يعترف المؤلفون بأن الأرض التي أجروا عليها هذا البحث هي الأراضي التقليدية والأجداد وغير المعترف بها لأمة xwməθkwəy̓əm (Musqueam). لطالما كانت الأرض التي تقع عليها مكانا للتعلم لشعب Musqueam ، الذين انتقلوا لآلاف السنين في ثقافتهم وتاريخهم وتقاليدهم من جيل إلى آخر في هذا الموقع. نحن نشجع الآخرين على معرفة المزيد عن الأراضي الأصلية التي يعيشون ويعملون فيها في https://native-land.ca. يقر المؤلفون بالدعم المقدم من مجلس العلوم الطبيعية والهندسة في كندا (NSERC) المنح الدراسية الكندية للخريجين - الماجستير (NP) ، جائزة مايكل سميث للبحوث الصحية BC للمتدربين (RT-2023-3174 ، إلى MH) ، برنامج المنح الاستكشافية لمجلس أبحاث العلوم الطبيعية والهندسة في كندا (NSERC) (RGPIN-2019-04591 إلى CT ، RGPIN-2016-04282 إلى LCO) ، المعهد الكندي للبحوث المتقدمة / البشر والميكروبيوم (FL-001253 Appt 3362 ، إلى CT) ، وجائزة مؤسسة مايكل سميث للباحثين في مجال البحوث الصحية (18239 ، إلى CT) ، والمعاهد الكندية للبحوث الصحية (PJT-159458 إلى LCO) والمؤسسة الكندية للابتكار (34673 إلى LCO و 38277 إلى CT). نحن ممتنون للدعم الفني من مركز UBC لنمذجة الأمراض و ubcFLOW ، الذي تدعمه مبادرة المرونة البيولوجية UBC GREx ، ولأعضاء مختبرات Osborne و Tropini للمناقشات النقدية وتقييم المخطوطة. تم إنشاء الشكل 1A والشكل 2A باستخدام Biorender.com.

استكشاف ديناميكيات بكتيريا عاثيات الأمعاء في نماذج الفئران باستخدام T4 Phage

ليس لدى المؤلفين ما يكشفون عنه.

تمثل دراسة العاثيات في الميكروبيوم تحديا كبيرا مقارنة بنظيراتها البكتيرية. على وجه التحديد ، لا تحتوي العاثيات على علامة تطورية محفوظة مشتركة بين جميع العاثيات المشابهة للوحدات الفرعية الريبوسومية 16S و 18S التي تسمح بسهولة تسلسل وتحديد الأنواع بدائية النواة وحقيقية النواة ، على التوالي<su...

البكتيريا ، أو العاثيات ، هي فيروسات تصيب وتقتل البكتيريا بالأنواع وخصوصية مستوى السلالة1. تلعب العاثيات أدوارا مهمة داخل المجتمعات البكتيرية المعقدة مثل ميكروبيوتا الأمعاء ، حيث تورطت في تنظيم ديناميكيات السكان وقيادة اللياقة البكتيرية2. طوال العقد الماضي ، كان هناك اهتمام متجدد بأبحاث العاثيات بسبب ظهور مسببات الأمراض المقاومة لمضادات الميكروبات3 ، وإمكانية العلاج بالعاثيات كاستراتيجية علاج بديلة. في السنوات الأخيرة ، تم استخدام كوكتيلات العاثية lytic عن طريق الوريد مع بعض النجاح في الالتهابات الإنتانية البكتيرية الخطيرة المقاومة للمضادات الحيوية في البشر 3,4. كما تم اقتراح العلاج بالعاثيات عن طريق الفم كبديل محتمل للمضادات الحيوية لعلاج الالتهابات المعوية والالتهابات. علاوة على ذلك ، تورطت العاثيات في نجاح عمليات زرع الترشيح البرازي (FFT) ، وهي مستحضرات ميكروبيوتا برازية تم ترشيحها لإزالة البكتيريا ، في علاج عدوى المطثية العسيرة المتكررة (rCDI) 5,6 ، واضطرابات الأمعاء الالتهابية (IBD) 7,8 والتهاب الأمعاء والقولون الناخر في الخنازير قبل الأوان9. بالنظر إلى هذه النتائج ، من المهم النظر في التفاعلات بين كل من العاثيات وميكروبات الأمعاء ، والعاثيات ومضيف الثدييات ، لأن إضافة العاثيات الجديدة إلى مجتمع موجود مسبقا قد يكون له آثار غير مباشرة على المجتمع ككل ، وليس فقط البكتيريا المستهدفة2،10.
أثبتت دراسة تفاعلات العاثيات مع البكتيريا المستهدفة في المختبر أنها مفيدة لفهم آليات وتأثيرات تفاعلات العاثيات والبكتيريا في الأمعاء. في هذا الإعداد ، تبين أن العاثيات T4 الخاصة بالإشريكية القولونية من رتبة Caudovirales تتطلب مجالات شبيهة بالغلوبولين المناعي (Ig) تقع داخل بروتينات قفيصة خارجية عالية الاستضفاف (Hoc) على سطح virion للالتصاق بالمخاط المعوي11. بالإضافة إلى ذلك ، أظهرت فحوصات transwell أن العاثيات T4 قادرة على التفاعل مع ثقافات الخلايا الظهارية والانتقال عبر طبقات الخلايا عن طريق كثرة الخلايا الكبيرة12,13. تدعم هذه النتائج الفرضية القائلة بأن العاثيات يمكن أن تتفاعل مع مضيفها الميتازوان ، على الرغم من أنها غير قادرة على إصابة الخلايا حقيقية النواة. هذه النماذج ، على الرغم من فائدتها ، تفتقر إلى مجموعة كاملة من التفاعلات المعقدة التي تحدث في النظام البيئي للأمعاء المطلوبة لاستكشاف شامل للتفاعل الثلاثي بين العاثيات والبكتيريا ومضيف metazoan.
تعد نماذج الماوس أداة مهمة للتحقيق في العاثيات داخل البيئات المعقدة. التطبيق المرغوب فيه لإدارة العاثيات هو كاستراتيجية بديلة لعلاج الالتهابات المقاومة لمضادات الميكروبات أو الأمراض المرتبطة بالأمراض الالتهابية المزمنة ، بما في ذلك مرض التهاب الأمعاء. ومع ذلك ، تشير الأدبيات الناشئة إلى أن سلوك العاثيات في المختبر لا يمثل بشكل كامل وظائف الجسم الحي . أظهر Buttimer et al.14 أن كوكتيل العاثية كان قادرا على استنفاد البكتيريا المستهدفة في اتحاد ميكروبيوتا بشري مبسط في المختبر ، ولكن لا يمكن تكراره في الجسم الحي في الفئران gnotobiotic المستعمرة بنفس اتحاد البكتيريا والعاثيات. علاوة على ذلك ، في ميكروبيوم الفئران التقليدي ، أدت العاثية T7 إلى استنفاد انتقائي لبكتيريا الأمعاء المستهدفة ، على الرغم من ملاحظة الانتعاش التدريجي بمرور الوقت ، مما يدل على تطور المقاومة15. أظهرت دراسات أخرى تعايش العاثيات التي يتم تناولها عن طريق الفم والسلالات البكتيرية المستهدفة في الجسم الحي2،16. في الواقع ، بالإضافة إلى التعايش بين العاثيات والبكتيريا ، أدت إدارة العاثيات إلى تغييرات واسعة النطاق في التكوين العام لمجتمع الجراثيم ووظيفتها2،16. هذا مهم في إعدادات المرض حيث وجدت العديد من الدراسات ارتباطات بين زيادة الوفرة النسبية ل Caudovirales و IBD7،8،17 التي كانت مستقلة عن التغيرات في وفرة البكتيريا7. لا يزال من غير المعروف ما إذا كان هذا هو المحرك أو نتيجة لمرض المرض.
كان التركيز التاريخي للتحقيق في العاثيات حول العلاقة بين العاثية والبكتيريا المستهدفة. ومع ذلك ، من المهم أيضا مراعاة التفاعلات المحتملة بين العاثية والغشاء المخاطي والظهارة والجهاز المناعي لمضيف metazoan. تلعب جميع هذه التفاعلات دورا مهما في الاستجابة الشاملة لعدوى العاثيات المعوية. لإثبات ذلك ، تمت دراسة العاثيات باستخدام الفئران الخالية من الجراثيم (GF) لتوضيح تأثيرها على الجهاز المناعي دون تدخل من قبل الجراثيم8. في هذا النظام ، تم الكشف عن الأحماض النووية العاثية بواسطة مستقبلات تشبه الرسوم (TLRs) الموجودة داخل إندوسومات الخلايا المناعية البلعمية (الضامة والخلايا المتغصنة). أدى هذا إلى تنشيط إشارات المصب وتحفيز الإنتاج المعتمد على الخلايا التائية للإنترفيرون (IFN) -γ 8 أو IFNs من النوع الأول18. علاوة على ذلك ، تورط Fluckiger et al.19 خلايا الذاكرة CD8 + T في التعرف على المستضدات المشفرة بالعاثيات (prophage) ، مما أدى إلى تفاعل الخلايا التائية مع مستضدات الورم ، مما أدى إلى تقليل عبء الورم. أخيرا ، تم توثيق إنتاج الأجسام المضادة الخاصة بالعاثيات في دراسات الفئران حيث تم تسليم العاثيات إلى النماذج الحيوانية بطريقة مستمرة من خلال مياه الشرب 8,20 ، أو عن طريق التزويج الفموي المتكرر على مدى عدة أشهر20 ، مما يدل على قدرة بروتينات العاثيات على تعزيز الاستجابات المناعية الخلطية. على الرغم من أن هذه الأنماط من التلقيح بالعاثيات تسمح بالتحضير الأمثل والمستمر للجهاز المناعي ، إلا أنها قد لا تمثل التفاعلات التي تحدث بشكل طبيعي بين العاثيات والبيئة المعوية ، ولا حركية العلاج بالعاثيات المطبقة عن طريق الفم. حتى الآن ، فحص عدد محدود من الدراسات تفاعلات العاثية مع نوع بكتيري واحد في نماذج الفئران أحادية القولون21. ومع ذلك ، أثبتت الفئران أحادية القولون أهميتها في فك رموز التأثيرات الخاصة بالميكروبات للأنواع الفردية على الجهاز الهضمي (GI) وتطور المناعة22،23،24 ، وقد تثبت فائدتها في فهم التفاعلات الثلاثية بين العاثيات والبكتيريا المستهدفة ومضيف metazoan.
بشكل مثير ، لا يزال هناك الكثير لنتعلمه عن التفاعلات بين العاثية المعوية والبكتيريا المتعايشة مع الأمعاء ، بالإضافة إلى التفاعلات التي تحدث بين مضيف metazoan والعاثيات الموجودة داخله. يوفر هذا البروتوكول مجموعة من الإجراءات لدراسة عاثية T4 المعزولة ونظيرتها البكتيرية ، E. coli (K-12 ، BW25113) ، باستخدام نموذج فأر gnotobiotic. توفر هذه الإجراءات الموحدة أيضا أساسا لتحسين ثنائيات العاثيات / البكتيريا الأخرى من خلال تكييف معلمات النمو مع الأزواج ذات الاهتمام. توضح الطرق الموضحة هنا: (1) تحضير T4 phage و sysates المركبات للتزويج الفموي للفئران. (2) إعطاء العاثية T4 عن طريق الفم إلى الفئران gnotobiotic أحادية القولون E. ؛ (3) مراقبة مستويات العاثية T4 في براز وأنسجة الفئران بمرور الوقت.
بالنسبة للنتائج التمثيلية المعروضة هنا ، تم نشر محللات العاثية T4 المنقاة من مخزونات بنك العاثيات التي يحتفظ بها مختبر Rohwer. تم تكييف طريقة Phage-on-Tap لنشر العاثية T425 ، كما هو مشار إليه في هذا البروتوكول. تنتج هذه الطريقة مخزونا عاليا من العاثيات منخفضة العيار والسموم الداخلية في غضون ثلاثة أيام. باستخدام هذا النهج ، تم جمع 10 مل من ≥ 1010 وحدات تشكيل البلاك (pfu) / مل من العاثية T4 مع < 0.5 وحدة من السموم الداخلية (EU) / مل بشكل روتيني. مستويات السموم الداخلية الموصى بها للإعطاء عن طريق الفم أو الوريد في الفئران هي ≤ 20 EU / mL و ≤ 5 EU / kg / h (أو 0.1 EU تدار على مدار ساعة واحدة للفأر 20 جم) ، على التوالي ، مما يجعل هذه طريقة مناسبة لإعداد العاثيات للتلقيح في الجسم الحي . تم تخزين جميع مخزونات العاثيات عند 4 درجات مئوية في محلول عاثي المغنيسيوم الملحي (SM) (الوصفة المقدمة في الخطوة 1.1.5.1). تمت زراعة الإشريكية القولونية في وسائط LB. بالنسبة لأزواج البكتيريا العاثية المختلفة ، يمكن تكييف وسائط الثقافة المتنوعة وظروف النمو من هذا البروتوكول. يمكن أيضا الحصول على العاثيات من البيئة ، مثل مياه الصرف الصحي والمياه البحرية والتربة والمحتويات المعوية ويمكن عزلها وتنقيتها وفقا ل Sambrook و Russell26 قبل التحضير باستخدام ظروف النمو والانتشار المناسبة لكل زوج من العاثيات المضيفة25. بدلا من ذلك ، يمكن الحصول على العاثيات من مصادر تجارية (انظر جدول المواد) أو من بنوك العاثيات.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1-octanol (99%)</td>
			<td>Thermofisher</td>
			<td>CAAAA15977-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>50 ml PES Steriflip Sterile Disposable Vacuum Filter Units</td>
			<td>Millipore Sigma&#160;</td>
			<td>SCGP00525</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose (Low-EEO/Multi-Purpose/Molecular Biology Grade)</td>
			<td>Fisher BioReagents&#160;</td>
			<td>BP160-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon&#174; 100kDa Ultra-15 centrifugal filter device, Ultracel-100</td>
			<td>Millipore Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr>
			<td>BD Microtainer&#174; Tubes, SST</td>
			<td>BD Medical</td>
			<td>365967</td>
			<td></td>
		</tr>
		<tr>
			<td>Bioexclusion airtight cages (ISO cages)&#160;</td>
			<td>Techiplast</td>
			<td>1245ISOCAGE</td>
			<td></td>
		</tr>
		<tr>
			<td>C1000 Touch&#8482; Thermal Cycler with 96-Well Fast Reaction Module</td>
			<td>BioRad</td>
			<td>1851196</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium Chloride Dihydrate (White Crystals to Powder)</td>
			<td>Fisher BioReagents</td>
			<td>BP510-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Cap Locks For 1.5ML Tube 100/pk</td>
			<td>Andwin Scientific&#160;</td>
			<td>16812612</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform (Ethanol as Preservative/Certified ACS)</td>
			<td>Fisher</td>
			<td>C298-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Copper coated steel beads (4.5 mm)</td>
			<td>Crosman Corporation</td>
			<td>0767</td>
			<td></td>
		</tr>
		<tr>
			<td>DNeasy Blood &#38; Tissue Kit (50)</td>
			<td>Thermo Scientific&#160;</td>
			<td>69504</td>
			<td></td>
		</tr>
		<tr>
			<td>DreamTaq Green PCR Master Mix (2X)</td>
			<td>Thermo Scientific&#160;</td>
			<td>K1081</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid (EDTA) disodium salt solution, for molecular biology, 0.5 M in H2O</td>
			<td>Sigma Aldrich</td>
			<td>E7889</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisher BioReagents&#8482; Agar, Powder / Flakes, Fisher BioReagents&#8482;&#160;</td>
			<td>Fisher Bioreagents</td>
			<td>BP1423-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisher BioReagents&#8482; Microbiology Media: LB Broth (Powder) - Lennox&#160;</td>
			<td>Fisher Bioreagents</td>
			<td>BP1427-500</td>
			<td></td>
		</tr>
		<tr>
			<td>GeneRuler 100 bp DNA Ladder</td>
			<td>Thermo Scientific&#160;</td>
			<td>SM0241</td>
			<td></td>
		</tr>
		<tr>
			<td>Green FastMix&#174; qPCR mix, 1250 rxns</td>
			<td>QuantaBio</td>
			<td>95072-012</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPA filters for isocage lids, AUTOCLAVABLE H14 FILTERS FOR ISO LINE- IRRADIATED</td>
			<td>Techiplast</td>
			<td>UISOHEPAXTBOX-300</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium sulfate heptahydrate</td>
			<td>Fisher BioReagents</td>
			<td>BP213-1</td>
			<td></td>
		</tr>
		<tr>
			<td>MaxQ 6000 Incubated Shaker</td>
			<td>Thermo Scientific&#160;</td>
			<td>8354-30-0009</td>
			<td></td>
		</tr>
		<tr>
			<td>Microbiology Media: LB Broth (Powder) - Lennox</td>
			<td>Fisher BioReagents</td>
			<td>BP1427-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge Tubes with Locking Snap Cap, 2ml</td>
			<td>Fisher</td>
			<td>14-666-315</td>
			<td></td>
		</tr>
		<tr>
			<td>Parafilm sealing film</td>
			<td>Bemis</td>
			<td>PM-996</td>
			<td></td>
		</tr>
		<tr>
			<td>Phage stocks</td>
			<td>Carolina Biological Supply&#160;</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>PicoLab&#174; Mouse Diet 20 EXT</td>
			<td>LabDiet</td>
			<td>5R58</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce&#8482; Chromogenic Endotoxin Quant Kit</td>
			<td>Thermo Scientific&#160;</td>
			<td>A39552S</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase A (17,500 U)</td>
			<td>Qiagen</td>
			<td>19101</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-free DNase Set</td>
			<td>Qiagen&#160;</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Bicarbonate (Fine White Powder)</td>
			<td>Fisher Chemical</td>
			<td>BP328-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Chloride (Crystalline/Certified ACS)</td>
			<td>Fisher Chemical</td>
			<td>S271</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator (probe model CL-18; power source model FB50)</td>
			<td>Fisher scentific&#160;</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile flexible film isolator&#160;</td>
			<td>Class Biologically Clean&#160;</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR&#8482; Safe DNA Gel Stain</td>
			<td>Invitrogen</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr>
			<td>T100 Thermal Cycler&#160;</td>
			<td>BioRad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 phage primer, forward (CCACACATAGCGCGAGTATAA)</td>
			<td>IDT</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 phage primer, forward (GAAACTCGGTCAGGCTATCAA)</td>
			<td>IDT</td>
			<td>n/a</td>
			<td></td>
		</tr>
		<tr>
			<td>TissueLyser II&#160;</td>
			<td>Qiagen&#160;</td>
			<td>85300</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl, 1M Solution, pH 8.0, Molecular Biology Grade, Ultrapure</td>
			<td>Thermo Scientific&#160;</td>
			<td>AAJ22638AE</td>
			<td></td>
		</tr>
		<tr>
			<td>Water, (DNASE, RNASE free)</td>
			<td>Fisher BioReagents</td>
			<td>BP2484100</td>
			<td></td>
		</tr>
	</tbody>
</table>

t4 bacteriophage and e. coli interaction in the murine intestine: a prototypical model for studying host-bacteriophage dynamics in vivo

البكتيريا (العاثيات) هي فيروسات تصيب البكتيريا بخصوصية على مستوى الأنواع والسلالة، وهي أكثر الكيانات البيولوجية وفرة في جميع النظم الإيكولوجية المعروفة. داخل المجتمعات البكتيرية ، مثل تلك الموجودة في ميكروبات الأمعاء ، فإن العاثيات متورطة في تنظيم ديناميكيات مجموعة الميكروبات ودفع التطور البكتيري. كان هناك اهتمام متجدد بأبحاث العاثيات في العقد الماضي ، ويرجع ذلك جزئيا إلى قدرات القتل الخاصة بالمضيف للعاثيات المحللة ، والتي توفر أداة واعدة لمواجهة التهديد المتزايد للبكتيريا المقاومة لمضادات الميكروبات. علاوة على ذلك ، تشير الدراسات الحديثة التي تثبت أن العاثيات تلتصق بالمخاط المعوي إلى أنها قد يكون لها دور وقائي في منع الغزو البكتيري للظهارة الأساسية. الأهم من ذلك ، مثل الميكروبات البكتيرية ، ارتبطت البلعوم المعطلة بنتائج متفاقمة في أمراض مثل مرض التهاب الأمعاء. أظهرت الدراسات السابقة أن العاثيات يمكن أن تعدل ميكروبيوم والبشر من خلال عمليات زرع الترشيح البرازي ، مما يفيد صحة المضيف. مع هذه الموجة الأخيرة من الأبحاث تأتي ضرورة إنشاء وتوحيد بروتوكولات لدراسة العاثيات في سياق ميكروبيوم الأمعاء. يوفر هذا البروتوكول مجموعة من الإجراءات لدراسة عاثيات T4 المعزولة ومضيفها البكتيري ، الإشريكية القولونية ، في سياق الجهاز الهضمي للفئران. توضح الطرق الموضحة هنا كيفية البدء من تحلل العاثيات ، وإدارتها للفئران وتقييم التأثيرات على مستويات المضيف البكتيري والعاثيات. يمكن تعديل هذا البروتوكول وتطبيقه على أزواج العاثيات البكتيرية الأخرى ويوفر نقطة انطلاق لدراسة ديناميكيات العاثية المضيفة في الجسم الحي.

Bacteriophages, or phages, are viruses that infect and kill bacteria with species and strain-level specificity1. Phages play important roles within complex bacterial communities such as the gut microbiota, where they have been implicated in regulating population dynamics and driving bacterial fitness2. Throughout the last decade, there has been renewed interest in phage research owing to the rise of antimicrobial resistant pathogens3, and the potential for phage therapy as an alternative treatment strategy. In recent years, lytic phage cocktails have been used intravenously with some success in serious, antibiotic-resistant bacterial septic infections in humans3,4. Oral phage therapy has also been proposed as a potential alternative to antibiotics to treat intestinal infections and inflammation. Furthermore, phages have been implicated in the success of fecal filtrate transplants (FFT), which are fecal microbiota preparations that have been filtered to remove bacteria, in the treatment of recurrent Clostridioides difficile infection (rCDI)5,6, inflammatory bowel disorders (IBD)7,8&#160;and necrotizing enterocolitis in pre-term pigs9. Given these results, it is important to consider interactions both between phages and the gut microbiota, and phages and the mammalian host, as the addition of novel phages into a preexisting community may have indirect effects on the community as a whole, and not only its target bacteria2,10.
The study of phage interactions with their target bacteria in vitro has proven useful for understanding the mechanisms and impacts of phage and bacteria interactions in the gut. In this setting, it has been shown that Escherichia coli-specific T4 phages of the order Caudovirales require immunoglobulin (Ig)-like domains located within highly antigenic outer capsid (Hoc) proteins on the virion surface to adhere to intestinal mucus11. Additionally, transwell assays have shown that T4 phages are capable of interacting with epithelial cell cultures and translocating through cell layers by macropinocytosis12,13. These results support the hypothesis that phages can interact with their metazoan host, even though they are incapable of infecting eukaryotic cells. These models, while useful, lack the full range of complex interactions that occur in a gut ecosystem that are required for a comprehensive exploration of the tripartite interaction between phages, bacteria and the metazoan host.
Mouse models are an important tool for investigating phages within complex environments. A desirable application of phage administration is as an alternative strategy to treat antimicrobial resistant infections or pathobionts associated with chronic inflammatory diseases, including IBD. However, emerging literature suggests that phage behavior in vitro does not fully represent in vivo functions. Buttimer et al.14&#160;demonstrated that a phage cocktail was able to deplete the targeted bacteria in a simplified human microbiota consortium in vitro, but could not be replicated in vivo in gnotobiotic mice colonized with the same bacteria-phage consortium. Furthermore, in a conventional mouse microbiome, T7 phage led to selective depletion of its target gut bacteria, although gradual recovery was observed over time, indicative of evolved resistance15. Other studies have demonstrated co-existence of orally administered phages and their target bacterial strains in vivo2,16. Indeed, beyond phage/bacteria co-existence, phage administration led to widespread changes in overall microbiota community composition and function2,16. This is relevant in disease settings as several studies have found associations between increased relative abundance of Caudovirales and IBD7,8,17&#160;that were independent of changes in bacterial abundance7. It remains unknown whether this is a driver or consequence of disease pathogenesis.
The historic focus of phage investigation has been around the relationship between a phage and its target bacterium. However, it is also important to consider potential interactions between phage and the mucosa, epithelium, and immune system of the metazoan host. These interactions all play an important role in the overall response to intestinal phage infection. To demonstrate this, phages have been studied using germ-free (GF) mice to elucidate their impact on the immune system without interference by the microbiota8. In this system, phage nucleic acids were detected by Toll-like receptors (TLRs) located within endosomes of phagocytic immune cells (macrophages and dendritic cells). This activated downstream signaling and stimulated T cell dependent production of interferon (IFN)-&#947;8&#160;or type I IFNs18. Moreover, Fluckiger et al.19&#160;implicated memory CD8+ T cells in the recognition of phage-encoded (prophage) antigens, which resulted in T cell cross-reactivity with tumor antigens, resulting in reduced tumor burden. Finally, phage-specific antibody production has been documented in mouse studies where phages were delivered to animal models in a continual manner through drinking water8,20, or by repeated oral gavage over several months20, demonstrating the capacity for phage proteins to promote humoral immune responses. Although these modes of phage inoculation allow for optimal and continual priming of the immune system, they may not represent the naturally occurring interactions between phages and the intestinal environment, nor the kinetics of orally applied phage therapy. Thus far, a limited number of studies have examined the interactions of phage with a single bacterial species in monocolonized mouse models21. However, monocolonized mice proved critical in deciphering microbe-specific effects of individual species on gastrointestinal (GI) tract and immune development22,23,24, and they may yet prove useful in understanding tripartite interactions between phages, their target bacteria, and the metazoan host.
Excitingly, there is still much to learn about the interactions between intestinal phage and gut commensal bacteria, as well as the interactions that occur between the metazoan host and the phages that reside within it. This protocol provides a set of procedures to study isolated T4 phage and its&#160;bacterial counterpart, E. coli (K-12, BW25113), using a gnotobiotic mouse model. These standardized procedures also provide a foundation for optimizing other phage/bacteria dyads by adapting the growth parameters to the pairs of interest. The methods described here outline: (1) Preparation of T4 phage and vehicle lysates for oral gavage of mice; (2) Oral administration of T4 phage to E. coli monocolonized gnotobiotic mice; (3) Monitoring T4 phage levels in mouse feces and tissues over time.
For the representative results presented here, purified T4 phage lysates were propagated from phage bank stocks maintained by the Rohwer Lab. The Phage-on-Tap method for propagating T4 phage was adapted25, as referenced in this protocol. The method yields high titer, endotoxin-low phage stocks within three days. Utilizing this approach, 10 mL of &#8805; 1010&#160;plaque forming units (pfu)/mL of T4 phage with &#60; 0.5 endotoxin units (EU)/mL were&#160;routinely collected. The recommended endotoxin levels for oral or intravenous administration into mice are &#8804; 20 EU/mL and &#8804; 5 EU/kg/h (or 0.1 EU administered over 1 h for a 20 g mouse), respectively, making this a suitable method of phage preparation for in vivo inoculation. All phage stocks were stored at 4 &#176;C in saline magnesium (SM) phage buffer (recipe provided in step 1.1.5.1). E. coli was cultivated in LB media. For various phage-bacteria pairs, diverse culture media and growth conditions may be adapted from this protocol. Phages can also be sourced from the environment, such as wastewater, marine water, soil and intestinal contents and can be isolated and purified as per Sambrook and Russell26&#160;prior to preparation using the appropriate growth and propagation conditions for each phage-host pair of interest25. Alternatively, phages can be obtained from commercial sources (see Table of Materials) or from phage banks.

تسليط الضوء على المؤلف: التحقيق في الاستجابات المناعية التي تسببها البكتيريا في الفئران gnotobiotic

تفاعل البكتيريا T4 والإشريكية القولونية في أمعاء الفئران: نموذج نموذجي لدراسة ديناميكيات البكتيريا المضيفة في الجسم الحي

Our research aims to understand the tripartite interactions between bacteriophages bacteria and the mammalian immune system within the context of the gut, gnotobiotic mouse gut. We hope to gain insight into these interactions under health and disease conditions to better-understand the importance of the gut microbiome. Recent developments have found that bacteriophages can be detected by the mammalian immune system.It has been suggested that the human gut phageome may be dysregulated in disease conditions such as inflammatory bowel disorder, and immune stimulation by phages could exacerbate disease phenotypes. Our goal is to provide others with a standardized protocol for producing a T4 phage lysate for inoculation and enumeration in gnotobiotic mouse models. These protocols can be built upon and modified for use with other bacteriophage bacteria pairs.

للتحقيق في التفاعلات بين T4 phage / E. coli dyad في أمعاء الفئران ، تم تحضير وتنظيف وتنقية العاثية T4 ومحللات المركبات (الشكل 1 أ). تم معايرة محللات العاثية T4 بواسطة مقايسة البلاك وتخفيفها إلى 2 × 107 pfu / mL (2 × 106 pfu / mouse) في المخزن المؤقت SM. كما تم معايرة محللات المركبات لتأ?...

Watch this Scientific Journal Video about Author Spotlight: Investigating Bacteriophage-Induced Immune Responses in Gnotobiotic Mice at JoVE.com

البكتيريا (العاثيات) ، الفيروسات التي تصيب البكتيريا ، هي جزء لا يتجزأ من ميكروبيوم الأمعاء. على الرغم من أن هؤلاء السكان التكافليين يقودون اللياقة البكتيرية وديناميكيات السكان ، إلا أنه لا يفهم سوى القليل عن كيفية تأثيرها على توازن الأمعاء والمرض. يدرس هذا البروتوكول عاثيات T4 المعزولة داخل نموذج فأر ، قابلة للتكيف مع أزواج العاثيات البكتيرية الأخرى.

Bacteriophages (phages) are viruses that infect bacteria with species- and strain-level specificity and are the most abundant biological entities across ...

يهدف بحثنا إلى فهم التفاعلات الثلاثية بين بكتيريا البكتيريا والجهاز المناعي للثدييات في سياق الأمعاء ، أمعاء الفئران gnotobiotic. نأمل في الحصول على نظرة ثاقبة لهذه التفاعلات في ظل الظروف الصحية والمرضية لفهم أهمية ميكروبيوم الأمعاء بشكل أفضل. وقد وجدت التطورات الأخيرة أن البكتيريا يمكن اكتشافها من قبل الجهاز المناعي للثدييات.وقد اقترح أن البلعوم المعوي البشري قد يكون غير منظم في حالات مرضية مثل اضطراب الأمعاء الالتهابي ، والتحفيز المناعي بواسطة العاثيات يمكن أن يؤدي إلى تفاقم الأنماط الظاهرية للمرض. هدفنا هو تزويد الآخرين ببروتوكول موحد لإنتاج محللات العاثية T4 للتلقيح والتعداد في نماذج الفئران gnotobiotic. يمكن بناء هذه البروتوكولات وتعديلها للاستخدام مع أزواج البكتيريا البكتيرية الأخرى.

t4-bacteriophage-e-coli-interaction-murine-intestine-prototypical

Research

JoVE Journal

Immunology and Infection

T4 Bacteriophage and E. coli Interaction in the Murine Intestine: A Prototypical Model for Studying Host-Bacteriophage Dynamics In Vivo

1.0K Views.  University of British Columbia. يهدف بحثنا إلى فهم التفاعلات الثلاثية بين بكتيريا البكتيريا والجهاز المناعي للثدييات في سياق الأمعاء ، أمعاء الفئران gnotobiotic. نأمل في الحصول على نظرة ثاقبة لهذه التفاعلات في ظل الظروف الصحية والمرضية لفهم أهمية ميكروبيوم الأمعاء بشكل أفضل. وقد وجدت التطورات الأخيرة أن الب?...

Video: تسليط الضوء على المؤلف: التحقيق في الاستجابات المناعية التي تسببها البكتيريا في الفئران gnotobiotic

Bacteriophages (phages) are viruses that infect bacteria with species- and strain-level specificity and are the most abundant biological entities across all known ecosystems. Within bacterial communities, such as those found in the gut microbiota, phages are implicated in regulating microbiota population dynamics and driving bacterial evolution. There has been renewed interest in phage research in the last decade, in part due to the host-specific killing capabilities of lytic phages, which offer a promising tool to counter the increasing threat of antimicrobial resistant bacteria. Furthermore, recent studies demonstrating that phages adhere to intestinal mucus suggest they may have a protective role in preventing bacterial invasion into the underlying epithelium. Importantly, like bacterial microbiomes, disrupted phageomes have been associated with worsened outcomes in diseases such as inflammatory bowel disease. Previous studies have demonstrated that phages can modulate the microbiome of animals and humans through fecal filtrate transplants, benefiting the host&#39;s health. With this recent wave of research comes the necessity to establish and standardize protocols for studying phages in the context of the gut microbiome. This protocol provides a set of procedures to study isolated T4 phages and their bacterial host, Escherichia coli,&#160;in the context of the murine gastrointestinal tract. The methods described here outline&#160;how to start from a phage lysate, administer it to mice and assess effects on bacterial host and phage levels.&#160;This protocol can be modified and applied to other phage-bacterial pairs and provides a starting point for studying host-phage dynamics in vivo.

Bacteriophages (phages), viruses that infect bacteria, are an integral component of the gut microbiome. Though these symbiotic inhabitants drive bacterial fitness and population dynamics, little is understood about how they impact gut homeostasis and disease. This protocol studies isolated T4 phages within a mouse model, adaptable to other phage-bacterial pairs.