Name: combining x-ray crystallography with small angle x-ray scattering to model unstructured regions of nsa1 from s. cerevisiae
Uploaded: 2018-01-10T15:00:00
Description: Watch this Scientific Journal Video about Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae at JoVE.com

Diffraction data were collected at Southeast Regional Collaborative Access Team (SER-CAT) 22-ID and 22-BM beamlines at the Advanced Photon Source (APS), Argonne National Laboratory. The SAXS data was collected on the SIBYLS beamline at the Advance Light Source (ALS), Lawrence Berkeley National Laboratory. We would like to thank the staff at the SIBYLS beamline for their help with remote data collection and processing. We are grateful to the National Institute of Environmental Health Sciences (NIEHS) Mass Spectrometry Research and Support Group for help determining the protein domain boundaries. This work was supported by the US National Institute of Health Intramural Research Program; US National Institute of Environmental Health Sciences (NIEHS) (ZIA ES103247 to R. E. S.) and the Canadian Institutes of Health Research (CIHR, 146626 to M.C.P). Use of the APS was supported by the US Department of Energy, Office of Science, Office of Basic Energy Sciences under Contract No. W-31-109-Eng-38. Use of the Advanced Light Source (ALS) was supported by the Director, Office of Science, Office of Basic Energy Sciences, of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231. Additional support for the SIBYLS SAXS beamline comes from the National Institute of Health project MINOS (R01GM105404) and a High-End Instrumentation Grant S10OD018483. We would also like to thank Andrea Moon and Dr. Sara Andres for their critical reading of this manuscript.

1. Recombinant Protein Production and Purification of Nsa 1
<ol>
	<li>Nsa1 Expression Plasmid Design and Cloning
	<ol>
		<li>Obtain or purchase S. cerevisiae genomic DNA.</li>
		<li>PCR amplify the target sequences of Nsa1 (Nsa1FL, residues 1-463) and C-terminal truncated Nsa1 (Nsa1&#916;C, residues 1-434) with appropriate primers using genomic DNA isolated from S. cerevisiae and a melting temperature of approximately 60 &#176;C with an extension time of 1-2 min. The following pr...

Using this protocol, recombinant Nsa1 from S. cerevisiae was generated for structural studies by both X-ray crystallography and SAXS. Nsa1 was well-behaved in solution and crystallized in multiple crystal forms. During the optimization of these crystals, it was discovered that the C-terminus of Nsa1 was sensitive to protease degradation. The high resolution, orthorhombic crystal form could only be duplicated with C-terminal truncation variants of Nsa1, likely because the flexible C-terminus of Nsa1 prevented cry...

Ribosomes are large ribonucleoprotein machines that carry out the essential role of translating mRNA into proteins in all living cells. Ribosomes are composed of two subunits which are produced in a complex process termed ribosome biogenesis1,2,3,4. Eukaryotic ribosome assembly relies on the aid of hundreds of essential ribosomal assembly factors2,3,5. Nsa1 (Nop7 associated 1) is a eukaryotic ribosome assembly factor that is specifically required for the production of the large ribosomal subunit6, and is known as WD-repeat containing 74 (WDR74) in higher organisms7. WDR74 has been shown to be required for blastocyst formation in mice8and the WDR74 promoter is frequently mutated in cancer cells9. However, the function and precise mechanisms of Nsa1/WDR74 in ribosome assembly are still largely unknown. To begin to uncover the role of Nsa1/WDR74 during eukaryotic ribosome maturation, multiple structural analyses were performed, including X-ray crystallography and small angle X-ray scattering (SAXS)10.
X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, electron microscopy, and SAXS are all important techniques for studying macromolecular structure. Size, shape, availability, and stability of macromolecules influences the structural biology method for which a particular macromolecule will be best suited, however combining multiple techniques through a so-called &#34;hybrid&#34; approach is becoming an increasingly beneficial tool11. In particular X-ray crystallography and SAXS are powerful and complementary methods for structural determination of macromolecules12.
Crystallography provides high-resolution atomic structures ranging from small molecules to large cellular machinery such as the ribosome, and has led to numerous breakthroughs in the understanding of the biological functions of proteins and other macromolecules13. Furthermore, structure-based drug design harnesses the power of crystal structures for molecular docking by computational methods, adding a critical dimension to drug discovery and development14. Despite its broad applicability, flexible and disordered systems are challenging to assess by crystallography since crystal packing can be hindered or electron density maps may be incomplete or of poor quality. Conversely, SAXS is a solution-based and low-resolution structural approach capable of describing flexible systems ranging from disordered loops and termini to intrinsically disordered proteins12,15,16. Considering it is compatible with a broad range of particle sizes12, SAXS can work synergistically with crystallography to expand the range of biological questions that can be addressed by structural studies.
Nsa1 is suitable for a hybrid structural approach because it contains a well-structured WD40 domain followed by a functional, but flexible C-terminus which is not amenable to X-ray crystallography methods. Following is a protocol for the cloning, expression, and purification of S. cerevisiae Nsa1 for hybrid structural determination by X-ray crystallography and SAXS. This protocol can be adapted to study the structures of other proteins that are comprised of a combination of ordered and disordered regions.

<table>
	<tbody>
		<tr>
			<td>Molecular Cloning of Nsa1</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pMBP2 parallel vector</td>
			<td>Sheffield et al, Protein Expression and Purification 15, 34-39 (1999)</td>
			<td></td>
			<td>We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)</td>
		</tr>
		<tr>
			<td>S. cerevisiae genomic DNA</td>
			<td>ATCC</td>
			<td>204508D-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers for cloning Nsa1</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SC_Nsa1_FLFw</td>
			<td>IDT</td>
			<td></td>
			<td>CGC CAA AGG CCT 
			ATGAGGTTACTAGTCAGCTGTGT 
			GGATAG</td>
		</tr>
		<tr>
			<td>SC_Nsa1_FLRv</td>
			<td>IDT</td>
			<td></td>
			<td>AATGCAGCGGCCGCTCAAATTTT 
			GCTTTTCTTACTGGCTTTAGAAGC 
			AGC</td>
		</tr>
		<tr>
			<td>SC_Nsa1_DeltaCFw</td>
			<td>IDT</td>
			<td></td>
			<td>GGGCGCCATGGGATCCATGAGG 
			TTACTAGTCAGCTGTGTGG</td>
		</tr>
		<tr>
			<td>SC_Nsa1_DeltaCRv</td>
			<td>IDT</td>
			<td></td>
			<td>GATTCGAAAGCGGCCGCTTAAAC 
			CTTCCTTTTTTGCTTCCC</td>
		</tr>
		<tr>
			<td>Recombinant Protein Production and Purification of Nsa1</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Escherichia coli BL21 (DE3) Star Cells</td>
			<td>Invitrogen</td>
			<td>C601003</td>
			<td></td>
		</tr>
		<tr>
			<td>pMBP- NSA1 and various truncations</td>
			<td>Lo et al., 2017</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Selenomethionine</td>
			<td>Molecular Dimensions</td>
			<td>MD12-503B</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG, Dioxane-Free</td>
			<td>Promega</td>
			<td>V3953</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA Free Protease Inhibitor Cocktail</td>
			<td>Sigma-Aldrich</td>
			<td>4693159001</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Chloride</td>
			<td>Caledon Laboratory Chemicals</td>
			<td>7560-1-80</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium Chloride hexahydrate</td>
			<td>Sigma-Aldrich</td>
			<td>M2670</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris Buffer, 1 M pH7.5</td>
			<td>KD Medical</td>
			<td>RGF-3340</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Invitrogen</td>
			<td>15514-029</td>
			<td></td>
		</tr>
		<tr>
			<td>beta-mercaptoethanol</td>
			<td>Sigma</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>1M Imidazole, pH 8.0</td>
			<td>Teknova</td>
			<td>I6980-06</td>
			<td></td>
		</tr>
		<tr>
			<td>Talon Affinity Resin</td>
			<td>Clonetech</td>
			<td>635503</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K)</td>
			<td>Millipore</td>
			<td>UFC901024</td>
			<td></td>
		</tr>
		<tr>
			<td>HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column</td>
			<td>GE-Healthcare</td>
			<td>28989335</td>
			<td></td>
		</tr>
		<tr>
			<td>TEV Protease</td>
			<td>Prepared by NIEHS Protein Expression Core</td>
			<td>Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)</td>
			<td></td>
		</tr>
		<tr>
			<td>4-15% Mini-PROTEAN TGX Precast Protein Gels</td>
			<td>BioRad</td>
			<td>456-8056</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystallization, Proteolytic Screening</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Screen</td>
			<td>Hampton Research</td>
			<td>HR2-110</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Screen 2</td>
			<td>Hampton Research</td>
			<td>HR2-112</td>
			<td></td>
		</tr>
		<tr>
			<td>Salt Rx</td>
			<td>Hampton Research</td>
			<td>HR2-136</td>
			<td></td>
		</tr>
		<tr>
			<td>Index&#160; Screen</td>
			<td>Hampton Research</td>
			<td>HR2-144</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG/Ion Screen</td>
			<td>Hampton Research</td>
			<td>HR2-139</td>
			<td></td>
		</tr>
		<tr>
			<td>JCSG+</td>
			<td>Molecular Dimensions</td>
			<td>MD1-37</td>
			<td></td>
		</tr>
		<tr>
			<td>Wizard Precipitant Synergy&#160;</td>
			<td>Molecular Dimensions</td>
			<td>MD15-PS-T</td>
			<td></td>
		</tr>
		<tr>
			<td>Swissci 96-well 3-drop UVP sitting drop plates</td>
			<td>TTP Labtech</td>
			<td>4150-05823</td>
			<td></td>
		</tr>
		<tr>
			<td>3inch Wide Crystal Clear Sealing Tape</td>
			<td>Hampton Research</td>
			<td>HR4-506</td>
			<td></td>
		</tr>
		<tr>
			<td>Proti-Ace Kit</td>
			<td>Hampton Research</td>
			<td>HR2-429</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG 1500</td>
			<td>Molecular Dimensions</td>
			<td>MD2-100-6</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG 400</td>
			<td>Molecular Dimensions</td>
			<td>MD2-100-3</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES/sodium hydroxide pH 7.5</td>
			<td>Molecular Dimensions</td>
			<td>MD2-011-</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Citrate tribasic</td>
			<td>Molecular Dimensions</td>
			<td>MD2-100-127</td>
			<td></td>
		</tr>
		<tr>
			<td>22 mm x 0.22 mm Siliconized Coverslides</td>
			<td>Hampton Research</td>
			<td>HR3-231</td>
			<td></td>
		</tr>
		<tr>
			<td>24 Well Plates with sealant (VDX Plate with Sealant)</td>
			<td>Hampton Research</td>
			<td>HR3-172</td>
			<td></td>
		</tr>
		<tr>
			<td>&#160;18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM)</td>
			<td>Hampton Research</td>
			<td>HR4-945, HR4-947, HR4-970, HR4-971</td>
			<td></td>
		</tr>
		<tr>
			<td>Seed Bead Kit</td>
			<td>Hampton Research</td>
			<td>HR2-320</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Crystal Caps</td>
			<td>Hampton Research</td>
			<td>HR4-779</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Cryo Wand</td>
			<td>Hampton Research</td>
			<td>HR4-729</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryogenic Foam Dewar</td>
			<td>Hampton Research</td>
			<td>HR4-673</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Puck System</td>
			<td>MiTeGen</td>
			<td>M-CP-111-021</td>
			<td></td>
		</tr>
		<tr>
			<td>Full Skirt 96 well Clear Plate</td>
			<td>VWR</td>
			<td>10011-228</td>
			<td></td>
		</tr>
		<tr>
			<td>AxyMat Sealing Mat</td>
			<td>VWR</td>
			<td>10011-130</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>UVEX-m</td>
			<td>JAN Scientific, Inc.</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nanodrop Lite Spectrophotometer</td>
			<td>Thermo-Fisher</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Mosquito Robot</td>
			<td>TTP Labtech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Software/Websites</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HKL2000</td>
			<td>Otwinoski and Minor, 1997</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Phenix</td>
			<td>Adams et al., 2010</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Coot</td>
			<td>Emsley et al., 2010</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ATSAS</td>
			<td>Petoukhov et al., 2012</td>
			<td></td>
			<td>https://www.embl-hamburg.de/biosaxs/atsas-online/</td>
		</tr>
		<tr>
			<td>Scatter</td>
			<td>Rambo and Tainer, 2013</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pymol</td>
			<td>The PyMOL Molecular Graphics System, Version 1.8 Schr&#246;dinger, LLC.</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BUNCH</td>
			<td>Petoukhov and Svergun, 2005</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CRYSOL</td>
			<td>Svergun et al, 1995</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PRIMUS</td>
			<td>Konarev et al, 2003</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>EOM</td>
			<td>Tria et al, 2015</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

combining x-ray crystallography with small angle x-ray scattering to model unstructured regions of nsa1 from s. cerevisiae

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the disordered and protease labile C-terminus of the protein. This manuscript describes the methods to purify recombinant Nsa1 from S. cerevisiae for structural analysis by both X-ray crystallography and SAXS. X-ray crystallography was utilized to solve the structure of the well-ordered N-terminal WD40 domain of Nsa1, and then SAXS was used to resolve the structure of the C-terminus of Nsa1 in solution. Solution scattering data was collected from full-length Nsa1 in solution. The theoretical scattering amplitudes were calculated from the high-resolution crystal structure of the WD40 domain, and then a combination of rigid body and ab initio modeling revealed the C-terminus of Nsa1. Through this hybrid approach the quaternary structure of the entire protein was reconstructed. The methods presented here should be generally applicable for the hybrid structural determination of other proteins composed of a mix of structured and unstructured domains.

Nsa1 was PCR amplified from S. cerevisiae genomic DNA and subcloned into a vector containing an N-terminal 6x-Histidine affinity tag followed by MBP and a TEV protease site. Nsa1 was transformed into E. coli BL21(DE3) cells and high yields of protein expression were obtained following induction with IPTG and growth at 25 &#176;C overnight (Figure 1A). Nsa1 was affinity-purified on immobilized cobalt affinity resin, followed by MBP cleavage w...

Watch this Scientific Journal Video about Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae at JoVE.com

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

This method describes the cloning, expression, and purification of recombinant Nsa1 for structural determination by X-ray crystallography and small-angle X-ray scattering (SAXS), and is applicable for the hybrid structural analysis of other proteins containing both ordered and disordered domains.

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the ...

The overall goal of this procedure is to produce a recombinant protein that is composed of a mixture of ordered and disordered domains for hybrid structural analysis by both x-ray crystallography and small angle x-ray scattering. This method can help to answer key questions in structural biology about putting biological function so that the determination of all solutions stay structure of protein. The main advantage of this technique is that it can be used to model dynamic regions of a protein or macro-molecule that cannot be resolved by x-ray crystallography.Generally, individuals new to this method will struggle at the beginning with learning how to properly assess the quality of their SAXS data. To begin the procedure, transform an Nsa1 expression plasmid into a suitable E.coli expression strain. Culture the cells, induce Nsa1 expression, and harvest the cells.Resuspend the cells in 25 milliliters of lysis buffer, pre-chill to four degrees Celsius, containing one EDTA-free protease inhibitor tablet. Sonicate the cells at four degrees Celsius for seven minutes, with a cycle of two seconds on, two seconds off. Then, centrifuge the lysate at 26, 900 times gravity for 45 minutes at four degrees Celsius.Ensure that the mixture does not freeze during centrifugation. Next, equilibrate a gravity flow column containing 10ml of immobilized cobalt affinity resin with lysis buffer. Load the clarified lysate onto the column and allow it to flow through the resin at four degrees Celsius.Then, wash the resin twice with 100ml portions of lysis buffer. Elute Nsa1 from the column with 20ml of elution buffer. Run a 15mcl aliquot of the eluere on a four to 15%SDS-PAGE gel to confirm the elution of the protein.Then, add 1ml of the 1mg/ml TEV protease stock solution to the eluere. Incubate the eluere at four degrees Celsius overnight to remove the MBP tag. Then, use a 10 kilodalton centrifugal filter unit to concentrate the MBP-cleaved Nsa1 to about 5ml, being careful not to over-concentrate.Purify the concentrated protein on a gel filtration column pre-equilibrated with Buffer A.One of the critical steps in this procedure is ensuring you remove all aggregates during the purification. Aggregates will interfere with crystallization and SAXS data acquisition and analyses. Analyze 15mcl samples from each column fraction with SDS-PAGE to confirm the separation of MBP from Nsa1.Combine the Nsa1 containing fractions. Use a 10 kilodalton centrifugal filter unit to concentrate the combined fractions to about 8mg/ml. Measure the absorbance at 289 nanometers and calculate the protein concentration.Immediately proceed to proteolytic screening and crystallization trials. To begin the proteolytic screening, prepare 1mg/ml stock solutions of Alpha-comotrypsin, trypsin, elastase, capayin, septilisin, and Endoproteinase GluC. Dilute each stock solution with dilution buffer to 1:10, 1:100, and 1:1, 000.Dilute the 8mg/ml solution of Nsa1 to 1mg/ml with Buffer A.Then, for each protease dilution, combine 1mcl of the protease dilution with 9mcl of the diluted protein stock. Incubate the solutions at 37 degrees Celsius for one hour. Then, add 10mcl of 2x SDS-PAGE sample to buffer to each solution and heat the solutions at 95 degrees Celsius for five minutes.Run the solutions on a four to 15%SDS-PAGE gel to identify protease resistant domains. Create truncated expression constructs that exclude protease labile regions. Express and purify these proteins for crystallization optimization.After acquiring SAXS data for the Nsa1 protein over a range of concentrations, set the terminal shell file path to the directory containing the data. Then, launch the analysis software. Load the scattering curves into the analysis software.Use the auto RG tool to determine the radius of gyration and the forward-scattering intensity for each curve. Then, generate Kratky plots for each scattering curve to determine the degree of compactness. Use the autonome tool to calculate the pair-wise distribution function for each curve, using a starting maximum dimension of 3x the radius of gyration.Optimize the maximum dimension to obtain a smooth, pair-wise distribution function curve that is consistent with the experimental scattering curve. Compare the structural parameters across concentrations to verify the absence of radiation damage or concentration-dependent effects. It is critical to compare key structural parameters, including radius of gyration, molecular mass, forward scattering and pair distance distribution functions across a concentration series.And that's to ensure there's no radiation damage or concentration effects. Next, run the ensemble optimization method utility using the starting protein crystal structure file, the target protein sequence file, and the experimental SAXS data file. Compare the chi squared values from the starting crystal structure file to the ensemble file to determine whether the ensemble model fits the experimental data well.Use molecular visualization software to overlay the crystal structure with the generated conformers. Note the total number of conformers and the fraction of occupancy for each conformer contributing to the scattering curve. Proteolytic cleavage of the protease labile C terminus of Nsa1 resulted in the formation of orthorhombic crystals.The freshly purified Nsa1 formed cubic crystals, but the crystal structure still lacked electron density for the labile c terminus. The n-terminal seven blated beta propeller WD-40 domain of Nsa1 was well-resolved in both structures. The Nsa1 WD-40 domain alone was not a good fit for the experimental SAXS data.A combination of rigid-body modeling and abinitial reconstruction of the C terminus significantly improved the goodness of fit. Ensemble modeling provided an even greater improvement in goodness of fit, revealing the confirmational sampling of the C-terminal tail in solution. While SAXS is a low-resolution structural technique, it compliments very well high-resolution structural studies, like x-ray crystallography.So you can model flexible and disordered regions. By collecting and analyzing SAXS data of macromolecule, you can begin to understand confirmational change that occurred upon After watching this video, you should have a good understanding of how to solve the structure of a protein composed of ordered and disordered regions by both x-ray crystallography and SAXS.

combining-x-ray-crystallography-with-small-angle-x-ray-scattering-to

Research

JoVE Journal

Biochemistry

Characterization of Glycoproteins with the Immunoglobulin Fold by X-Ray Crystallography and Biophysical Techniques

Glycoproteins on the surface of cells play critical roles in cellular function, including signalling, adhesion and transport. On leukocytes, several of these glycoproteins possess immunoglobulin (Ig) folds and are central to immune recognition and regulation. Here, we present a platform for the design, expression and biophysical characterization of the extracellular domain of human B cell receptor CD22. We propose that these approaches are broadly applicable to the characterization of mammalian glycoprotein ectodomains containing Ig domains. Two suspension human embryonic kidney (HEK) cell lines, HEK293F and HEK293S, are used to express glycoproteins harbouring complex and high-mannose glycans, respectively. These recombinant glycoproteins with different glycoforms allow investigating the effect of glycan size and composition on ligand binding. We discuss protocols for studying the kinetics and thermodynamics of glycoprotein binding to biologically relevant ligands and therapeutic antibody candidates. Recombinant glycoproteins produced in HEK293S cells are amenable to crystallization due to glycan homogeneity, reduced flexibility and susceptibility to endoglycosidase H treatment. We present methods for soaking glycoprotein crystals with heavy atoms and small molecules for phase determination and analysis of ligand binding, respectively. The experimental protocols discussed here hold promise for the characterization of mammalian glycoproteins to give insight into their function and investigate the mechanism of action of therapeutics.

We present approaches for the biophysical and structural characterization of glycoproteins with the immunoglobulin fold by biolayer interferometry, isothermal titration calorimetry, and X-ray crystallography.

Glycoproteins on the surface of cells play critical roles in cellular function, including signalling, adhesion and transport. On leukocytes, several of ...

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the investigation of biological materials, biofuel processing, and bio-inspired materials covering nanometer to micrometer length scales. The methods presented here for investigating physical properties (i.e., size and shape) of membrane proteins (here, MmIAP, an intramembrane aspartyl protease from Methanoculleus marisnigri) in solutions of micelle-forming detergents are well-suited for this small-angle neutron scattering instrument, among others. Other biophysical characterization techniques are hindered by their inability to address the detergent contributions in a protein-detergent complex structure. Additionally, access to the Bio-Deuteration Lab provides unique capabilities for preparing large-scale cultivations and expressing deuterium-labeled proteins for enhanced scattering signal from the protein. While this technique does not provide structural details at high-resolution, the structural knowledge gap for membrane proteins contains many addressable areas of research without requiring near-atomic resolution. For example, these areas include determination of oligomeric states, complex formation, conformational changes during perturbation, and folding/unfolding events. These investigations can be readily accomplished through applications of this method.

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

This protocol demonstrates how to obtain a low-resolution ab initio model and structural details of a detergent-solubilized membrane protein in solution using small-angle neutron scattering with contrast-matching of the detergent.

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the ...

Structural Studies of Macromolecules in Solution using Small Angle X-Ray Scattering

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and how the domains are oriented/positioned. Here, a protocol with the potential for elucidating which specific domains mediate interactions in multicomponent system through ab initio modeling is described. A method for calculating solution structures of macromolecules and their assemblies is provided that involves integrating data from small angle X-ray scattering (SAXS), chromatography, and atomic resolution structures together in a hybrid approach. A specific example is that of the complex of full-length nidogen-1, which assembles extracellular matrix proteins and forms an extended, curved nanostructure. One of its globular domains attaches to laminin &#947;-1, which structures the basement membrane. This provides a basis for determining accurate structures of flexible multidomain protein complexes and is enabled by synchrotron sources coupled with automation robotics and size exclusion chromatography systems. This combination allows rapid analysis in which multiple oligomeric states are separated just prior to SAXS data collection. The analysis yields information on the radius of gyration, particle dimension, molecular shape and interdomain pairing. The protocol for generating 3D models of complexes by fitting high-resolution structures of the component proteins is also given.

Here, we present how Small Angle X-Ray Scattering (SAXS) can be utilized to obtain information on low-resolution envelopes representing the macromolecular structures. When used in conjunction with high-resolution structural techniques such as X-Ray Crystallography and Nuclear Magnetic Resonance, SAXS can provide detailed insights into multidomain proteins and macromolecular complexes in-solution.

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and ...

Ion Exchange Chromatography (IEX) Coupled to Multi-angle Light Scattering (MALS) for Protein Separation and Characterization

Ion-exchange chromatography with multi-angle light scattering (IEX-MALS) is a powerful method for protein separation and characterization. The combination of the high-specificity separation technique IEX with the accurate molar mass analysis achieved by MALS allows the characterization of heterogeneous protein samples, including mixtures of oligomeric forms or protein populations, even with very similar molar masses. Therefore, IEX-MALS provides an additional level of protein characterization and is complementary to the standard size-exclusion chromatography with multi-angle light scattering (SEC-MALS) technique.
Here we describe a protocol for a basic IEX-MALS experiment and demonstrate this method on bovine serum albumin (BSA). IEX separates BSA to its oligomeric forms allowing a molar mass analysis by MALS of each individual form. Optimization of an IEX-MALS experiment is also presented and demonstrated on BSA, achieving excellent separation between BSA monomers and larger oligomers. IEX-MALS is a valuable technique for protein quality assessment since it provides both fine separation and molar mass determination of multiple protein species that exist in a sample.

Ion Exchange Chromatography IEX Coupled to Multi-angle Light Scattering MALS for Protein Separation and Characterization

This protocol describes the use of high-specificity ion-exchange chromatography with multi-angle light scattering for an accurate molar mass determination of proteins, protein complexes, and peptides in a heterogeneous sample. This method is valuable for quality assessment, as well as for the characterization of native oligomers, charge variants, and mixed-protein samples.

Ion-exchange chromatography with multi-angle light scattering (IEX-MALS) is a powerful method for protein separation and characterization. The combination ...

Characterization of Proteins by Size-Exclusion Chromatography Coupled to Multi-Angle Light Scattering (SEC-MALS)

Analytical size-exclusion chromatography (SEC), commonly used for the determination of the molecular weight of proteins and protein-protein complexes in solution, is a relative technique that relies on the elution volume of the analyte to estimate molecular weight. When the protein is not globular or undergoes non-ideal column interactions, the calibration curve based on protein standards is invalid, and the molecular weight determined from elution volume is incorrect. Multi-angle light scattering (MALS) is an absolute technique that determines the molecular weight of an analyte in solution from basic physical equations. The combination of SEC for separation with MALS for analysis constitutes a versatile, reliable means for characterizing solutions of one or more protein species including monomers, native oligomers or aggregates, and heterocomplexes. Since the measurement is performed at each elution volume, SEC-MALS can determine if an eluting peak is homogeneous or heterogeneous and distinguish between a fixed molecular weight distribution versus dynamic equilibrium. Analysis of modified proteins such as glycoproteins or lipoproteins, or conjugates such as detergent-solubilized membrane proteins, is also possible. Hence, SEC-MALS is a critical tool for the protein chemist who must confirm the biophysical properties and solution behavior of molecules produced for biological or biotechnological research. This protocol for SEC-MALS analyzes the molecular weight and size of pure protein monomers and aggregates. The data acquired serve as a foundation for further SEC-MALS analyses including those of complexes, glycoproteins and surfactant-bound membrane proteins.

Characterization of Proteins by Size-Exclusion Chromatography Coupled to Multi-Angle Light Scattering SEC-MALS

This protocol describes the combination of size exclusion chromatography with multi-angle light scattering (SEC-MALS) for absolute characterization of proteins and complexes in solution. SEC-MALS determines the molecular weight and size of pure proteins, native oligomers, heterocomplexes and modified proteins such as glycoproteins.

Analytical size-exclusion chromatography (SEC), commonly used for the determination of the molecular weight of proteins and protein-protein complexes in ...

An All-in-one Sample Holder for Macromolecular X-ray Crystallography with Minimal Background Scattering

Macromolecular X-ray crystallography (MX) is the most prominent method to obtain high-resolution three-dimensional knowledge of biological macromolecules. A prerequisite for the method is that highly ordered crystalline specimen need to be grown from the macromolecule to be studied, which then need to be prepared for the diffraction experiment. This preparation procedure typically involves removal of the crystal from the solution, in which it was grown, soaking of the crystal in ligand solution or cryo-protectant solution and then immobilizing the crystal on a mount suitable for the experiment. A serious problem for this procedure is that macromolecular crystals are often mechanically unstable and rather fragile. Consequently, the handling of such fragile crystals can easily become a bottleneck in a structure determination attempt. Any mechanical force applied to such delicate crystals may disturb the regular packing of the molecules and may lead to a loss of diffraction power of the crystals. Here, we present a novel all-in-one sample holder, which has been developed in order to minimize the handling steps of crystals and hence to maximize the success rate of the structure determination experiment. The sample holder supports the setup of crystal drops by replacing the commonly used microscope cover slips. Further, it allows in-place crystal manipulation such as ligand soaking, cryo-protection and complex formation without any opening of the crystallization cavity and without crystal handling. Finally, the sample holder has been designed in order to enable the collection of in situ X-ray diffraction data at both, ambient and cryogenic temperature. By using this sample holder, the chances to damage the crystal on its way from crystallization to diffraction data collection are considerably reduced since direct crystal handling is no longer required.

A novel sample holder for macromolecular X-ray crystallography along with a suitable handling protocol is presented. The system allows crystal growth, crystal soaking and in situ diffraction data collection at both, ambient and cryogenic temperature without the need of any crystal manipulation or mounting.

Macromolecular X-ray crystallography (MX) is the most prominent method to obtain high-resolution three-dimensional knowledge of biological macromolecules. ...

Cell Culture on Silicon Nitride Membranes and Cryopreparation for Synchrotron X-ray Fluorescence Nano-analysis

Very little is known about the distribution of metal ions at the subcellular level. However, those chemical elements have essential regulatory functions and their disturbed homeostasis is involved in various diseases. State-of-the-art synchrotron X-ray fluorescence nanoprobes provide the required sensitivity and spatial resolution to elucidate the two-dimensional (2D) and three-dimensional (3D) distribution and concentration of metals inside entire cells at the organelle level. This opens new exciting scientific fields of investigation on the role of metals in the physiopathology of the cell. The cellular preparation is a key and often complex procedure, particularly for basic analysis. Although X-ray fluorescence techniques are now widespread and various preparation methods have been used, very few studies have investigated the preservation of the elemental content of cells at best, and no stepwise detailed protocol for the cryopreparation of adherent cells for X-ray fluorescence nanoprobes has been released so far. This is a description of a protocol that provides the stepwise cellular preparation for fast cryofixation to enable synchrotron X-ray fluorescence nano-analysis of cells in a frozen hydrated state when a cryogenic environment and transfer is available. In case nano-analysis has to be performed at room temperature, an additional procedure for freeze-drying the cryofixed adherent cellular preparation is provided. The proposed protocols have been successfully used in previous works, most recently in studying the 2D and 3D intracellular distribution of an organometallic compound in breast cancer cells.

Presented here is a protocol for cell culture on silicon nitride membranes and plunge-freezing prior to X-ray fluorescence imaging with a synchrotron cryogenic X-ray nanoprobe. When only room temperature nano-analysis is provided, the frozen samples can be further freeze-dried. These are critical steps to obtain information on the intracellular elemental composition.

Very little is known about the distribution of metal ions at the subcellular level. However, those chemical elements have essential regulatory functions ...

X-Ray Crystallography to Study the Oligomeric State Transition of the Thermotoga maritima M42 Aminopeptidase TmPep1050

The M42 aminopeptidases form functionally active complexes made of 12 subunits. Their assembly process appears to be regulated by their metal ion cofactors triggering a dimer-dodecamer transition. Upon metal ion binding, several structural modifications occur in the active site and at the interaction interface, shaping dimers to promote the self-assembly. To observe such modifications, stable oligomers must be isolated prior to structural study. Reported here is a method that allows the purification of stable dodecamers and dimers of TmPep1050, an M42 aminopeptidase of T. maritima, and their structure determination by X-ray crystallography. Dimers were prepared from dodecamers by removing metal ions with a chelating agent. Without their&#160;cofactor, dodecamers became less stable and were fully dissociated upon heating. The oligomeric structures were solved by the straightforward molecular replacement approach. To illustrate the methodology, the structure of a TmPep1050 variant, totally impaired in metal ion binding, is presented showing no further breakdown of dimers to monomers.

X-Ray Crystallography to Study the Oligomeric State Transition of the Thermotoga maritima M42 Aminopeptidase TmPep1050

This protocol has been developed to study the dimer-dodecamer transition of TmPep1050, an M42 aminopeptidase, at the structural level. It is a straightforward pipeline starting from protein purification to X-ray data processing. Crystallogenesis, data set indexation, and molecular replacement have been emphasized through a case of study, TmPep1050H60A H307A variant.

The M42 aminopeptidases form functionally active complexes made of 12 subunits. Their assembly process appears to be regulated by their metal ion ...

Fixed Target Serial Data Collection at Diamond Light Source

Serial data collection is a relatively new technique for synchrotron users. A user manual for fixed target data collection at I24, Diamond Light Source is presented with detailed step-by-step instructions, figures, and videos for smooth data collection.

We present a comprehensive guide to fixed target sample preparation, data collection, and data processing for serial synchrotron crystallography at Diamond beamline I24.

Serial data collection is a relatively new technique for synchrotron users. A user manual for fixed target data collection at I24, Diamond Light Source is ...

Motility of Single Molecules and Clusters of Bi-Directional Kinesin-5 Cin8 Purified from S. cerevisiae Cells

The mitotic bipolar kinesin-5 motors perform essential functions in spindle dynamics. These motors exhibit a homo-tetrameric structure with two pairs of catalytic motor domains, located at opposite ends of the active complex. This unique architecture enables kinesin-5 motors to crosslink and slide apart antiparallel spindle microtubules (MTs), thus providing the outwardly-directed force that separates the spindle poles apart. Previously, kinesin-5 motors were believed to be exclusively plus-end directed. However, recent studies revealed that several fungal kinesin-5 motors are minus-end directed at the single-molecule level and can switch directionality under various experimental conditions. The Saccharomyces cerevisiae kinesin-5 Cin8 is an example of such bi-directional motor protein: in high ionic strength conditions single molecules of Cin8 move in the minus-end direction of the MTs. It was also shown that Cin8 forms motile clusters, predominantly at the minus-end of the MTs, and such clustering allows Cin8 to switch directionality and undergo slow, plus-end directed motility. This article provides a detailed protocol for all steps of working with GFP-tagged kinesin-5 Cin8, from protein overexpression in S. cerevisiae cells and its purification to in vitro single-molecule motility assay. A newly developed method described here helps to differentiate between single molecules and clusters of Cin8, based on their fluorescence intensity. This method enables separate analysis of motility of single molecules and clusters of Cin8, thus providing the characterization of the dependence of Cin8 motility on its cluster size.

Motility of Single Molecules and Clusters of Bi-Directional Kinesin-5 Cin8 Purified from S. cerevisiae Cells

The bi-directional mitotic kinesin-5 Cin8 accumulates in clusters that split and merge during their motility. Accumulation in clusters also changes the velocity and directionality of Cin8. Here, a protocol for motility assays with purified Cin8-GFP and analysis of motile properties of single molecules and clusters of Cin8 is described.

The mitotic bipolar kinesin-5 motors perform essential functions in spindle dynamics. These motors exhibit a homo-tetrameric structure with two pairs of ...