Name: bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses
Uploaded: 2015-12-29T13:00:00.000+00:00
Duration: 12 min 20 s
Description: Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

Das aktuelle Protokoll wurde erfolgreich verwendet, um Volllängen-infektiöse cDNA-Klone für zwei verschiedene Stämme (CNU / LP2 27 und SA 14 -14-2 28) des JEV, einem Flavivirus, deren funktionelle cDNA hat sich als von Natur aus schwierig zu konstruieren und zu erzeugen, ausbreiten, weil Wirtszelltoxizität und die genetische Instabilität der klonierten cDNA 8,74-76 Dieses Protokoll besteht aus drei Hauptkomponenten:. erste und maximiert die Synthese / Amplifikation einer cDNA getreue Kopie der viralen RNA unter Verwendung von High-Fidelity-Reverse Transkriptase / DNA-Polymerase; Zweitens Klonieren des viralen prM-E kodierenden Region mit toxischen Sequenzen (unveröffentlichte Daten) 74,77,78 in sehr geringer Kopienzahlvektor BAC von der anfänglichen cDNA Subklonieren der endgültigen cDNA mit voller Länge Montageschritte; und drittens, die Verwendung eines Klonierungsvektors BAC, die eine Fremd-DNA mit einer durchschnittlichen Größe von 120-350 kb, 19-21, die offensichtlich toleriert größere DNA inse aufnehmen kannrts als andere Klonierungsvektoren. Diese Klonierungsansatz im allgemeinen auf viele andere Positiv-Strang-RNA-Viren, insbesondere solchen mit einem großen RNA-Genom von ca. 10 bis 32 kb. Erzeugung eines infektiösen cDNA-Klon ist ein wichtiger Schritt bei der Entwicklung einer reversen Genetik System für RNA-Viren, insbesondere bei Positiv-Strang-RNA-Viren, da das Genom wirkt als virale mRNA, die von Wirtszellen Ribosomen in Proteine ​​übersetzt wird. Somit kann die virale Replikation durch die Einführung einer cDNA-abgeleitete Genomlänge RNA-Moleküls in einer empfänglichen Wirtszelle eingeleitet werden. Die Verfügbarkeit eines infektiösen JEV cDNA-Klon, wenn sie mit rekombinanter DNA-Technologie kombiniert wird, hat das Verständnis der verschiedenen Aspekte der Lebenszyklus des Virus auf molekularer Ebene wie Genexpression 73,79 und die Genomreplikation 63,64 erhöht. Außerdem ist ein Volllängen-JEV cDNA-Klon hat sich als ein wertvolles Werkzeug für die Entwicklung von antiviralen Impfstoffen 28 und Genübertragungsvektoren können. &lt;sup&gt; 80,81 Wie bei allen Positivstrang-RNA-Viren gibt es mehrere wichtige Schritte bei der Konstruktion eines zuverlässigen Funktions cDNA für JEV, aus dem hochinfektiösen RNAs können in vitro synthetisiert werden. Idealerweise sollte die Sequenz der synthetischen RNAs aus einem Klon der Volllängen-cDNA transkribiert identisch sein zu derjenigen der genomischen Virus-RNA, insbesondere die 5&#39;- und 3&#39;-terminalen Sequenzen, die für die Initiation der viralen RNA-Replikation erforderlich sind, . 60-62 In der aktuellen Protokolls der authentische 5&#39;-und 3&#39;-Enden wurden durch Anordnen der SP6-Promotorsequenz stromaufwärts des ersten Adeninnucleotid des viralen Genoms und Positionieren einer einzigartigen künstlichen Xba I-Restriktionsstelle stromabwärts des letzten sichergestellt Thymin Nukleotid des viralen Genoms sind. Capped synthetischen RNAs mit der authentischen 5 &#39;und 3&#39;-Enden wurden durch Run-off-Transkription einer Xba I-linearisiert und MBN behandelten cDNA te hergestelltmplate mit SP6 RNA-Polymerase mit der m 7 G (5 &#39;) ppp grundiert (5&#39;) eine Kappe analog. Dieses Protokoll kann auf verschiedene Weise modifiziert werden. Für in vitro-Transkription, eine andere Bakteriophagen-RNA-Polymerase (zB T3 oder T7) kann in Verbindung mit seinen gut definierten Promotor-Sequenz 27 als Run-off-Website verwendet werden. Kann eine andere Restriktionsstelle verwendet werden, wenn es nicht vorhanden sein, das virale Genom und wenn synthetische RNA aus dem linearisierten cDNA-Enden mit dem authentischen 3&#39;-Ende. Die Wichtigkeit des 3&#39;- Ende Nukleotidsequenz wurde durch einen ca. 10-fachen Verringerung der Infektiosität RNA nachgewiesen, wenn eine synthetische RNA enthält drei oder vier virus unabhängigen Nukleotide an seinem 3&#39;-Ende. 27 in einem in vitro-Transkriptions-Reaktion, sowohl die m 7 G (5 &#39;) ppp (5&#39;) A und m 7 G (5 &#39;) ppp (5&#39;) G cap Analog kann gleichermaßen verwendet werden, obwohl die letzteren Orte eine unabhängige zusätzliche G-Nukleotid stromaufwärts des viralen 5 &#39;-Ende, aber dasZusatz nicht die Infektiosität oder Replikation von synthetischer RNA verändern. 27 ist darüber hinaus nicht für die RNA-Infektiosität Prüfungen erforderlich Entfernen der cDNA-Matrize aus dem RNA-Transkripte durch DNase I-Verdau, da der cDNA-Matrize selbst ist nicht infektiös. 27 Die BAC-Technologie wurde nun auf den Bau infektiösen cDNA-Klone für eine Handvoll Positiv-Strang-RNA-Viren, nämlich zwei JEVs, CNU / LP2 27 und SA 14 -14-2 28 (Genomgröße, ~ 11 kb) zugrunde gelegt wurden; zwei Dengue-Viren, BR / 90 26 und NGC 29 (~ 11 kb); das Virus der bovinen Virusdiarrhoe, SD1 (~ 12 kb); 25 zwei KSP-Viren, C und Paderborn (~ 12 kb); 24 die Grenze Euche-Virus, Gifhorn (~ 12 kb); 24 das PRRS-Virus , PL97-1 / LP1 (~ 15 kb); 30 die Transmissible Gastroenteritis Virus PUR46-MAD (~ 29 kb); 16 die Feline Infektiöse Peritonitis-Virus,DF-2 (~ 29 kb); 32 das schwere akute Atemwegssyndrom Coronavirus, Urbani (~ 30 kb); 9 der MERS-CoV, EMC / 2012 (~ 30 kb); 17 und der menschlichen Coronavirus, OC43 (~ 31 kb) 31. Der Hauptvorteil der Verwendung BACs für die cDNA-Konstruktion ist der hohe genetische Stabilität der großen, 1- oder 2-copy BAC-Plasmide. jedoch ist die intrinsische Natur ihrer extrem niedrigen Kopienzahl auch ein großer Nachteil, wegen der sehr geringen Ausbeuten von BAC-DNA und der daraus folgenden Verringerung der Reinheit der BAC-DNA in Bezug auf die chromosomale DNA beherbergen. Im aktuellen Protokoll wird die Ausbeute von BAC-DNA durch wachsende E. maximiert coli DH10B transformiert mit dem infektiösen BAC pBAC / SA 14 -14-2 in einem nährstoffreichen Medium, 2xYT. Trotz dieser Bemühungen ist das mittlere Ausbeute nur ~ 15 ug BAC-DNA aus 500 ml 2 × YT-Brühe. Auch ist die Reinheit des BAC-DNA am besten mit CsCl-EtBr-Dichtegradientenzentrifugation zur Reinigung erreichtAnstelle des üblicherweise verwendeten spaltenbasierten Plasmidisolierung. Allerdings ist es wichtig, im Hinterkopf behalten, dass die BAC-transformierten E. coli sollte nicht überwuchern, denn es könnte die genetische Stabilität des geklonten cDNA zu gefährden, und ein höheres Wachstum nicht zwangsläufig zu größeren Ausbeuten oder höhere Reinheit BAC DNA führen. Das hier beschriebene Protokoll ist eine optimierte, effiziente und gestraffte Verfahren für den Bau und die Ausbreitung eines genetisch stabil voller Länge infektiösen cDNA-Klon als BAC für JEV, ein Verfahren einmal dachte, praktisch unmöglich. Diese gleichen Klonierungsstrategie kann auch auf viele andere Positiv-Strang-RNA-Viren angewendet werden. Im allgemeinen infektiöse cDNA-Klone ermöglichen es uns, eine Vielzahl von Mutationen (zB Deletionen, Insertionen und Punktmutationen) zu einer viralen RNA-Genom einzuführen, um ihre biologischen Funktionen in die virale Replikation und Pathogenese studieren. Diese cDNA-basierte reversen Genetik-System macht es möglich, zu entwickeln und zu test-Impfstoff und therapeutischen Kandidaten gezielt ein Virulenzfaktor (n) eines bestimmten Positiv-Strang-RNA-Virus von Interesse. Darüber hinaus kann diese infektiösen cDNA-Technologie auch als ein viraler Vektor, der fähig ist, ein fremdes Gen (en) von Interesse exprimieren, für viele Anwendungen in der biomedizinischen Forschung eingesetzt werden.

Für RNA virologists, die in der rekombinanten DNA-Technologie in den späten 1970er Jahren wurde es möglich, die virale RNA-Genome in cDNA-Klonen, die dann als Plasmide in Bakterien, die für die genetische Manipulation von RNA-Viren vermehrt werden konnten konvertieren. 1 Die erste RNA-Virus zu sein, molekular kloniert wurde Bakteriophage Qß, ein Positiv-Strang-RNA-Virus, das Escherichia coli infiziert. Ein Plasmid, das eine vollständige cDNA Kopie des Qß-Genom-RNA führte zu Infektions Qß-Phagen, wenn sie in E. eingeführt coli. 2 Kurz danach wurde diese Technik auf Poliovirus angewendet wird, ein Positiv-Strang-RNA-Virus, von Menschen und Tieren. Ein Plasmid, das für ein Volllängen-cDNA des Poliovirus-Genom-RNA infektiös, wenn es in Säugerzellen transfiziert und in der Lage, infektiöse Virionen 3 In diesem &quot;DNA-aufgelegt&quot; Ansatzes sollte die klonierten cDNAs intrazellulär transkribiert, um virale RNA-Replikation zu initiieren.Es ist jedoch unklar, wie die Transkription initiiert wird, und wie die Transkripte werden auf die richtige Virussequenz verarbeitet. Dieses Anliegen wurde für die Entwicklung eines alternativen &quot;RNA-ins Leben gerufen&quot; orientierten Ansatz, wobei eine vollständige cDNA-Kopie der viralen RNA-Genom unter einem Promotor, der von einem E. erkannt geklont coli oder Phagen-RNA-Polymerase zur Herstellung von synthetischen RNAs in vitro mit definierten 5&#39;- und 3&#39;-Enden, die, wenn sie in Wirtszellen eingeführt das vollständige virale Replikationszyklus durchlaufen. 4,5 Der erste Erfolg mit diesem Ansatz wurde für Brommosaikvirus gemeldet , 6,7 eine positive Strang RNA-Virus von Pflanzen. Seitdem hat sich der RNA-ins Leben gerufen Ansatz für eine breite Palette von Positivstrang-RNA-Viren, einschließlich Caliciviren, Alphaviren, Flaviviren, Arteriviren und Coronaviren entwickelt. 1,4,5,8 Sowohl in der DNA- und RNA-aufgelegt reversen Genetik Systemen die Konstruktion eines volll cDNA-Klon ist der Schlüssel zum Erzeugen von infektiösen DNA oder RNA von Positivstrang-RNA-Viren, aber es wird eine beträchtliche technische Herausforderung dar, wenn die Größe des viralen Genoms zunimmt. 9-17 Insbesondere ein großer RNA Genom von ~ 10 -32 kb präsentiert drei Haupthindernisse für das Klonen von voller Länge funktionellen cDNA. 18 Die erste Schwierigkeit ist die Synthese eines treuen cDNA zu kopieren, da die Wiedergabetreue der RT-PCR ist umgekehrt proportional zur Länge der viralen RNA. Die zweite Hürde ist die Anwesenheit von potentiell toxischen Sequenzen, da lange RNA-Moleküle sind eher unerwartete Sequenzen, die zur Herstellung des cDNA-Fragments in die Plasmide instabil in E. enthalten coli. Der dritte und kritische Punkt ist die Verfügbarkeit eines geeigneten Vektors, da es schwierig ist, einen Klonierungsvektor, der eine virale cDNA-Insert von&gt; 10 kb aufnehmen kann, zu finden. In den vergangenen drei Jahrzehnten haben diese Barrieren durch einige Fortschritte in der Enzymologie, Methodik, eine überwundend Vektorologie. 1,4,5,8 Davon ist die vielversprechendsten und innovativsten Entwicklungs das Klonen von großen positiven Strang RNA-Viren, wie infektiöse bakterielle künstliche Chromosomen (BACs). Der BAC-Vektor ein low-copy Klonierungsplasmid (1-2 Kopien / Zelle) auf der Grundlage der E. coli F-Plasmid, mit einem Durchschnitt DNA Insertgröße von ~ 120-350 kb 19-21 Ein DNA-Fragment wird in den BAC-Vektor in einer ähnlichen Weise wie die Klonierung in allgemeinen Klonierungsvektoren eingeführt. die resultierenden BAC-Klone sind über viele Generationen in E. stabil coli. 22,23 Bisher wurde die BAC-Technologie wurde verwendet, um infektiöse cDNA-Klone für&gt; 10 Mitglieder von drei Positivstrang RNA Virusfamilien, also Flaviviridae, 24-29 Arteriviridae, 30 und Coronaviridae erstellen. 9,16,17 , 31,32 Verwendung Japanische Enzephalitis-Virus (JEV) als Beispiel, berichtet die vorliegende Arbeit die detaillierten Verfahren, die sein können,verwendet, um eine genetisch stabil voller Länge infektiös BAC für eine Vielzahl von Positiv-Strang-RNA-Viren zu konstruieren. JEV ist eine zoonotische Flavivirus 33, die in der Natur zwischen Vögeln, Schweinen und anderen Wirbeltierwirten durch Mückenvektoren übertragen wird. 34,35 Beim Menschen kann JEV-Infektion die schwere oft tödliche neurologische Erkrankung Japanische Enzephalitis verursachen (JE), 36, die in auftritt Asien und Teilen des Westpazifik, 37,38 mit einem geschätzten jährlichen Inzidenz von ~ 50,000-175,000 klinische Fälle. 39,40 Das Genom der JEV ist ein ~ 11-kb, einzelsträngig, positive Sense-RNA-Molekül und besteht aus einen einzelnen offenen Leserahmen (ORF), die durch zwei nicht-kodierenden Regionen (NCR) am 5 &#39;und 3&#39; flankiert endet. 41,42 Der ORF codiert ein Polyprotein, das von Host und virale Proteasen gespalten wird, um 10 einzelne Proteine ​​zu erzeugen, bezeichnet als C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B und NS5 in N- zu C-terminalen Richtung. 34,43,44 Auch eine EXtended Form von NS1 (NS1 &#39;) von ribosomalem -1-Leserastersprung an den Codons 8-9 von NS2A ausgedrückt. 45,46 Von diesen 11 Proteine, sind die drei Strukturproteine ​​(C, prM und E) für die Bildung von Infektions Virionen, 47,48 und die verbleibenden acht strukturelle Proteine ​​(NS1 bis NS5 und NS1) sind von entscheidender Bedeutung für die virale RNA-Replikation, 49-51 Partikelzusammenlagerung, 52-56 und angeborenen Immunität Flucht. 57-59 Sowohl die 5 &#39;und 3 &#39;NCRs enthalten konservierte Primärsequenzen und Form RNA sekundäre / ​​tertiäre Strukturen, 60-62, die wichtig für die Modulation Virus-RNA-Replikation sind. 63,64 Dieses Protokoll beschreibt die Werkzeuge, Verfahren und Strategien zur Erzeugung eines Volllängen-infektiösen BAC von JEV SA 14 -14-2. 28 diese Funktions BAC-Klon enthält eine vollständige cDNA-Kopie des JEV genomische RNA, 65, die durch einen Promotor umfasst ist für die SP6-RNA-Polymerase stromaufwärtsdes viralen 5&#39;-Ende und eine einzigartige Xba I-Restriktionsstelle stromabwärts von der viralen 3&#39;-Ende für eine in vitro run-off-Transkription. Dieser BAC-Technologie anwendbar ist, um eine voll funktionsfähige Konstruktion cDNA molekularen Klon für eine Reihe von Positivstrang-RNA-Viren.

<table><tbody><tr><td>&lt;strong&gt;1. Molecular Cloning&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>2xYT Broth</td><td>Sigma-Aldrich</td><td>Y2377</td><td></td></tr><tr><td>[&lt;sup&gt;3&lt;/sup&gt;H]UTP</td><td>PerkinElmer</td><td>NET380250UC</td><td>Radioactive</td></tr><tr><td>50 ml Tube</td><td>Thermo Scientific (Nalgene)</td><td>3114-0050</td><td></td></tr><tr><td>250 ml Bottle</td><td>Beckman Coulter</td><td>356011</td><td></td></tr><tr><td>Agarose</td><td>Lonza</td><td>50004</td><td></td></tr><tr><td>Agarose (Low Melting Point)</td><td>Life Technologies (Invitrogen)</td><td>16520-100</td><td></td></tr><tr><td>AvaI</td><td>New England BioLabs</td><td>R0152S</td><td></td></tr><tr><td>AvrII</td><td>New England BioLabs</td><td>R0174S</td><td></td></tr><tr><td>BamHI</td><td>New England BioLabs</td><td>R0136S</td><td></td></tr><tr><td>BsiWI</td><td>New England BioLabs</td><td>R0553S</td><td></td></tr><tr><td>BsrGI</td><td>New England BioLabs</td><td>R0575S</td><td></td></tr><tr><td>Butanol</td><td>Fisher Scientific</td><td>A399-1&amp;nbsp;</td><td></td></tr><tr><td>Cesium Chloride</td><td>Fisher Scientific</td><td>BP1595-1</td><td></td></tr><tr><td>Chloramphenicol</td><td>Sigma-Aldrich</td><td>C0378</td><td></td></tr><tr><td>Chloroform</td><td>Sigma-Aldrich</td><td>C2432</td><td>Carcinogenic</td></tr><tr><td>DE-81 Filter Paper</td><td>GE Healthcare Life Sciences</td><td>3658-023</td><td></td></tr><tr><td>dNTP mix</td><td>Life Technologies (Invitrogen)</td><td>18427-088</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DH10B&amp;nbsp;</td><td>Life Technologies (Invitrogen)</td><td>18297-010</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>E5134</td><td></td></tr><tr><td>Ethanol&amp;nbsp;</td><td>Sigma-Aldrich</td><td>E7023</td><td></td></tr><tr><td>Ethidium Bromide</td><td>Sigma-Aldrich</td><td>E7637</td><td>Toxic and highly mutagenic</td></tr><tr><td>Filter Column (Plasmid Maxiprep Kit)</td><td>Life Technologies (Invitrogen)</td><td>K2100-26</td><td></td></tr><tr><td>Glacial Acetic Acid</td><td>Sigma-Aldrich</td><td>A6283</td><td>Irritating</td></tr><tr><td>Glucose</td><td>Sigma-Aldrich</td><td>G5400</td><td></td></tr><tr><td>Glycogen&amp;nbsp;</td><td>Roche</td><td>10901393001</td><td></td></tr><tr><td>High-fidelity DNA Polymerase</td><td>New England BioLabs</td><td>M0491S</td><td></td></tr><tr><td>Isoamyl Alcohol</td><td>Sigma-Aldrich</td><td>I9392</td><td>Flammable</td></tr><tr><td>Isopropanol&amp;nbsp;</td><td>Amresco</td><td>0918</td><td>Flammable</td></tr><tr><td>LB Broth</td><td>Life Technologies (Invitrogen)</td><td>12795-027</td><td></td></tr><tr><td>Lithium Chloride</td><td>Sigma-Aldrich</td><td>L9650</td><td></td></tr><tr><td>Lysozyme</td><td>Amresco</td><td>0663</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Sigma-Aldrich</td><td>M8266</td><td></td></tr><tr><td>M-MLV Reverse Transcriptase</td><td>Life Technologies (Invitrogen)</td><td>18080-044</td><td></td></tr><tr><td>Mung Bean Nuclease</td><td>New England BioLabs</td><td>M0250S</td><td></td></tr><tr><td>Needle (18G, 20G)</td><td>BD</td><td>305196, 305175</td><td>Biohazardous (Sharps waste)</td></tr><tr><td>NotI</td><td>New England BioLabs</td><td>R0189S</td><td></td></tr><tr><td>Oligonucleotide</td><td>Integrated DNA Technologies</td><td>Custom Oligonucleotide Synthesis</td><td></td></tr><tr><td>PacI</td><td>New England BioLabs</td><td>R0547S</td><td></td></tr><tr><td>pBeloBAC11</td><td>New England BioLabs</td><td>ER2420S (E4154S)</td><td></td></tr><tr><td>Phenol (Buffer-Saturated)</td><td>Life Technologies (Invitrogen)</td><td>15513-039</td><td>Toxic and highly corrosive</td></tr><tr><td>Phenol:Chloroform:Isoamyl Alcohol</td><td>Life Technologies (Invitrogen)</td><td>15593-031</td><td>Toxic and highly corrosive</td></tr><tr><td>Phenol:Guanidine Isothiocyanate</td><td>Life Technologies (Ambion)</td><td>10296-010</td><td>Toxic, corrosive, and irritating</td></tr><tr><td>Pme I</td><td>New England BioLabs</td><td>R0560S</td><td></td></tr><tr><td>Potassium Acetate</td><td>Amresco</td><td>0698</td><td></td></tr><tr><td>RNase Inhibitor</td><td>Life Technologies (Invitrogen)</td><td>10777-019</td><td></td></tr><tr><td>rNTP Set</td><td>GE Healthcare Life Sciences</td><td>27-2025-01</td><td></td></tr><tr><td>Sealable Polypropylene Tube (16 &amp;times; 76 mm)&amp;nbsp;</td><td>Beckman Coulter</td><td>342413</td><td></td></tr><tr><td>SfiI</td><td>New England BioLabs</td><td>R0123S</td><td></td></tr><tr><td>Sma I</td><td>New England BioLabs</td><td>R0141S</td><td></td></tr><tr><td>Sodium Acetate</td><td>Sigma-Aldrich</td><td>S2889</td><td></td></tr><tr><td>Sodium Dodecyl Sulfate</td><td>Amresco</td><td>0227</td><td></td></tr><tr><td>Sodium Hydroxide</td><td>Sigma-Aldrich</td><td>S5881</td><td></td></tr><tr><td>SP6 RNA Polymerase</td><td>New England BioLabs</td><td>M0207S</td><td></td></tr><tr><td>Spin Column (Plasmid Miniprep Kit)</td><td>Life Technologies (Invitrogen)</td><td>K2100-11</td><td></td></tr><tr><td>Syringe</td><td>HSW NORM-JECT</td><td>4200.000V0</td><td></td></tr><tr><td>T4 DNA Ligase</td><td>New England BioLabs</td><td>M0202S</td><td></td></tr><tr><td>Tris</td><td>Amresco</td><td>0826</td><td></td></tr><tr><td>tRNA (yeast)</td><td>Life Technologies (Invitrogen)</td><td>15401-011</td><td></td></tr><tr><td>XbaI&amp;nbsp;</td><td>New England BioLabs</td><td>R0145S</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;2. Cell Culture&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Alpha Minimal Essential Medium</td><td>Life Technologies (Gibco)</td><td>12561-049</td><td></td></tr><tr><td>Conical Tube (50 mL)</td><td>VWR</td><td>21008-242</td><td></td></tr><tr><td>Crystal Violet&amp;nbsp;</td><td>Sigma-Aldrich</td><td>C0775</td><td></td></tr><tr><td>Culture Dish (150 mm)&amp;nbsp;</td><td>TPP</td><td>93150&amp;nbsp;</td><td></td></tr><tr><td>Cuvette (2-mm Gap)</td><td>Harvard Apparatus</td><td>450125&amp;nbsp;</td><td></td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Life Technologies (Gibco)</td><td>16000-044</td><td></td></tr><tr><td>Formaldehyde</td><td>Sigma-Aldrich</td><td>F1635</td><td>Toxic and carcinogenic</td></tr><tr><td>Glutamine</td><td>Life Technologies (Gibco)</td><td>25030-081</td><td></td></tr><tr><td>Minimal Essential Medium</td><td>Life Technologies (Gibco)</td><td>61100-061</td><td></td></tr><tr><td>Penicillin/Streptomycin</td><td>Life Technologies (Gibco)</td><td>15070-063</td><td></td></tr><tr><td>Potassium Chloride</td><td>Sigma-Aldrich</td><td>P3911</td><td></td></tr><tr><td>Potassium Phosphate Monobasic</td><td>Sigma-Aldrich</td><td>P9791</td><td></td></tr><tr><td>Six-Well Plate</td><td>TPP</td><td>92006</td><td></td></tr><tr><td>Sodium Chloride</td><td>Sigma-Aldrich</td><td>S3014</td><td></td></tr><tr><td>Sodium Phosphate Dibasic</td><td>Sigma-Aldrich</td><td>S3264</td><td></td></tr><tr><td>Trypsin-EDTA (0.25%)</td><td>Life Technologies (Gibco)</td><td>25200-056</td><td></td></tr><tr><td>Vitamins</td><td>Sigma-Aldrich</td><td>M6895</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;3. Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Agarose Gel Electrophoresis System</td><td>Mupid</td><td>MPDEXU-01</td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; Incubator</td><td>Thermo Scientific</td><td>Heracell 150i</td><td></td></tr><tr><td>Desktop Centrifuge&amp;nbsp;</td><td>Thermo Scientific</td><td>ST16R</td><td></td></tr><tr><td>Electroporator</td><td>Harvard Apparatus</td><td>ECM 830</td><td></td></tr><tr><td>Longwave Ultraviolet Lamps (Handheld)</td><td>UVP</td><td>UVGL-58</td><td></td></tr><tr><td>Tabletop Centrifuge</td><td>Beckman Coulter</td><td>368826</td><td></td></tr><tr><td>Thermocycler</td><td>Life Technologies (Applied Biosystems)</td><td>GeneAmp PCR System 9700</td><td></td></tr><tr><td>Vortexer</td><td>Scientific Industries</td><td>G-560</td><td></td></tr><tr><td>Water Bath</td><td>Jeio Tech</td><td>WB-10E</td><td></td></tr></tbody></table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

Für alle Positivstrang-RNA-Viren, die Zuverlässigkeit und die Effizienz einer reversen Genetik System abhängig von der genetischen Stabilität eines klonierten cDNA voller Länge, deren Sequenz ist äquivalent zu der Konsensussequenz der genomischen Virus-RNA. 27. Figur 1 zeigt einen fünf- Schritt-Strategie für die Konstruktion eines Volllängen-infektiösen cDNA als BAC für JEV SA 14 -14-2 28: Schritt 1 Reinigung von viraler RNA aus der Zellkulturüberstand von JEV-infizierten BHK-21-Zellen (1A); Schritt 2 Synthese von vier überlappenden cDNA-Amplikons (F1 bis F4) überspannt die gesamte virale Genom (1B); Schritt 3 Subklonieren jedes der vier benachbarten cDNA-Fragmenten in einen BAC-Vektor, wodurch pBAC / F1 um pBAC / F4 (1C); Schritt 4 Abwandlung der klonierten cDNAs für in vitro-Run-off-Transkription mit SP6-RNA-Polymerase, das heißt, wobei sich der SP6Promotorsequenz unmittelbar stromaufwärts des viralen 5&#39;-Ende (pBAC / F1 SP6), wodurch eine bereits bestehende interne Xba I-Stelle am Nukleotid 9131 durch die Einführung einer stillen Punktmutation, A → T 9134 (pBAC / F3 KO) und das Einfügen eine neue künstliche Xba I run-off-Stelle unmittelbar stromabwärts der viralen 3&#39;-Ende (pBAC / F4 RO) (1D); und Schritt 5, Montage von einer Volllängen-SA 14 -14-2 cDNA BAC, pBAC / SA 14 -14-2 (1E). In Tabelle 1 sind die in diesem Klonierungsverfahren verwendeten Oligonukleotide. 28 Für die Konstruktion eines funktionalen JEV cDNA ist ein erster wichtiger Schritt bei der Synthese der vier überlappenden cDNA-Fragmente unter Verwendung der gereinigten viralen RNA als Matrize für die RT-PCR. 2 stellt ein repräsentatives Ergebnis für die vier RT-PCR-Produkte waren auf einem 0,8%Agarose-Gel. Dieses Gel zeigt deutlich, dass ein voller Länge JEV cDNA ist in vier überlappenden cDNA-Fragmente amplifiziert. Gelegentlich kann RT-PCR-Reaktionen ein oder mehrere weitere virusspezifische oder nicht-spezifische Produkte, die meist kleiner als die erwarteten Produkts zu ergeben, wegen der nicht-spezifischen Anlagerung der Primer bei der cDNA-Synthese / Amplifikation. Andererseits wenig oder keine erwartete RT-PCR-Produkt würde aufgrund zufälliger RNase Kontamination während der viralen RNA-Isolierung oder unsachgemäße RT-PCR-Technologie amplifiziert sein. Der nächste Schlüsselschritt ist die Clonierung und Modifikation einer Teil- oder Volllängen-JEV cDNA in BAC, die eine relativ einfache Prozedur, die von rekombinanten Standard-DNA-Techniken verwendet, ist. 69 3 stellt ein repräsentatives Ergebnis für die Reinigung des BAC-Klon, eine cDNA voller Länge des JEV SA 14 -14-2 durch Streifenbildung in einem CsCl-Gradienten EtBr.In diesem Experiment wurde nach Zentrifugation für 16 Stunden bei 401.700 × g, zwei getrennte Banden, dh der E. coli chromosomale DNA oben und die supercoiled BAC-Plasmid-DNA unter, sind in der Mitte des Rohres unter langwelligem UV-Licht sichtbar. Ein minimales Volumen (~ 400 &amp; mgr; l) des unteren BAC-DNA-Bande wurde vorsichtig durch das Stoßen ein Loch mit einer Spritze auf der Seite der Röhrchen gesammelt. Anschließend wurde das Ethidiumbromid aus dem BAC-DNA durch Butanolextraktion extrahiert und der EtBr freien BAC DNA wurde durch Ethanolfällung konzentriert. Der letzte Schritt ist die Bestimmung der spezifischen Infektivität der synthetischen RNAs in vitro aus dem Volllängen-SA 14 -14-2 BAC (pBAC / SA 14 -14-2) nach der RNA-Transfektion in permissive Zellen (Figur 4) transkribiert. Dieser Schritt erfolgt in drei aufeinanderfolgenden Schritten: Schritt 1, Linearisierung des Volllängen-SA 14 -14-2-cDNA am 3&#39;-Ende des viralen Genoms (4A); Schritt 2 Herstellung von synthetischen RNAs, die von dem linearisierten cDNA durch Run-off-Transkription (4B); und Schritt 3, Rettung der rekombinanten Viren in BHK-21-Zellen mit den synthetischen RNAs (4C) transfiziert. Experimentell wurden zwei unabhängige Klone von pBAC / SA 14 -14-2 mit XbaI Verdau linearisiert und mit MBN behandelt, um das Vier-Basen 5&#39;-Überhang von der XbaI-Verdauung erzeugten entfernen. Die linearisierten BACs wurden durch Phenol-Chloroform-Extraktion gereinigt, gefolgt von Ethanolfällung. Die Linearisierung der beiden gereinigten BACs wurde auf einem 0,8% igen Agarosegel (5A) demonstriert. Die Phenol-Chloroform-Extraktion muss sorgfältig durchgeführt werden, um sicherzustellen, daß die linearisierte BACs RNase-frei. Jeder der beiden linearisierte BACs diente als Vorlage für die cDNA Ablauf Transkription unter Verwendung von SP6 RNA-Polymerase in Gegenwart der m 7 G (5 &#39;) ppp (5&#39;) Eine Kappe analog. Die Integrität der synthetischen RNAs wurde durch Ausführen von Aliquots der zwei Transkriptionsreaktionsgemische auf einem 0,6% igen Agarosegel zusammen mit einer Referenz 1 kb DNA-Leiter (5B) dargestellt ist. In diesem einfachen Test, der Haupt prominenten RNA band stets nur migriert unterhalb der 3 kb Referenz DNA-Bande und erschien scharf sein. Allerdings verschlechtert RNA würde eine verschmierte Aussehen auf dem gleichen Gel müssen. Eine Infektionszentrum Assay ist der Goldstandard für die Bestimmung der spezifischen Infektiosität der synthetischen RNAs. Dieser Assay wurde durch Elektroporation von BHK-21-Zellen, die mit RNA-Proben, die Beimpfung gleiche Aliquots der 10-fach seriell verdünnt elektroporierten Zellen in 6-Well-Platten, die naive BHK-21-Zellen (3 × 10 5 Zellen / Well), und Überlagern Agarose getan auf die Zellmonoschichten. Nach einer Inkubationszeit von 4 Tagen wurden die überlebenden Zellen mit Formaldehyd fixiert und mit einer Kristallviolett gebeiztolution um die Anzahl der Infektionszentren (Plaques), die die Anzahl der in den Zellen (6A) geliefert infektiöse RNA-Moleküle entspricht quantifizieren. Da die cDNA-Matrize für die in vitro Transkription eingesetzt wurde, erwiesen sich als nicht-infektiös wurde 27 ein Aliquot der Transkriptionsreaktionsmischung direkt für die Elektroporation verwendet. Elektroporation ist die bevorzugte Methode zur RNA-Transfektion; alternativ kann RNAs durch andere Verfahren unter Verwendung von DEAE-Dextran und kationischen Liposomen transfiziert werden. RNA Elektroporation ist sehr effektiv, aber &quot;Lichtbogenbildung&quot; des elektrischen Impulses tritt selten, wenn Salze in der Reaktions Elektroporation oder die Elektroporationsküvette wiederverwendet vorliegen. Die Expression von viralen Proteinen in RNA-transfizierten Zellen wurde durch Immunfluoreszenz unter Verwendung eines Anti-NS1 Kaninchen-Antiserum (6B) untersucht. Die Produktion von Viruspartikeln in den Überständen von RNA-transfizierten Zellen akkumuliert wardurch Plaque-Assays (6C) sierten. Die Ergebnisse dieser Experimente zeigen deutlich, dass die cDNA-abgeleitete synthetische RNAs sind infektiös in permissiven BHK-21-Zellen, wodurch eine hohe Titer von rekombinanten Viren. <table fo:keep-together.within-page="1"><tbody><tr><td> Oligonukleotid </td><td> Sequenz A (5 &#39;nach 3&#39;) </td><td> Position b </td><td> Polarität </td></tr><tr><td> 1RT </td><td> TAGGGATCTGGGCGTTTCTG GCAAAT </td><td> 2578-2603 </td><td> Antisense- </td></tr><tr><td> 1F </td><td> aatcccgggAGAAGTTTATC TGTGTGAACTT </td><td> 1-22 </td><td> Sinn </td></tr><tr><td> 1R </td><td> attgcggccgcCCACGTCGT TGTGCACGAAGAT </td><td> 2532-2553 </td><td> Antisense- </td></tr><tr><td> 2RT </td><td> TTCTGCCTACTCTGCCCCTC CGTTGA </td><td> 5975-6000 </td><td> Ameiseich spüre </td></tr><tr><td> 2F </td><td> aatcccgggTCAAGCTCAGT GATGTTAACAT </td><td> 1800-1821 </td><td> Sinn </td></tr><tr><td> 2R </td><td> attgcggccgcGATGGGTTT CCGAGGATGACTC </td><td> 5929-5950 </td><td> Antisense- </td></tr><tr><td> 3RT </td><td> ACGGTCTTTCCTTCTGCTGC AGGTCT </td><td> 9426-9451 </td><td> Antisense- </td></tr><tr><td> 3F </td><td> aatcccgggGAGGATACATT GCTACCAAGGT </td><td> 5500-5521 </td><td> Sinn </td></tr><tr><td> 3R </td><td> attgcggccgcGTAAGTCAG TTCAATTATGGCT </td><td> 9380-9401 </td><td> Antisense- </td></tr><tr><td> 4RT </td><td> AGATCCTGTGTTCTTCCTCA CCACCA </td><td> 10.952-10.977 </td><td> Antisense- </td></tr><tr><td> 4F </td><td> aatcccgggAGTGGAAGGCT CAGGCGTCCAA </td><td> 9200-9221 </td><td> Sinn </td></tr><tr><td> 4R </td><td> attgcggccgcAGATCCTGT GTTCTTCCTCACC </td><td> 10.956-10.977 </td><td> Antisense- </td></tr><tr><td> SP6F </td><td> cataccccgcgtattcccac ta </td><td></td><td> Sinn </td></tr><tr><td> SP6R </td><td> ACAGATAAACTTCTctatag tgtcccctaaa </td><td> 1-14 </td><td> Antisense- </td></tr><tr><td> F1F </td><td> aggggacactatagAGAAGT TTATCTGTGTG </td><td> 1-17 </td><td> Sinn </td></tr><tr><td> F1R </td><td> TGGATCATTGCCCATGGTAA GCTTA </td><td> 638-662 </td><td> Antisense- </td></tr><tr><td> X1f </td><td> CGAATGGATCGCACAGTGTG GAGAG </td><td> 8403-8427 </td><td> Sinn </td></tr><tr><td> X1R </td><td> AAAGCTTCAAACTCAAGATA CCGTGCTCC </td><td> 9120-9148 </td><td> Antisense- </td></tr><tr><td> X2F </td><td> GGAGCACGGTATCTTGAGTT TGAAGCTTT </td><td> 9120-9148 </td><td> Sinn </td></tr><tr><td> X2R </td><td> cacgtggacgagggcatgcc tgcag </td><td></td><td> Antisense- </td></tr><tr><td> ROF </td><td> CCAGGAGGACTGGGTTACCA AAGCC </td><td> 10670-10694 </td><td> Sinn </td></tr><tr><td> ROR </td><td> agggcggccgctctagAGAT CCTGTGTTCTTCCTCACCAC </td><td> 10.954-10.977 </td><td> Antisense- </td></tr><tr><td colspan="4"> ein JEV-Sequenzen werden in Großbuchstaben angezeigt, und BAC-Sequenzen werden in Kleinbuchstaben angegeben. b Nukleotid-Position bezieht sich auf die komplette Genomsequenz von JEV SA 14 -14-2 (Genbank-Zugangsnummer JN604986). </td></tr></tbody></table> Tabelle 1: Oligonukleotide, die für die cDNA-Synthese, PCR-Amplifikation und BAC-Mutagenese verwendet. <img alt="Abbildung 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> Abbildung 1.0; Strategie für die Konstruktion einer cDNA voller Länge von JEV SA 14 -14-2 als BAC (A) Isolierung von viraler RNA aus JEV Teilchen.. Gezeigt ist eine schematische Darstellung der genomischen RNA des JEV SA 14 -14-2. (B) Synthese von vier überlappenden cDNA-Fragmente (F1 bis F4), die den gesamten Virusgenom. (C) Subklonierung von vier überlappenden cDNA-Fragmente in einen BAC-Vektor, die Schaffung pBAC / F1 bis pBAC / F4. (D) Änderung der geklonten cDNAs für Run-off-Transkription in vitro. pBAC / F1 SP6 ist ein Derivat von pBAC / F1, der die SP6-Promotorsequenz stromaufwärts des viralen 5&#39;-Ende enthält. pBAC / F3 KO ist ein Derivat der pBAC / F3, die eine stille Punktmutation (A 9134 → T, Sternchen) enthält. pBAC / F4 RO ist ein Derivat der pBAC / F4, die eine künstliche Xba I run-off-Stelle stromabwärts der viralen 3&#39;-Ende enthält. (E </<html> strong&gt;) Montage eines in voller Länge SA 14 -14-2 BAC (pBAC / SA 14 -14-2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" src="/files/ftp_upload/53164/53164fig2.jpg" /> Abbildung 2. Synthese von vier überlappenden cDNA-Fragmente (F1 bis F4) überspannt den in voller Länge genomischen RNA des JEV SA 14 -14-2. Die vier RT-PCR-Produkte werden durch Elektrophorese in einem 0,8% Agarosegel bewertet. M, 1 kb DNA-Leiter. Die erwarteten Größen der vier cDNA-Fragmente werden am unteren Rand des Gels Bild angezeigt. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> /ftp_upload/53164/53164fig3.jpg &quot;/&gt; Abbildung 3. Die Reinigung des BAC, das eine cDNA voller Länge des JEV SA 14 -14-2. Die BAC-Plasmid von E. isoliert coli DH10B durch die SDS-Alkali-Lyse-Verfahren und durch Streifenbildung in einem CsCl-EtBr-Gradienten gereinigt. Präsentiert wird, ist ein Beispiel für die CsCl-Gradienten EtBr mit einem 16 × 76 mm verschließbaren Polypropylenröhrchen. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 4" src="/files/ftp_upload/53164/53164fig4.jpg" /> Abbildung 4. Überblick über die Rückgewinnung von infektiösen Viren aus einem in voller Länge JEV SA 14 -14-2 cDNA in einer BAC zusammengestellt. (A) Die Linearisierung der cDNA-Matrize. Die in voller Länge JEV BAC mit geschnittenXbaI und mit MBN behandelt. (B) Synthese der RNA-Transkripte. Das linearisierte cDNA durch SP6-RNA-Polymerase in Gegenwart der m 7 G (5 &#39;) ppp (5&#39;) eine Kappe analogen transkribiert. (C) Die Gewinnung des synthetischen JEVs. Die in vitro transkribierte RNAs werden in BHK-21-Zellen durch Elektroporation, die einen hohen Titer von synthetischen Virus erzeugt transfiziert. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 5" src="/files/ftp_upload/53164/53164fig5.jpg" /> Figur 5. Synthese der RNAs durch in vitro Transkription unter Verwendung einer Volllängen-JEV BAC als cDNA-Templat. (A) Herstellung des linearisierten Volllängen JEV BAC, pBAC / SA 14 -14-2. Zwei unabhängige Klone von pBAC/ SA 14 -14-2 (Cl.1 und Cl.2) durch Verdau mit XbaI und anschließende Behandlung mit MBN linearisiert. Die linearisierten BACs werden durch Elektrophorese in einem 0,8% igen Agarosegel untersucht. (B) Herstellung der synthetischen RNAs durch Run-off-Transkription. Jeder der beiden linearisierte BACs wird als Matrize für die SP6-RNA-Polymerase-Run-off-Transkription eingesetzt. Aliquots der beiden Transkriptionsreaktionen werden auf einem 0,6% Agarosegel laufen gelassen. M, 1 kb DNA-Leiter. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 6" src="/files/ftp_upload/53164/53164fig6.jpg" /> Figur 6. spezifische Infektiosität der synthetischen RNAs, die von einer Volllängen-JEV BAC und die Gewinnung synthetischer virus transkribiert. BHK-21-Zellen mock-elektroporiert (Mock), oder durch Elektroporation mit den RNA-Transkripten hergeleitet sind from jede der beiden unabhängigen Klonen von voller Länge JEV BAC (Cl.1 und Cl.2). (A) RNA-Infektiosität. Die Zellen werden mit Agarose überschichtet und mit Kristallviolett gefärbt bei 4 Tage nach der Transfektion. RNA-Infektiosität durch infectious center Tests bestimmt, um die Menge der infektiösen RNA in die Zellen (links) elektroporiert abzuschätzen. Auch sind repräsentative Bilder von Infektionszentren dargestellt (rechtes Bild). (B) Proteinexpression. Die Zellen sind in 4-Well-Kammerobjektträgern kultiviert. Virale Proteinexpression in RNA-elektroporierten Zellen bei 20 Stunden nach der Transfektion (hpt) durch Immunfluoreszenz unter Verwendung eines primären anti-NS1 Kaninchen-Antiserum und einer Sekundär Cy3-konjugiertem Ziegen-Anti-Kaninchen-IgG (rot) analysiert. Die Kerne werden mit 4 &#39;, 6-Diamidino-2-phenylindol (blau) gegengefärbt. Die Immunfluoreszenz-Bilder werden auf ihre entsprechenden Differentialinterferenzkontrastbilder überlagert. (C) Virus-Ausbeute. Die Zellen werden in 1 kultiviert50 mm Kulturschalen. Die Produktion von infektiösen Virionen in den Kulturüberständen von RNA-elektroporierten Zellen bei 22 und 40 hpt sammelt wird durch Plaque-Assays untersucht. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Bakterielle künstliche Chromosomen: A Functional Genomics-Werkzeug für das Studium der Positiv-Strang-RNA-Viren

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Research

JoVE Journal

Immunology and Infection

21.3K Aufrufe.  Utah State University. Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Serie: Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

Einfach und robust In-vivo- Und In-vitro- Ansatz für das Studium Virusassemblierung

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Forschung

Immunologie und Infektion

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

Hochdurchsatz-Screening für Breitspektrum-Chemische Inhibitoren der RNA-Viren

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Reverse Genetics to Engineer Positive-Sense RNA Virus Variants

The lack of a convenient method for the iterative generation of diverse full-length viral variants has impeded the study of directed evolution in RNA viruses. By integrating a full RNA genome error-prone PCR and reverse genetics, random genome-wide substitution mutagenesis can be induced. We have developed a method using this technique to synthesize diverse libraries to identify viral mutants with phenotypes of interest. This method, called full-length mutant RNA synthesis (FL-MRS), offers the following advantages: (i) the ability to create a large library via a highly efficient one-step error-prone PCR; (ii) the ability to create groups of libraries with varying levels of genetic diversity by manipulating the fidelity of DNA polymerase; (iii) the creation of a full-length PCR product that can directly serve as a template for mutant RNA synthesis; and (iv) the ability to create RNA that can be delivered into host cells as a non-selected input pool to screen for viral mutants of the desired phenotype. We have found, using a reverse genetics approach, that FL-MRS is a reliable tool to study viral-directed evolution at all stages in the life cycle of the hepatitis C virus, JFH1 isolate. This technique appears to be an invaluable tool to employ directed evolution to understand adaptation, replication, and the role of viral genes in pathogenesis and antiviral resistance in positive-sense RNA viruses.

The protocol describes a method for introducing controllable genetic diversity in the hepatitis C virus genome by combining full-length mutant RNA synthesis using error-prone PCR and reverse genetics. The method provides a model for phenotype selection and can be used for 10 kb long positive-sense RNA virus genomes.

Reverse Genetik zur Entwicklung von RNA-Virusvarianten mit positivem Sinn

The lack of a convenient method for the iterative generation of diverse full-length viral variants has impeded the study of directed evolution in RNA ...

Genetik

Generation and Assembly of Virus-Specific Nucleocapsids of the Respiratory Syncytial Virus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and assay development in virology. The RNA template of nonsegmented negative-sense (NNS) RNA viruses, such as the respiratory syncytial virus (RSV), is not an RNA molecule alone but rather a nucleoprotein (N) encapsidated ribonucleoprotein complex. Despite the importance of the authentic RNA template, the generation and assembly of such a ribonucleoprotein complex remain sophisticated and require in-depth elucidation. The main challenge is that the overexpressed RSV N binds non-specifically to cellular RNAs to form random nucleocapsid-like particles (NCLPs). Here, we established a protocol to obtain RNA-free N (N0) first by co-expressing N with a chaperone phosphoprotein (P), then assembling N0 with RNA oligos with the RSV-specific RNA sequence to obtain virus-specific nucleocapsids (NCs). This protocol shows how to overcome the difficulty in the preparation of this traditionally challenging viral ribonucleoprotein complex.

For in-depth mechanistic analysis of the respiratory syncytial virus (RSV) RNA synthesis, we report a protocol of utilizing the chaperone phosphoprotein (P) for coexpression of the RNA-free nucleoprotein (N0) for subsequent in vitro assembly of the virus-specific nucleocapsids (NCs).

Generierung und Aufbau virusspezifischer Nukleokapsiden des respiratorischen Synzytialvirus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and ...

Biochemie

Modeling The Lifecycle Of Ebola Virus Under Biosafety Level 2 Conditions With Virus-like Particles Containing Tetracistronic Minigenomes

Ebola viruses cause severe hemorrhagic fevers in humans and non-human primates, with case fatality rates as high as 90%. There are no approved vaccines or specific treatments for the disease caused by these viruses, and work with infectious Ebola viruses is restricted to biosafety level 4 laboratories, significantly limiting the research on these viruses. Lifecycle modeling systems model the virus lifecycle under biosafety level 2 conditions; however, until recently such systems have been limited to either individual aspects of the virus lifecycle, or a single infectious cycle. Tetracistronic minigenomes, which consist of Ebola virus non-coding regions, a reporter gene, and three Ebola virus genes involved in morphogenesis, budding, and entry (VP40, GP1,2, and VP24), can be used to produce replication and transcription-competent virus-like particles (trVLPs) containing these minigenomes. These trVLPs can continuously infect cells expressing the Ebola virus proteins responsible for genome replication and transcription, allowing us to safely model multiple infectious cycles under biosafety level 2 conditions. Importantly, the viral components of this systems are solely derived from Ebola virus and not from other viruses (as is, for example, the case in systems using pseudotyped viruses), and VP40, GP1,2 and VP24 are not overexpressed in this system, making it ideally suited for studying morphogenesis, budding and entry, although other aspects of the virus lifecycle such as genome replication and transcription can also be modeled with this system. Therefore, the tetracistronic trVLP assay represents the most comprehensive lifecycle modeling system available for Ebola viruses, and has tremendous potential for use in investigating the biology of Ebola viruses in future. Here, we provide detailed information on the use of this system, as well as on expected results.

Work with infectious Ebola viruses is restricted to biosafety level 4 laboratories. Tetracistronic minigenome-containing replication and transcription-competent virus like particles (trVLPs) represent a lifecycle modeling system that allows us to safely model multiple infectious cycles under biosafety level 2 conditions, relying exclusively on Ebola virus components.

Modellierung des Lebenszyklus von Ebola Virus unter Biosafety Level 2 Bedingungen mit Virus-ähnlichen Partikeln, die Tetracistronic Minigenome

Ebola viruses cause severe hemorrhagic fevers in humans and non-human primates, with case fatality rates as high as 90%. There are no approved vaccines or ...

Combining Analysis of DNA in a Crude Virion Extraction with the Analysis of RNA from Infected Leaves to Discover New Virus Genomes

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low titers in their host or cannot be mechanically inoculated to another host are difficult to propagate to achieve a greater titer of infectious material. Infected leaves are ground in a mild buffer with optimal pH and ionic composition recommended for purifying most bacilliform Para retroviruses. Urea is used to break up inclusion bodies that trap virions and to dissolve cellular components. Differential centrifugation provides further separation of virions from plant contaminants. Then proteinase K treatment removes the capsids. Then the viral DNA is concentrated and used for next-generation sequencing (NGS). The NGS data are used to assemble contigs which are submitted to NCBI-BLASTn to identify a subset of virus sequences in the generated dataset. In a parallel pipeline, RNA is isolated from infected leaves using a standard column-based RNA extraction method. Then ribosome depletion is carried out to enrich for a subset of mRNA and virus transcripts. Assembled sequences derived from RNA sequencing (RNA-seq) were submitted to NCBI-BLASTn to identify a subset of virus sequences in this dataset. In our study, we identified two related full-length badnavirus genomes in the two datasets. This method is preferred to another common approach which extracts the aggregate population of small RNA sequences to reconstitute plant virus genomic sequences. This latter metagenomic pipeline recovers virus related sequences that are retro-transcribing elements inserted into the plant genome. This is coupled to biochemical or molecular assays to further discern the actively infectious agents. The approach documented in this study, recovers sequences representative of replicating viruses that likely indicate active virus infection.

Here we present a new approach to identify plant viruses with double-strand DNA genomes. We use standard methods to extract DNA and RNA from infected leaves and carry out next-generation sequencing. Bioinformatic tools assemble sequences into contigs, identify contigs representing virus genomes and assign genomes to taxonomic groups.

Kombination von Analyse von DNA in eine grobe Virion-Extraktion mit der Analyse der RNA aus den infizierten Blättern, entdecken neue Virus-Genom

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. However, these screens are typically conducted in cells that are naturally permissive to the viral pathogen under study. Therefore, the robust replication of viruses in control conditions may limit the dynamic range of these screens. Furthermore, these screens may be unable to easily identify cellular defense pathways that restrict virus replication if the virus is well-adapted to the host and capable of countering antiviral defenses. In this article, we describe a new paradigm for exploring virus-host interactions through the use of screens that center on naturally abortive infections by arboviruses such as vesicular stomatitis virus (VSV). Despite the ability of VSV to replicate in a wide range of dipteran insect and mammalian hosts, VSV undergoes a post-entry, abortive infection in a variety of cell lines derived from lepidopteran insects, such as the gypsy moth (Lymantria dispar). However, these abortive VSV infections can be &#34;rescued&#34; when host cell antiviral defenses are compromised. We describe how VSV strains encoding convenient reporter genes and restrictive L. dispar cell lines can be paired to set-up screens to identify host factors involved in arbovirus restriction. Furthermore, we also show the utility of these screening tools in the identification of virally encoded factors that rescue VSV replication during coinfection or through ectopic expression, including those encoded by mammalian viruses. The natural restriction of VSV replication in L. dispar cells provides a high signal-to-noise ratio when screening for the conditions that promote VSV rescue, thus enabling the use of simplistic luminescence- and fluorescence-based assays to monitor the changes in VSV replication. These methodologies are valuable for understanding the interplay between host antiviral responses and viral immune evasion factors.

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

Arboviren Infektionen als Screening-Tools für die Identifizierung von viralen Immunmodulatoren und Host antiviralen Faktoren

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

Confocal Imaging of Double-Stranded RNA and Pattern Recognition Receptors in Negative-Sense RNA Virus Infection

Double-stranded (ds) RNA is produced as a replicative intermediate during RNA virus infection. Recognition of dsRNA by host pattern recognition receptors (PRRs) such as the retinoic acid (RIG-I) like receptors (RLRs) RIG-I and melanoma differentiation-associated protein 5 (MDA-5) leads to the induction of the innate immune response. The formation and intracellular distribution of dsRNA in positive-sense RNA virus infection has been well characterized by microscopy. Many negative-sense RNA viruses, including some arenaviruses, trigger the innate immune response during infection. However, negative-sense RNA viruses were thought to produce low levels of dsRNA, which hinders the imaging study of PRR recognition of viral dsRNA. Additionally, infection experiments with highly pathogenic arenaviruses must be performed in high containment biosafety level facilities (BSL-4). The interaction between viral RNA and PRRs for highly pathogenic RNA virus is largely unknown due to the additional technical challenges that researchers need to face in the BSL-4 facilities. Recently, a monoclonal antibody (Mab) (clone 9D5) originally used for pan-enterovirus detection has been found to specifically detect dsRNA with a higher sensitivity than the traditional J2 or K1 anti-dsRNA antibodies. Herein, by utilizing the 9D5 antibody, we describe a confocal microscopy protocol that has been used successfully to visualize dsRNA, viral protein and PRR simultaneously in individual cells infected by arenavirus. The protocol is also suitable for imaging studies of dsRNA and PRR distribution in pathogenic arenavirus infected cells in BSL4 facilities.

Double-stranded RNA produced during RNA virus replication can be recognized by pattern recognition receptors to induce an innate immune response. For negative-sense RNA viruses, the interaction between the low-level dsRNA and PRRs remains unclear. We have developed a confocal microscopy method to visualize arenavirus dsRNA and PRR in individual cells.

Konfokale Abbildung von Double-Stranded RNA und Muster Anerkennung Rezeptoren im negativen Sinn-RNA-Virusinfektion

Double-stranded (ds) RNA is produced as a replicative intermediate during RNA virus infection. Recognition of dsRNA by host pattern recognition receptors ...

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 106 to 1 x 107 plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

Erzeugung, Verstärkung und Titration von rekombinanten Respiratory Syncytial Viren

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, ...

Rescue of Recombinant Zika Virus from a Bacterial Artificial Chromosome cDNA Clone

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines and/or antivirals have underscored the urgent need to develop ZIKV reverse genetic systems to facilitate the study of ZIKV biology and the development of therapeutic and/or prophylactic approaches. However, like with other flaviviruses, the generation of ZIKV full-length infectious cDNA clones has been hampered due to the toxicity of viral sequences during its amplification in bacteria. To overcome this problem, we have developed a nontraditional approach based on the use of bacterial artificial chromosomes (BACs). Using this approach, the full-length cDNA copy of the ZIKV strain Rio Grande do Norte Natal (ZIKV-RGN) is generated from four synthetic DNA fragments and assembled into the single-copy pBeloBAC11 plasmid under the control of the human cytomegalovirus (CMV) immediate-early promoter. The assembled BAC cDNA clone is stable during propagation in bacteria, and infectious recombinant (r)ZIKV is recovered in Vero cells after transfection of the BAC cDNA clone. The protocol described here provides a powerful technique for the generation of infectious clones of flaviviruses, including ZIKV, and other positive-strand RNA viruses, particularly those with large genomes that have stability problems during bacterial&#160;propagation.

The recent epidemic of Zika virus highlights the importance of establishing reverse genetic approaches to develop vaccines and/or therapeutic strategies. Here, we describe the protocol to rescue an infectious recombinant Zika virus from a full-length cDNA clone assembled in a bacterial artificial chromosome under the control of the human cytomegalovirus immediate-early promoter.

Rettung des rekombinanten Zika-Virus aus einem bakteriellen künstlichen Chromosom cDNA-Klon

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines ...

Bakterielle künstliche Chromosomen: A Functional Genomics-Werkzeug für das Studium der Positiv-Strang-RNA-Viren

Zusammenfassung

Weitere Videos entdecken

PLAYLIST