استخدام في 1:1000 </td></tr><tr><td> بيتا-III تويولين الأجسام المضادة (ارنب) </td><td> كوفانس </td><td> PRB-435P </td><td> استخدام في 1:2000 </td></tr><tr><td> BRN3A (POU4F1) الأجسام المضادة </td><td> سانتا كروز </td><td> SC-8429 </td><td> استخدام في 1:500 </td></tr><tr><td></td><td></td><td></td><td> الجدول 1. &lt;/ STRONG&gt; الكواشف محددة والمعدات. </td></tr></tbody></table>

rapid and efficient generation of neurons from human pluripotent stem cells in a multititre plate format

البروتوكولات القائمة لتوليد الخلايا العصبية البشرية من الخلايا الجذعية المحفزة (hPSCs) وغالبا ما تكون مملة في أن تكون إجراءات متعددة الخطوات التي تنطوي على العزل والتوسع في الخلايا العصبية السلائف، قبل التمايز النهائي. بالمقارنة مع هذه النهج تستغرق وقتا طويلا، وجدنا مؤخرا أن تثبيط مجتمعة من ثلاثة مسارات الإشارات، TGFβ/SMAD2، BMP/SMAD1، وجمعية جيل المستقبل / ERK، ويعزز الحث السريع في الأديم الظاهر العصبي من hPSCs، تليها تمايز الخلايا العصبية فوري في وظيفية. هنا، تكيفنا إجراءاتنا إلى تنسيق رواية وحة multititre، لزيادة تعزيز وتكرار لجعلها متوافقة مع منتصف الإنتاجية التطبيقات. وهي تتألف من أربع أيام من تشكيل الأديم الظاهر العصبي في مجالات العائمة (الهيئات مضغي الشكل)، تليها أربعة أيام مزيد من التمايز في الخلايا العصبية في ظل ظروف ملتصقة. معظم الخلايا التي تم الحصول عليها مع هذا البروتوكول ويبدو أن الخلايا العصبية الحسية الثنائي القطب. وعلاوة على ذلك،هذا الإجراء هو ذات كفاءة عالية، لا تتطلب مهارات خاصة الخبراء، ويستند إلى وسيلة بسيطة محددة الصفات كيميائيا مع فعالة من حيث التكلفة جزيئات صغيرة. بسبب هذه الميزات، قد الإجراء بمثابة منصة مفيدة لتحقيق مزيد الفنية وكذلك لخلية القاعدة التي تتطلب فحص الخلايا العصبية الحسية يقترب الإنسان أو الخلايا العصبية من أي نوع.

في تقريرنا السابق، وذلك تمشيا مع العديد من الآخرين، يمكن أن تتولد من EBS hPSCs ببساطة عن طريق replating المجاميع على تقسيم الروتيني للhPSCs في المرفقات أطباق منخفضة 10. هذه النتائج عادة في توزيع واسعة من الأحجام EB الناتجة (الشكل 1C، أعلى). مشكلة أخرى تنتج عن ذلك هو أن تحتفظ في التعليق EBS تميل إلى تجميع مع بعضها البعض، مما يؤدي إلى عدم تجانس أكبر من الأحجام EB. للتحايل على هذه المشاكل، لذلك حاولنا لتوليد EBS من الطلاء hPSCs واحد في المرفقات الآبار منخفضة لوحات multititre (الشكل 1A). أدى ذلك إلى تشكيل أي EB وموت الخلايا (1B الشكل، أسفل اليمين). تطبيق جزيء بقاء المعروف hPSCs، أعطى Y-27632، نتائج مماثلة. وبالمثل، تميل تطبيق الكحول البولي فينيل (PVA) الذي سبق أظهرت لتعزيز تشكيل EB hESCs من 16، إلى &quot;جمع&quot; في hPSCs في الجزء السفلي من 96Vلم الآبار ولكن لا تؤدي إلى تشكيل EB. ومع ذلك، إذا الجمع بين Y-27632 مع مكملات PVA، كنا قادرين على توليد بسهولة من EBS وحيدة الخلية تعليق من hESCs، في ظل ظروف محددة الصفات كيميائيا (1B الشكل). مريح، يمكن أن أحجام EB في هذا الشكل لوحة multititre لرقابة مشددة من قبل البذر أعداد مختلفة من الخلايا لكل بئر، وعلى النقيض من استخدام التقنيات التقليدية (الشكل 1C، أسفل). على حضانة أخرى في لوحات 96V، ومع ذلك، تميل إلى التمسك EBS الجزء السفلي من الآبار. لذلك، في اليوم بعد تشكيل EB، كان مطلوب منها نقل EBS لوحات المرفقات البالغة الانخفاض 96U (الشكل 1A). ثم هو فعل الأديم الظاهر العصبي في هذا الشكل باستخدام جزيء صغير كوكتيل تتألف من PD0325901 (FGF / ERK المانع)، SB431542 (TGFβ/SMAD2 المانع)، وdorsomorphin (BMP/SMAD1 المانع)، كما هو موضح 10. بعد تشكيل الأديم الظاهر العصبياستخدام هذا الكوكتيل جزيء صغير، يمكن مطلي على EBS من أن تثير الخلايا العصبية على أي شكل، شريطة أن تكون السطوح المغلفة مع Matrigel، (الشكل 2). من خلال البدء بتشكيل EB مع أعداد مختلفة من الخلايا (الشكل 1C، أسفل)، وجدنا أن EBS المتولدة من الخلايا حوالي 8000 من شأنه ان يؤدي أفضل قدرة الخلايا العصبية تمايز. ويتميز هذا الامتداد من الخلايا العصبية وضوحا من EBS مطلي، وانخفاض المراكز EB نخرية بعد الطلاء، والتعبير عالية من علامات حسية والقومية العصبية، مثل BRN3A وβ-III تويولين (أرقام 2 و 3A، B). مجمل الكفاءات تمايز الخلايا العصبية يبدو أن تكون قابلة للمقارنة إلى الإجراء الأصلي (~ 70٪) (الشكل 3)، والتي كانت سارية المفعول لكلا hESCs وhiPSCs 10. لدينا حتى الآن يعملون خطين hESC مستقلة، وHuES6 NCL3، في إجراء multiwell، في حين تقلب خط تعتمد على التمايز في الخلاياعموما يمكن ن الكفاءة لا يمكن استبعاده. والعديد من التطبيقات من الخلايا العصبية المشتقة من hPSC تتطلب monolayers من الخلايا التمييزية، بدلا من EBS مطلي. ولذلك التحقيق أيضا عما إذا كانت الخلية المفترضة المجالات عصبي في يوم 4 من البروتوكول (الشكل 2، وسط) يمكن أن تنفصل إلى خلايا واحدة باستخدام Accutase؛ لثم يتم مطلي على النحو monolayers. في الواقع، بناء على الطلاء من الخلايا واحدة من الخلايا عصبي يوم-4، وضوحا تمايز الخلايا العصبية من هذه الخلايا يتم الحصول replated في الكفاءة ما يقرب من 60٪ (الشكل 3C). <img src="/files/ftp_upload/4335/4335fig1.jpg" alt="الشكل 1" fo:content-width="5.5in" fo:src="/files/ftp_upload/4335/4335fig1highres.jpg"/> الشكل 1. EB الإجراء التشكيل. تخطيطي) من إجراء تشكيل EB. قبل يوم واحد من بدء اح<html> والمصنف ntiation (د-1)، تعليق hESCs تحتوي على عدة آلاف من الخلايا لكل 100 ميكرولتر في آبار 96V، تليها الطرد المركزي. شكلت EBS بين عشية وضحاها يتم نقل بعد ذلك إلى مرفق الآبار منخفضة للغاية 96U لمزيد من العلاج. B) اختبار آثار PVA وY-27632 على تشكيل EB. لا يمكن إلا أن EB تشكيل لوحظ في المتوسط ​​تحتوي على كل PVA وY-27632 (انظر رأس السهم) C) أعلى: EBS شكلت بالوسائل التقليدية وعادة ما تكون غير متجانسة في الحجم. القاع: EBS شكلت مع تقنية &quot;تدور EB&quot; صورت في A. باستخدام أعداد مختلفة من الخلايا المدخلات، ويمكن التحكم بأحجام EB بإحكام وكانت موحدة إلى حد كبير. <a href="http://www.jove.com/files/ftp_upload/4335/4335fig1large.jpg" target="_blank">اضغط هنا لمشاهدتها بشكل اكبر شخصية</a> . <html> 35fig2highres.jpg &quot;/&gt; الشكل 2. الخلايا العصبية الرسم البياني التشكيل. قبل يوم من بدء التمايز (د-1)، يتم إنشاء EBS في لوحات باستخدام 96V تشكيل EB المشار المتوسط. عند نقله من لوحات EBS إلى 96U، يبدأ الاستقراء العصبية باستخدام التمايز المتوسطة. 4 أيام في وقت لاحق، ومطلي EBS في Matrigel الآبار المغلفة لشكل multiwell المطلوب. وتظهر الأشكال التضاريسية ممثل عن كل خطوة. الصورة على اليمين يظهر الامتداد العصبية نموذجية من EBS مطلي - كثافة عالية الخلية المنطقة على الحق جدا هو جزء من مركز EB مطلي من الخلايا العصبية التي تميل إلى النمو على نحو شعاعي. بدلا من ذلك، في يوم 4، EBS يمكن أن تنفصل إلى خلايا واحد ومطلي بها لالتمايز النهائي وmonolayers (النص والشكل 3C للحصول على التفاصيل). <a href="http://www.jove.com/files/ftp_upload/4335/4335fig2large.jpg" target="_blank">اضغط هنا لمشاهدتها بشكل اكبر شخصية</a> . ontent &quot;FO: المحافظة على together.within صفحة =&quot; دائما &quot;&gt; <img src="/files/ftp_upload/4335/4335fig3.jpg" alt="الشكل 3" fo:content-width="5.5in" fo:src="/files/ftp_upload/4335/4335fig3highres.jpg"/> الشكل 3. توصيف الخلايا العصبية. A) في الوقت الحقيقي RT-PCR توصيف اليوم 8 الثقافات العصبية بكميات كبيرة. لاحظ أنه في عينات متباينة قمة العصبية والجينات علامة عموم العصبية كانت upregulated بقوة بالمقارنة مع خلايا غير متمايزة السيطرة. على الرغم من عينات الخلايا بدأت مع 16000 أظهرت أعلى مستويات التعبير العصبية (لاحظ زيادة وغاريتمي)، EBS أثبتت بين 4،000 إلى 8،000 الخلايا الأكثر فائدة على أساس معايير شكلية. B) أكثر من الخلايا المتزايد من الخلايا العصبية هي EBS مطلي تلطيخ إيجابية للبيتا III تويولين (أحمر) الخلايا العصبية الحسية وعلامة BRN3A (الخضراء). C) الخلايا العصبية التي تشكلت بعد الطلاء خلية واحدة بدلا من الطلاء EBS. في يوم 4 من البروتوكول (الشكل 2)، كانت EBS العائمة فصلها باستخدام Accutase والمصنف على النحو الخلايا واحدة لثم التفريق عضال كما monolayers. وكما هو موضح على اليسار، الحصول بسهولة على الخلايا العصبية مع مورفولوجيا النموذجية التي ملطخة إيجابية بالنسبة لبيتا-III تويولين، في حين بقاء الخلية على ما يبدو إلى حد ما انخفض بالمقارنة مع الطلاء EB. الحق: كيمياء سيتولوجية مناعية على أساس العائد الكمي للالعصبية (ن = 3 أقسام ممثل تحليل + / - SD). <a href="http://www.jove.com/files/ftp_upload/4335/4335fig3large.jpg" target="_blank">اضغط هنا لمشاهدتها بشكل اكبر شخصية</a> . <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> اسم الجين </td><td> FWD التمهيدي تسلسل </td><td> مراجعة تسلسل التمهيدي </td></tr><tr><td> ACTB (التدبير المنزلي الجينات) </td><td> TCAAGATCATTGCTCCTCCTGAG </td><td> ACATCTGCTGGAAGGTGGACA </td></tr><tr><td> RPL37A (التدبير المنزلي الجينات) </td><td> GTGGTTCCTGCATGAAGACAGTG </td><td> TTCTGATGGCGGACTTTACCG </td></tr><tr><td> DCX </td><td> AGGGCTTTCTTGGGTCAGAGG </td><td> GCTGCGAATCTTCAGCACTCA </td></tr><tr><td> ISL1 </td><td> TTTATTGTCGGAAGACTTGCCACTT </td><td> TCAAAGACCACCGTACAACCTTTATCT </td></tr><tr><td> MAPT </td><td> TTACCCTGGGCACTGGCCTA </td><td> TCCTGCTCAACATGGCAAACTC </td></tr><tr><td> NEUROD1 </td><td> GACTGATTGCACCAGCCCTTC </td><td> CGGACGGTTCGTGTTTGAAAG </td></tr><tr><td> NEUROG1 </td><td> CAGAGACAAGGAGTGGGCTTCA </td><td> CTCCAGCCCTGTGCCTGAAT </td></tr><tr><td> SOX10 </td><td> TCCTTGCCAGCTCCCTCTTC </td><td> CAAGGGTTAGGGCCTGAGCA </td></tr><tr><td> SYT4 </td><td> GCCAATCTCACCACCCAAATG </td><td> CACACACCATGCTTCCTTCCA </td></tr></tbody></table> الجدول 2. الاشعال تستخدم لRT-qPCR.

Watch this Scientific Journal Video about Rapid and Efficient Generation of Neurons from Human Pluripotent Stem Cells in a Multititre Plate Format at JoVE.com

Rapid and Efficient Generation of Neurons from Human Pluripotent Stem Cells in a Multititre Plate Format

بروتوكولات لتمايز الخلايا العصبية من الخلايا الجذعية المحفزة الإنسان (hPSCs) وغالبا ما تكون وقتا طويلا وتتطلب مهارات كبيرة ثقافة الخلية. هنا، تكيفنا صغيرة الداخلي القائم على التمايز جزيء إلى تنسيق وحة multititre، مما يسمح للجيل بسيطة وسريعة، وفعالة من الخلايا العصبية الإنسان في الطريقة التي تسيطر عليها.

بسرعة وكفاءة توليد الخلايا العصبية من الخلايا الجذعية المحفزة الإنسان في تنسيق اللوحة Multititre

Existing protocols for the generation of neurons from human pluripotent stem cells (hPSCs) are often tedious in that they are  multistep procedures ...

rapid-efficient-generation-neurons-from-human-pluripotent-stem-cells

Google

Research

JoVE Journal

Biology

43.5K Views.  Max Planck Institute for Molecular Biomedicine. بروتوكولات لتمايز الخلايا العصبية من الخلايا الجذعية المحفزة الإنسان (hPSCs) وغالبا ما تكون وقتا طويلا وتتطلب مهارات كبيرة ثقافة الخلية. هنا، تكيفنا صغيرة الداخلي القائم على التمايز جزيء إلى تنسيق وحة multititre، مما يسمح للجيل بسيطة وسريعة، وفعالة من الخلايا العصبية...

Video: Rapid and Efficient Generation of Neurons from Human Pluripotent Stem Cells in a Multititre Plate Format

Transfecting and Nucleofecting Human Induced Pluripotent Stem Cells

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human embryonic stem cells (HESCs)1. While improvements in several gene delivery methods have been described2-9, transfection remains a capricious process for HESCs, and has not yet been reported in human induced pluripotent stem cells (iPSCs). In this video, we demonstrate how our lab routinely transfects and nucleofects human iPSCs using plasmid with an enhanced green fluorescence protein (eGFP) reporter. Human iPSCs are adapted and maintained as feeder-free cultures to eliminate the possibility of feeder cell transfection and to allow efficient selection of stable transgenic iPSC clones following transfection. For nucleofection, human iPSCs are pre-treated with ROCK inhibitor11, trypsinized into small clumps of cells, nucleofected and replated on feeders in feeder cell-conditioned medium to enhance cell recovery. Transgene-expressing human iPSCs can be obtained after 6 hours. Antibiotic selection is applied after 24 hours and stable transgenic lines appear within 1 week. Our protocol is robust and reproducible for human iPSC lines without altering pluripotency of these cells.

Despite recent advancements in genetic modification, transfection of human embryonic stem cells (HESCs) remains a capricious process. To our knowledge, systematic and efficient methods to transfect human induced pluripotent stem cells (iPSCs) have not been reported. Here, we describe robust protocols to efficiently transfect and nucleofect human iPSCs.

وبنقل العدوى إلى الإنسان Nucleofecting الجذعية المحفزة المستحثة خلايا

Genetic modification is continuing to be an essential tool in studying stem cell biology and in setting forth potential clinical applications of human ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

كفاءة اشتقاق السلائف القلب البشري وافرة القوة العضلية من خلايا المنشأ الجنينية البشرية التعريفي مع جزيء صغير

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

إعادة برمجة الخلايا الجسدية البشرية المستحثة إلى الخلايا الجذعية المحفزة (iPSCs) استخدام ناقلات فيروسات الرجعية مع GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

جيل من الفئران المستمدة من الخلايا الجذعية المحفزة المستحثة

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Generation of Human Induced Pluripotent Stem Cells from Peripheral Blood Using the STEMCCA Lentiviral Vector

Through the ectopic expression of four transcription factors, Oct4, Klf4, Sox2 and cMyc, human somatic cells can be converted to a pluripotent state, generating so-called induced pluripotent stem cells (iPSCs)1-4. Patient-specific iPSCs lack the ethical concerns that surround embryonic stem cells (ESCs) and would bypass possible immune rejection. Thus, iPSCs have attracted considerable attention for disease modeling studies, the screening of pharmacological compounds, and regenerative therapies5.
We have shown the generation of transgene-free human iPSCs from patients with different lung diseases using a single excisable polycistronic lentiviral Stem Cell Cassette (STEMCCA) encoding the Yamanaka factors6. These iPSC lines were generated from skin fibroblasts, the most common cell type used for reprogramming. Normally, obtaining fibroblasts requires a skin punch biopsy followed by expansion of the cells in culture for a few passages. Importantly, a number of groups have reported the reprogramming of human peripheral blood cells into iPSCs7-9. In one study, a Tet inducible version of the STEMCCA vector was employed9, which required the blood cells to be simultaneously infected with a constitutively active lentivirus encoding the reverse tetracycline transactivator. In contrast to fibroblasts, peripheral blood cells can be collected via minimally invasive procedures, greatly reducing the discomfort and distress of the patient. A simple and effective protocol for reprogramming blood cells using a constitutive single excisable vector may accelerate the application of iPSC technology by making it accessible to a broader research community. Furthermore, reprogramming of peripheral blood cells allows for the generation of iPSCs from individuals in which skin biopsies should be avoided (i.e. aberrant scarring) or due to pre-existing disease conditions preventing access to punch biopsies.
Here we demonstrate a protocol for the generation of human iPSCs from peripheral blood mononuclear cells (PBMCs) using a single floxed-excisable lentiviral vector constitutively expressing the 4 factors. Freshly collected or thawed PBMCs are expanded for 9 days as described10,11 in medium containing ascorbic acid, SCF, IGF-1, IL-3 and EPO before being transduced with the STEMCCA lentivirus. Cells are then plated onto MEFs and ESC-like colonies can be visualized two weeks after infection. Finally, selected clones are expanded and tested for the expression of the pluripotency markers SSEA-4, Tra-1-60 and Tra-1-81. This protocol is simple, robust and highly consistent, providing a reliable methodology for the generation of human iPSCs from readily accessible 4 ml of blood.

Here we show a simple and effective protocol for the generation of human iPSCs from 3-4 ml of peripheral blood using a single lentiviral reprogramming vector. Reprogramming of readily available blood cells promises to accelerate the utilization of iPSC technology by making it accessible to a broader research community.

جيل من صنع الإنسان من الخلايا الجذعية المحفزة الدموية المحيطية باستخدام Lentiviral STEMCCA المتجهات

Through the ectopic expression of four transcription factors, Oct4, Klf4, Sox2 and cMyc, human somatic cells can be converted to a pluripotent state, ...

Generation of Human Cardiomyocytes: A Differentiation Protocol from Feeder-free Human Induced Pluripotent Stem Cells

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is essential first to generate functional human cardiomyocytes (CMs). The use of these cells in drug discovery and toxicology studies would also be highly beneficial, allowing new pharmacological molecules for the treatment of cardiac disorders to be validated pre-clinically on cells of human origin. Of the possible sources of CMs, induced pluripotent stem (iPS) cells are among the most promising, as they can be derived directly from readily accessible patient tissue and possess an intrinsic capacity to give rise to all cell types of the body 1. Several methods have been proposed for differentiating iPS cells into CMs, ranging from the classical embryoid bodies (EBs) aggregation approach to chemically defined protocols 2,3. In this article we propose an EBs-based protocol and show how this method can be employed to efficiently generate functional CM-like cells from feeder-free iPS cells.

Pluripotent stem cells, either embryonic or induced pluripotent stem (iPS) cells, constitute a valuable source of human differentiated cells, including cardiomyocytes. Here, we will focus on cardiac induction of iPS cells, showing how to use them to obtain functional human cardiomyocytes through an embryoid bodies-based protocol.

جيل من العضلية الإنسان: البروتوكول التمايز من خالية من الطاعم المستحثة الخلايا الجذعية المحفزة الإنسان

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

سريعة وفعالة الزرد التنميط الجيني باستخدام PCR عالية الدقة مع تحليل نذوب

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

Efficient Generation Human Induced Pluripotent Stem Cells from Human Somatic Cells with Sendai-virus

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs include modeling pathogenesis of human genetic diseases, autologous cell therapy after gene correction, and personalized drug screening by providing a source of patient-specific and symptom relevant cells. However, there are several hurdles to overcome, such as eliminating the remaining reprogramming factor transgene expression after human iPSCs production. More importantly, residual transgene expression in undifferentiated human iPSCs could hamper proper differentiations and misguide the interpretation of disease-relevant in vitro phenotypes. With this reason, integration-free and/or transgene-free human iPSCs have been developed using several methods, such as adenovirus, the piggyBac system, minicircle vector, episomal vectors, direct protein delivery and synthesized mRNA. However, efficiency of reprogramming using integration-free methods is quite low in most cases.
Here, we present a method to isolate human iPSCs by using Sendai-virus (RNA virus) based reprogramming system. This reprogramming method shows consistent results and high efficiency in cost-effective manner.

Here, we present our established method to reprogram human somatic cells into transgene-free human iPSCs with Sendai virus, which shows consistent outcome and enhanced efficiency.

كفاءة الجيل المستحثة الإنسان افرة القوة الخلايا الجذعية من الخلايا الجسدية البشرية مع سينداي الفيروسات

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs ...

Efficient Sporulation of Saccharomyces cerevisiae in a 96 Multiwell Format

During times of nutritional stress, Saccharomyces cerevisiae undergoes gametogenesis, known as sporulation. Diploid yeast cells that are starved for nitrogen and carbon will initiate the sporulation process. The process of sporulation includes meiosis followed by spore formation, where the haploid nuclei are packaged into environmentally resistant spores. We have developed methods for the efficient sporulation of budding yeast in 96 multiwell plates, to increase the throughput of screening yeast cells for sporulation phenotypes. These methods are compatible with screening with yeast containing plasmids requiring nutritional selection, when appropriate minimal media is used, or with screening yeast with genomic alterations, when a rich presporulation regimen is used. We find that for this method, aeration during sporulation is critical for spore formation, and have devised techniques to ensure sufficient aeration that are compatible with the 96 multiwell plate format. Although these methods do not achieve the typical ~80% level of sporulation that can be achieved in large-volume flask based experiments, these methods will reliably achieve about 50-60% level of sporulation in small-volume multiwell plates.

Efficient Sporulation of Saccharomyces cerevisiae in a 96 Multiwell Format

Here, sporulation of Saccharomyces cerevisiae is carried out in a 96 multiwell format.

تبوغ الفعال لل<em&gt; خميرة الخباز</em&gt; في تنسيق Multiwell 96

During times of nutritional stress, Saccharomyces cerevisiae undergoes gametogenesis, known as sporulation. Diploid yeast cells that are starved for ...

Efficient and Consistent Generation of Retinal Pigment Epithelium/Choroid Flatmounts from Human Eyes for Histological Analysis

The retinal pigment epithelium (RPE) and retina are functionally and structurally connected tissues that work together to regulate light perception and vision. Proteins on the RPE apical surface are tightly associated with proteins on the photoreceptor outer segment surface, making it difficult to consistently separate the RPE from the photoreceptors/retina. We developed a method to efficiently separate the retina from the RPE of human eyes to generate complete RPE/choroid and retina flatmounts for separate cellular analysis of the photoreceptors and RPE cells. An intravitreal injection of a high-osmolarity solution of D-mannitol, a sugar not transported by the RPE, induced the separation of the RPE and retina across the entire posterior chamber without causing damage to the RPE cell junctions. No RPE patches were observed attached to the retina. Phalloidin labeling of actin showed RPE shape preservation and allowed morphometric analysis of the entire epithelium. An artificial intelligence (AI)-based software was developed to accurately recognize and segment the RPE cell borders and quantify 30 different shape metrics. This dissection method is highly reproducible and can be easily extended to other animal models.

We describe a method to efficiently separate retinal pigment epithelium (RPE) from the retina in human eyes and generate whole RPE/choroid flatmounts for histological and morphometric analyses of the RPE.

توليد فعال ومتسق لظهارة صبغية شبكية العين / المشيمية من العين البشرية للتحليل النسيجي

The retinal pigment epithelium (RPE) and retina are functionally and structurally connected tissues that work together to regulate light perception and ...