Name: mapping genome-wide accessible chromatin in primary human t lymphocytes by atac-seq
Uploaded: 2017-11-13T13:00:00.000+00:00
Duration: 9 min 8 s
Description: Watch this Scientific Journal Video about Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq at JoVE.com

Diese Arbeit wird unterstützt von der Israel Science Foundation (Grant 748/14), Marie-Curie-Integration gewähren (CIG) - RP7-Menschen-20013-CIG-618763 und -CORE Programm für Planung und Budgetierung Ausschuss und der Israel Science Foundation grant Nr. 41/11.

alle Verfahren wurden von institutionellen Review Board der Bar-Ilan-Universität angenommen und das Protokoll folgt den Richtlinien des Ausschusses zur Genehmigung der Experimente zur Verfügung gestellt.
 1. Reinigung von naiven CD4 + Zellen und Polarisation zu T-Helfer-1 (Th1) und Th2-Zellen Hinweis: hier beschreiben wir die Vorgehensweise, die gefrorenen menschlichen peripheren mononukleären Blutzellen (PBMCs) ab. Der erste Schritt besteht aus CD4 + Zellen mittels Microbeads zu isolieren und Spalten in der Regel geben uns mehr als 95 % der CD4 +-Zellen. Dieser Schritt kann jedoch nach dem bevorzugten Protokoll in jeder Übungseinheit variieren. Das Protokoll für T-Zell-Aktivierung und Polarisation wurde von Jenner Et Al. modifiziert. (2009) 18. Isolation der CD4 +-Zellen von 10 Millionen PBMCs gibt Anlass zu 4 Millionen der CD4 +-Zellen. Sie sind aufgeteilt in zwei Fläschchen und angebaut unter Th1 und Th2 polarisierenden Bedingungen nachgiebige 3 Millionen Th1 und Th2-Zellen innerhalb nur einer Woche.
 Hinweis: Abkühlen der Zentrifuge auf 4 ° C vor.
<ol><li>Tauen 1 mL der menschlichen PBMCs (10 7 Zellen) in ein 50 mL-Tube mit 10 mL RPMI Medium mit 1 % Penicillin-Streptomycin, 2 mM L-Glutamin und 10 % Hitze-inaktivierten fötalen Rinderserum ergänzt. Zentrifugieren bei 500 X g für 5 min. Überstands entfernen und die Zellen mit einer sterilen 25 mL-Pipette in 15 mL ergänzt RPMI Medium aufzuwirbeln. Die Zellen (mit sterilen 25-mL-Pipette) auf einem T75 Kultur Kolben übertragen.</li>
	<li>Lassen die Zellen über Nacht in einem befeuchteten Inkubator (37 ° C, 5 % CO 2).</li>
	<li>Übertragen die schwimmenden Zellen mit einer sterilen 25 mL-Pipette auf 50 mL-Tube. Zellzahl und Lebensfähigkeit durch Trypan blau Ausgrenzung bestimmen.</li>
	<li>Isolieren CD4 +-Zellen von 10 Millionen Leben nicht-anhaftende PBMCs durch positive Selektion mit CD4 + Microbeads und Spalten nach Angaben des Herstellers &#39; s Empfehlungen (siehe Tabelle der Materialien/Geräte) mit den folgenden Modifikationen: 10 7 PBMCs sind beschriftet mit 30 µL CD4 Microbeads in 120 µL 0,5 % BSA in PBS.</li>
	<li>Aktivieren der CD4 + T-Zellen für 72 h RhIL-2 (10 ng/mL), Platte gebundene Anti-CD3 (5 µg/mL) und lösliche Anti-CD28 (2 µg/mL). Fügen Sie für Th1 Polarisation RhIL-12 (20 ng/mL) und Anti-IL-4 (10 µg/mL). Für Th2 Polarisation, fügen RhIL-4 (40 ng/mL) und Anti-IFN-γ (10 µg/mL).</li>
	<li>Kultur der Zellen für weitere 7 Tage im Beisein von RhIL-2 (10 ng/mL) und die gleichen polarisierende Zytokine (RhIL-12 für Th1 und Th2 RhIL-4).</li>
</ol> 2. Kerne Isolation Hinweis: ATAC-Seq erfolgt mit intakten Zellkernen. Lyse Puffer mit 0,05 % Nonylphenyl Polyethylenglykol wurde (siehe Tabelle der Materialien/Geräte) für die Isolierung von Kernen aus primären menschlichen Th1 und Th2-Zellen kalibriert. Es wird empfohlen, diesen Schritt mit den Laborreagenzien und Zellen zu kalibrieren. Ein Übermaß an intakten Zellen von nicht genügend Reinigungsmittel verringert die Effizienz der Umsetzung Reaktion. Lyse Zelleffizienz richtet sich nach der Anzahl der Kerne (Trypan blau positive Zellen) bezogen auf die Gesamtzahl der Zellen. 
Hinweis: Bereiten Sie die Lyse-Puffer (10 mM Tris-HCl, pH 7,5, 10 mM NaCl, 3 mM MgCl 2). Abkühlen, eine Zentrifuge mit einem Swing-Eimer-Rotor bis 4 ° c die Zellen in einer Swing-Eimer-Zentrifuge anstelle einer festen Winkel Zentrifuge Pelletierung Zellkerne/Verlust reduziert. Zellkerne oder Zellverlust, Pipettieren sorgfältig, wenn den Überstand verwerfen zu vermeiden.
<ol><li>Add frischen Nonylphenyl Polyethylenglykol (um eine Endkonzentration von 0,05 %) und 100 x Protease-Inhibitoren (um eine Endkonzentration von 1 X) auf den kalten Lyse Puffer unmittelbar vor der Anwendung. Halten Sie den Puffer auf Ice</li>
	<li>Graf T-Zellen, und ihre Lebensfähigkeit Trypan blau-Methode bestimmen. Rentabilität, die niedriger ist als 90 % ergibt höhere unspezifische Verdauung.</li>
	<li>Übertragung 0,5 x 10 6 T Zellen (Th1 oder Th2) 1,5 mL Mikroröhrchen. Spin-down bei 500 X g für 5 min bei 4 ° c</li>
	<li>Aufschwemmen der Zelle Pellet in 1 mL kalte Phosphat-gepufferte Kochsalzlösung (PBS) Lösung. Spin-down bei 500 X g für 5 min bei 4 ° c</li>
	<li>Aufschwemmen der Zelle Pellet in 1 mL kalte Lyse Puffer (mit Nonylphenyl Polyethylenglykol und Protease-Inhibitoren). Halten Sie das Rohr auf dem Eis. Pipette vorsichtig, um nicht zu stören die Kerne.</li>
	<li>Schnell 10 µL und die Zellen mit einem automatisierten Zelle Zähler zählen, während die Reaktionscup mit lysierten Zellen auf dem Eis ist. Dieser Schritt sollte fünf Minuten zur Vermeidung von Schäden die Kerne nicht überschreiten. Sollte mindestens 80 % der Zellen lysiert werden.</li>
	<li>Weiter sofort mit der Umsetzung-Reaktion. Halten Sie die vorbereitete Kerne auf der Ice</li>
</ol> 3. Umsetzung Reaktion Hinweis: In diesem Schritt sind isolierte Kerne mit prokaryotischen Tn5 Transposase (TDE1) beladen mit Adapter für die Sequenzierung von NGS inkubiert. Hyperaktiv Tn5 gleichzeitig DNA-Fragmente und ligates Adapter in zugänglichen Bereichen des Genoms (Tagmentation Verfahren). Das Verhältnis zwischen Kernen und Tn5 Transposase ist entscheidend für bevorzugte Spaltung an zugänglich Chromatin. Dieses Protokoll ist für 100.000 Kerne in einer 100 μl Reaktionsvolumen kalibriert. Jedoch kann die Reaktion nach unten skaliert werden.
<ol><li>Stellen Sie Temperatur in einem thermischen Shaker auf 37 ° c</li>
	<li>Transfer 100.000 Kerne auf einem 1,5 mL Reaktionscup.</li>
	<li>Zentrifuge bei 500 X g für 10 min bei 4 ° C und sanft entfernen des Überstands.</li>
	<li>Den Kernen als gemäß Tabelle 1 die Umsetzung Reaktionskomponenten hinzufügen.</li>
	<li>Durch sanfte Pipettieren Aufschwemmen.</li>
	<li>Brüten die Umsetzung Reaktion in einem thermischen Shaker bei 37 ° C für 30 min mit sanften Zittern (500 u/min). 
	Hinweis: DNA-Bereinigung erfolgt durch reversible Immobilisierung Festphasen-Perlen 19 (siehe Tabelle der Materialien/Geräte) oder PCR-Reinigung-Spalten. Am Ende der Reinigung eluieren Sie die DNA-Fragmente in 20 µL 10 mM Tris-HCl, pH 8. Vermeiden Sie EDTA in der Elution Buffer.</li>
</ol> 4. PCR-Bereicherung der ATAC-Seq Bibliotheken Hinweis: Diese Schritt zielt darauf ab, die ATAC-Seq Bibliothek z. B. DNA-Fragmente mit eingefügten Adapter zu verstärken. Ermöglichen, Mischen mehrerer ATAC-Seq-Bibliotheken in der gleichen Spur Next Generation Sequencing (&#34; multiplexing &#34;) Nutzung nichtindizierte Primer 1 (Ad1_noMx) 1 für alle Proben und ein anderes indiziert (Barcode) Primer 2 (Ad 2.1-2.24) 1 für jede Probe. Die Primer-Sequenzen werden in der ergänzten Tabelle von Material/Ausrüstung zur Verfügung gestellt.
<ol><li>Erste PCR Verstärkung Hinweis: die Arbeit Konzentration der Primer 1 (Ad1_noMx) und Primer 2 ist 25 µM. Die Primer werden vom ursprünglichen Bestand von 100 µM bis 25 µM verdünnt. Verwenden Sie in allen PCR-Reaktionen Primer 1 (Ad1_noMx) und nur einer der indizierten Primer 2.
	<ol><li>Gemäß Tabelle 2 in ein steriles Röhrchen PCR die Komponenten der PCR-Reaktion Agrega.</li>
		<li>Ort-PCR Tubus in einem Thermocycler und PCR-Amplifikation mit dem Radsport in Tabelle 3 aufgeführten Bedingungen erfüllen.</li>
	</ol></li> <li>Beurteilung der Anzahl der zusätzlichen Verstärkung Zyklen Hinweis: die Anzahl der zusätzliche PCR-Zyklen sollten ausreichenden Menge an Bibliothek Fragmente f Ausbeuteoder eine erfolgreiche Sequenzierung der nächsten Generation ausgeführt, während zur Vermeidung von GC und Größe Bias 20 minimiert. Die Bestimmung der Anzahl der PCR-Zyklen (N) erforderlich für optimale Bibliothek Fragment Verstärkung erfolgt durch quantitative PCR (qPCR).
	<ol><li>Verdünnen Primer 1 (Ad1_noMx) und 2 (verwendet für die erste Bibliothek Verstärkung) von 25 µM bis 6,25 µM.</li>
		<li>Komponenten zu optischen PCR-Röhrchen oder eine Platte hinzufügen, wie in Tabelle 4 angegeben.</li>
		<li>In eine qPCR Instrument und Zyklus gemäß Tabelle 5.</li>
		<li>Zur Ermittlung der erforderlichen Anzahl von zusätzlichen Verstärkung Zyklen (N) plot Zykluszahl auf der x-Achse und relative Fluoreszenz (RFU) auf der y-Achse.</li>
		<li>Die Anzahl der zusätzlichen Verstärkung Zyklen (N) ist 1/3 der Anzahl der Zyklen die qPCR-Reaktion die Hochebene erreichte. Abbildung 2 enthält Beispiele für die drei ATAC-Seq-Bibliotheken, die Plateau ~ 2.350 relative Fluoreszenz Einheiten, RFU (dicke grüne Linie) erreicht. Die Anzahl der PCR-Zyklen, in denen ein Drittel des maximalen Betrages (783 RFU, markiert auf y-Achse) verstärkt, entspricht 8 Zyklen für zwei Bibliotheken (rot und blau Verstärkung Kurven) und 9 PCR-Zyklen für die dritte Bibliothek (rosa).</li>
	</ol></li> <li>Letzte PCR Verstärkung <ol><li>verstärken die restlichen 45 µL des PCR-Reaktion. Legen Sie ein PCR-Röhrchen mit Verstärkung Reaktion aus Schritt 4.1.2 in einem Thermocycler. Führen Sie das in Tabelle 6 beschriebenen PCR-Programm aus. Verwenden Sie die zuvor ermittelte (4.2.5) Schrittnummer Verstärkung Zyklen (N).</li>
	</ol></li></ol> 5. Größe Auswahl der Bibliotheken der ATAC-Seq Hinweis: nach unserer Erfahrung verbessert die Größenauswahl des verstärkten ATAC-Seq-Bibliotheken Next Generation Sequencing Ergebnisse, da hochmolekularen Bibliothek Fragmente aus beseitigt die abschließende ATAC-Seq Bibliothek. 
Hinweis: Lassen Sie die magnetische Beads auf Zimmertemperatur 30 min vor Gebrauch erwärmen. 
Bereiten Sie frische 70 % Ethanol in Nuklease-freies Wasser.
<ol><li>Aufschwemmen der magnetischen Kügelchen durch das Mischen von.</li>
	<li>Der ATAC-Seq-Bibliotheken (abgerufen im Schritt 4.3.1.) Nuklease-freies Wasser hinzu und bringen bis zu 100 µL.</li>
	<li>Fügen Sie 50 µL (0,5 X) der resuspendierte DNA-Bindung magnetische Beads zu 100 µL der verstärkten Bibliotheken. Durch Pipettieren oben und unten mindestens 10 Mal mischen. Inkubieren Sie Beispiele für 5 min bei Raumtemperatur. Bei Bedarf schnell spin-down der Mikroröhrchen.</li>
	<li>Legen Sie das Rohr auf eine entsprechende Magnetstativ für 2 min der Überstand der magnetischen Kügelchen trennen. Nach 2 min übertragen den Überstand auf eine neue Reaktionscup.</li>
	<li>Messen Sie das Volumen des Überstands von pipettieren und 0,7 x magnetische Beads hinzufügen. Mix von Pipettieren oben und unten mindestens 10 Mal.</li>
	5 min bei Raumtemperatur inkubieren Sie <li>. Auf einem Magnetstativ für 2 min.</li>
	<li>Nach 2 min Inkubation, verwerfen den überstand. Fügen Sie 200 µL frisch 70 % Ethanol um die Perlen zu waschen, während die Rohre auf die Magnetstativ.</li>
	<li>Halten die Reaktionscup auf den Magneten für 30 s und dann verwerfen das Ethanol. Wiederholen Sie die Schritt 5.7.for zwei endgültige Ethanol Wäschen.</li>
	<li>Vollständig entfernen, die restlichen Ethanol und lassen Sie die Perlen für 5 min an der Luft trocknen während der Schlauch auf den Magneten ist. Falls erforderlich, kurz drehen Sie die Reaktionscup. Entfernen Sie die Spuren von Ethanol mit einer Pipettenspitze p10.</li>
	<li>Die Reaktionscup vom Magneten zu entfernen und fügen Sie 22 µL 10 mM Tris-HCl, pH 8. Nicht die ATAC-Seq-Bibliotheken in Puffer mit EDTA eluieren.</li>
	<li>Schlauch für 2 min bei Raumtemperatur inkubieren und dann auf die Magnetstativ.</li>
	<li>Wenn die Lösung klar ist, übertragen 20 µL der eluierten Bibliotheken auf eine neue sterile Reaktionscup.</li>
	<li>Store die Größe ausgewählt ATAC-Seq Bibliotheken bei-20 ° c</li>
</ol> 6. Qualitätsanalyse der ATAC-Seq Bibliotheken <ol><li>Überprüfung der Qualität der ATAC-Seq-Bibliotheken von Real-Time PCR Hinweis: Es ist wichtig zu beurteilen, das Signal Rauschabstand der ATAC-Seq-Bibliotheken vor der nächsten Generation Sequenzierung. Dies erfolgt durch die Bestimmung der relativen Höhe der DNA-Fragmente aus zugängliche und unzugängliche Loci mittels quantitativen PCR (qPCR). Die unzugänglichen Loci (negative Kontrolle, Chr1:48, 137, 860-48,137,934 und Chr1:193, 093, 748-193,093,827) werden verstärkt durch Grundierung Paare 1 und 2. Die zugänglichen Loci (Positivkontrolle, Chr19:30, 336, 166-30,336,253 und Chr19:11546154-11546237) werden verstärkt durch Primer-Paaren 3 und 4. Positive und negative Loci wurden von Chromatin Zugänglichkeit (DHS-Seq) Profile von menschlichen CD4 + Zellen (ENCODE Beitritte, ENCSR000EQE und ENCSR000EQG) definiert. Negativen Primer 1 befindet sich in einer großen heterochromatischen intergenetischer Region (230 kb, vom TRADB2 und vom FOXD2 88 kb). Negativkontrolle Region 2 befindet sich der ersten Intron des CDC73-Gens. Positiv Primerpaar 3 innerhalb einer offenen Chromatin-Region ist stromabwärts des Gens Cyclin E (CCNE1), während positive Primerpaar 4 innerhalb der Projektträger von Protein-Kinase C Substrat 80K-H (PRKCSH) zentriert. Wichtig ist, zeigen diese Kontrolle Loci ein ähnliches Muster der Barrierefreiheit in anderen menschlichen Zelltypen aus das ENCODE-Projekt 3, was darauf hindeutet, dass sie können, zur Überwachung der ATAC-Seq-Bibliotheken aus einem breiten Spektrum an menschlichen Zelltypen angewendet werden. Primer-Effizienz und Spezifität von alle Primer-Paaren wurde vom qPCR auf eine serielle Verdünnung von genomischer DNA (aus menschlichen Th-Zellen) und einer schmelzenden Kurvenanalyse der erhaltenen amplifizierten Produkte nachgeprüft.
	<ol><li>Isolierung genomischen DNA mit einem handelsüblichen kit (siehe Tabelle der Materialien/Geräte).</li>
		<li>Verdünnen der verstärkten ATAC-Seq Bibliothek 01:10 (1 µL Bibliothek + 9 µL Nuklease-freies Wasser) und genomischer DNA, ~ 5 ng/µL.</li>
		<li>Bereiten Reaktionsgemisch (Tabelle 7) für jede positive und negative Kontrolle Primerpaar, unter Berücksichtigung, dass die Reaktionen in dreifacher Ausführung durchgeführt werden.</li>
		<li>Inkubation in qPCR Thermocycler nach dem Protokoll von qPCR master-Mix Lieferanten empfohlen.</li>
		<li>Analyse der Ergebnisse in qPCR Instrument &#39; s Software (siehe Tabelle der Materialien/Geräte). Wählen Sie genomischen DNA als ein Beispiel für ein Steuerelement. Die erhaltenen Werte stellen eine Bereicherung der zugänglichen Regionen (verstärkt durch Positivkontrolle Primer). Ein Beispiel ist in Tabelle 8 dargestellt. 
		Hinweis: Schätzung der durchschnittlichen Bibliotheksgröße und Konzentration: die Größenverteilung der DNA-Fragmente von ATAC-Seq Bibliotheken richtet sich nach hoher Empfindlichkeit automatisierte Elektrophorese Systeme laut Hersteller &#39; Anweisungen. Es ist ratsam, die Probenkonzentration auf einem Fluorometer mit DsDNA hochempfindlichen Kit und mindestens 2 µL jeder DNA-Probe zu messen. 
		Hinweis: Next Generation Sequencing - vor multiplexing der Bibliotheken, das Molarity jeder ATAC-Seq-Bibliothek mit der Formel berechnen: (ng/µL X 10 6) / (660 x durchschnittliche Bibliothek fragment Länge). Ziel ist es für &#62; 30 Millionen liest jeder ATAC-Seq-Bibliothek geöffnet Chromatin bewerten Regionen des humanen Proben. Wenn Sie möchten ermitteln, ob die Bibliothek gut genug für die NGS Sequenzierung ist, streben Sie zunächst 10 Millionen Mal gelesen (5 % der Sequenzierung Fahrspur auf DNA-Sequenzierung Instrument im schnellen Modus). Denken Sie daran, dass um Nukleosom Positionierung ableiten, gepaart-End Sequenzierung benötigten 1.</li>
	</ol></li></ol> 7. Analyse der erhaltenen Next-Generation Sequenzierung Ergebnisse <ol><li>die Qualität der Sequenzierung lautet durch die Überprüfung der FastQC-Dateien separat für jede Bibliothek ableiten.</li>
	<li>Ausrichten der Lesezugriffe auf menschlichen Bezug Genom (hg19 Montage) mit Bowtie 21 Software in der Unix/Linux-Umgebung. Der Befehl ist &#39; Fliege -m 1 - Q -S Genom Verzeichnis reads.fastq output_aligned.sam &#39;. Genom-Verzeichnis steht für den Ordner wo die Genom-Indizes der Bowtie gespeichert sind. Die Parameter-m 1 ist für das erlauben nicht die Ausrichtung der Lesezugriffe auf mehr als einem Ort im Genom, - Q ist die Eingabedatei, die im Fastq Format sein sollte, -S ist für die Ausgabe, die im SAM-Format ist.</li>
	<li>Entfernen Sie doppelte liest mit SAMtools 22 Rmdup-Option in der Unix/Linux-Umfeld. Die Befehle sind &#39; Samtools anzeigen -S output_aligned.sam -b | SamTools sortieren -o-Output_aligned &#62; output_aligned.bam &#39;, Samtools Rmdup -s output_aligned.bam Output_aligned _rmdup.bam &#39;. Der erste Befehl Ansicht ändert das SAM-Format in BAM-Format, die dann sortiert ist. Die Möglichkeit der Rmdup wird dann auf die sortierten BAM-Datei angewendet. Optional kann man die lautet für die Insertionsstelle Transposon einstellen, wie in der ursprünglichen ATAC-Seq Papier 1 beschrieben. Dies geschieht mittels BEDtools Befehle 23 im Unix/Linux-Umfeld. Die Befehle sind &#39; BamToBed -i Output_aligned _rmdup.bam &#62; Output_aligned _rmdup.bed &#39;, &#39; ShiftBed -i Output_aligned _rmdup.bed -p-4 - m-5 - g-Genom &#62; Output_aligned _rmdup_adjusted.bed &#39;. Der erste Befehl, BamTobed, ändert das BAM-Format ins Bett-Format, welches dann für den ShiftBed-Befehl verwendet werden kann. Die Genom-Datei ist eine Registerkarte durch Trennzeichen getrennte Datei, die die Länge jedes Chromosom im Genom enthält. Die Datei wird in der Regel in das BEDtools Verzeichnis hinzugefügt.</li>
	<li>Perform Peak Berufung mit modellbasierte Analyse der ChIP-Seq (MACS2) 24-Software in der Unix/Linux-Umgebung auf die verschobene Bett-Datei mit den folgenden Parametern:--Nomodel--Extsize 75---30 zu verlagern. Diese Parameter werden verwendet, um die lautet so einstellen, dass die Einstichstelle Transposon in der Mitte jeder Sequenzierung lesen ist.</li>
</ol>

<ol>
	<li>Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposition+of+native+chromatin+for+fast+and+sensitive+epigenomic+profiling+of+open+chromatin,+DNA-binding+proteins+and+nucleosome+position.">Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position.</a> Nat Methods. 10 (12), 1213-1218 (2013).</li><li>Buenrostro, J. D., Wu, B., Chang, H. Y., Greenleaf, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATAC-seq:+A+method+for+assaying+chromatin+accessibility+genome-wide.">ATAC-seq: A method for assaying chromatin accessibility genome-wide.</a> Curr Protoc Mol Biol. , 21.29.1-21.29.9 (2015).</li><li>Thurman, R. E., Rynes, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+accessible+chromatin+landscape+of+the+human+genome.">The accessible chromatin landscape of the human genome.</a> Nature. 489 (7414), 75-82 (2012).</li><li>Song, L., Crawford, G. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNase-seq:+a+high-resolution+technique+for+mapping+active+gene+regulatory+elements+across+the+genome+from+mammalian+cells.">DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells.</a> Cold Spring Harb Protoc. (2), (2010).</li><li>Simon, J. M., Giresi, P. G., Davis, I. J., Lieb, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+formaldehyde-assisted+isolation+of+regulatory+elements+(FAIRE)+to+isolate+active+regulatory+DNA.">Using formaldehyde-assisted isolation of regulatory elements (FAIRE) to isolate active regulatory DNA.</a> Nat Protoc. 7 (2), 256-267 (2012).</li><li>Cui, K., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-Wide+Approaches+to+Determining+Nucleosome+Occupancy+in+Metazoans+Using+MNase-Seq.">Genome-Wide Approaches to Determining Nucleosome Occupancy in Metazoans Using MNase-Seq.</a> Methods Mol Biol. 833, 413-419 (2012).</li><li>Qu, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Individuality+and+Variation+of+Personal+Regulomes+in+Primary+Human+T+Cells.">Individuality and Variation of Personal Regulomes in Primary Human T Cells.</a> Cell Syst. 1 (1), 51-61 (2015).</li><li>Scharer, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATAC-seq+on+biobanked+specimens+defines+a+unique+chromatin+accessibility+structure+in+na&#239;ve+SLE+B+cells.">ATAC-seq on biobanked specimens defines a unique chromatin accessibility structure in na&#239;ve SLE B cells.</a> Sci Rep. 6, 27030 (2016).</li><li>Seb&#233;-Pedr&#243;s, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Dynamic+Regulatory+Genome+of+Capsaspora+and+the+Origin+of+Animal+Multicellularity.">The Dynamic Regulatory Genome of Capsaspora and the Origin of Animal Multicellularity.</a> Cell. 165 (5), 1224-1237 (2016).</li><li>Lu, Z., Hofmeister, B. T., Vollmers, C., DuBois, R. M., Schmitz, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combining+ATAC-seq+with+nuclei+sorting+for+discovery+of+cis-regulatory+regions+in+plant+genomes.">Combining ATAC-seq with nuclei sorting for discovery of cis-regulatory regions in plant genomes.</a> Nucleic Acids Res. 45 (6), e41 (2016).</li><li>Davie, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Transcription+Factors+and+Regulatory+Regions+Driving+In+Vivo+Tumor+Development+by+ATAC-seq+and+FAIRE-seq+Open+Chromatin+Profiling.">Discovery of Transcription Factors and Regulatory Regions Driving In Vivo Tumor Development by ATAC-seq and FAIRE-seq Open Chromatin Profiling.</a> PLOS Genet. 11 (2), (2015).</li><li>Villar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancer+Evolution+across+20+Mammalian+Species.">Enhancer Evolution across 20 Mammalian Species.</a> Cell. 160 (3), 554-566 (2015).</li><li>Lara-Astiaso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+state+dynamics+during+blood+formation.">Chromatin state dynamics during blood formation.</a> Science. 345 (6199), 943-949 (2014).</li><li>Prescott, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancer+Divergence+and+cis-Regulatory+Evolution+in+the+Human+and+Chimp+Neural+Crest.">Enhancer Divergence and cis-Regulatory Evolution in the Human and Chimp Neural Crest.</a> Cell. 163 (1), 68-83 (2015).</li><li>Wu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+landscape+of+accessible+chromatin+in+mammalian+preimplantation+embryos.">The landscape of accessible chromatin in mammalian preimplantation embryos.</a> Nature. 534 (7609), 652-657 (2016).</li><li>Buenrostro, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+chromatin+accessibility+reveals+principles+of+regulatory+variation.">Single-cell chromatin accessibility reveals principles of regulatory variation.</a> Nature. 523 (7561), 486-490 (2015).</li><li>Corces, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lineage-specific+and+single-cell+chromatin+accessibility+charts+human+hematopoiesis+and+leukemia+evolution.">Lineage-specific and single-cell chromatin accessibility charts human hematopoiesis and leukemia evolution.</a> Nat Genet. 48 (10), 1193-1203 (2016).</li><li>Jenner, R. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+T-bet+and+GATA-3+control+alternative+pathways+of+T-cell+differentiation+through+a+shared+set+of+target+genes.">The transcription factors T-bet and GATA-3 control alternative pathways of T-cell differentiation through a shared set of target genes.</a> Proc Natl Acad Sci USA. 106 (42), 17876-17881 (2009).</li><li>DeAngelis, M. M., Wang, D. G., Hawkins, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solid-phase+reversible+immobilization+for+the+isolation+of+PCR+products.">Solid-phase reversible immobilization for the isolation of PCR products.</a> Nucleic Acids Res. 23 (22), 4742-4743 (1995).</li><li>Aird, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyzing+and+minimizing+PCR+amplification+bias+in+Illumina+sequencing+libraries.">Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries.</a> Genome Biol. 12 (2), R18 (2011).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., Handsaker, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+Analysis+of+ChIP-Seq+(MACS).">Model-based Analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Meyer, C. A., Shirley Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+and+mitigating+bias+in+next-generation+sequencing+methods+for+chromatin+biology.">Identifying and mitigating bias in next-generation sequencing methods for chromatin biology.</a> Nat Rev Genet. 15 (11), 709-721 (2014).</li><li>He, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refined+DNase-seq+protocol+and+data+analysis+reveals+intrinsic+bias+in+transcription+factor+footprint+identification.">Refined DNase-seq protocol and data analysis reveals intrinsic bias in transcription factor footprint identification.</a> Nat Methods. 11 (1), 73-78 (2013).</li><li>Madrigal, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+Accounting+for+Sequence-Specific+Bias+in+Genome-Wide+Chromatin+Accessibility+Experiments:+Recent+Advances+and+Contradictions.">On Accounting for Sequence-Specific Bias in Genome-Wide Chromatin Accessibility Experiments: Recent Advances and Contradictions.</a> Front Bioeng Biotechnol. 3, 1-4 (2015).</li><li>Qin, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChiLin:+a+comprehensive+ChIP-seq+and+DNase-seq+quality+control+and+analysis+pipeline.">ChiLin: a comprehensive ChIP-seq and DNase-seq quality control and analysis pipeline.</a> BMC Bioinformatics. 17 (1), (2016).</li><li>Bao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+ATAC-seq+approach+reveals+lineage-specific+reinforcement+of+the+open+chromatin+landscape+via+cooperation+between+BAF+and+p63.">A novel ATAC-seq approach reveals lineage-specific reinforcement of the open chromatin landscape via cooperation between BAF and p63.</a> Genome Biol. 16 (1), 284 (2015).</li><li>Maurano, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+localization+of+common+disease-associated+variation+in+regulatory+DNA.">Systematic localization of common disease-associated variation in regulatory DNA.</a> Science. 337 (6099), 1190-1195 (2012).</li></ol>

Die Autoren haben nichts preisgeben.

Das hier beschriebene ATAC-Seq-Protokoll erfolgreich eingesetzte für die Analyse von zugänglich Chromatin in primäre Zellen (menschliche Th1, Th2 Zellen und B-Zellen) sowie die kultivierten Zelllinien (MCF10A menschlichen Brustkrebszellen und U261-Glioblastom-Zellen). Andere Zelltypen ATAC-Seq zuweisen kann einige Protokoll-Optimierung, vor allem in der Lyse Schritt erfordern. Wenn die Konzentration von nichtionischen Waschmittel zu hoch ist, liegt möglicherweise ein höherer Prozentsatz der mitochondrialen DNA-Konta...

ATAC-Seq1,2 ist eine robuste Methode, die Ermittlung der regulatorischen3 offene Chromatin Regionen und Nukleosom Positionierung ermöglicht. Diese Information gilt für ableiten, die Lage, die Identität und die Aktivität von Transkriptionsfaktoren. Die Methode Empfindlichkeit zur Messung der quantitative Abweichungen in Chromatinstruktur ermöglicht die Untersuchung der Aktivität von Chromatin Faktoren, einschließlich Chromatin Remodelers und Modifikatoren sowie die transkriptionelle Aktivität der RNA-Polymerase II1. ATAC-Seq bietet somit einen leistungsstarke und unvoreingenommenen Ansatz für die Entschlüsselung der Mechanismen, die transkriptionelle Regulierung in jeden Zelltyp des Interesses zu regieren. Wir beschreiben die Anpassung der ATAC-Seq an primären menschlichen Th1 und Th2-Zellen.
ATAC-Seq geladen hyperaktiven Tn5 Transposase mit Adaptern für Next Generation Sequencing (NGS) Paare DNA-Fragmentierung mit tagging von DNA mit Adaptern (d.h. der Prozess "Tagmentation")1. Nach PCR-Amplifikation sind die daraus resultierenden DNA-Bibliotheken bereit für Next Generation Sequencing (Abbildung 1). Die bevorzugte Tagmentation von zugänglich Chromatin wird durch die Analyse der lokalen Bereicherung der ATAC-Seq Sequenzierung liest erkannt.
Die kurze Versuchsdurchführung und Voraussetzung für weniger Ausgangsmaterial, im Vergleich zu anderen Methoden zur Messung von Chromatin Zugänglichkeit und nucleosomal Positionierung z. B. DNase-Seq4und FAIRE Seq5MNase-Seq6, hat die Verwendung von ATAC-Seq in mehrere biologische Systeme, einschließlich menschliche Primärzellen1,7 und klinischen Proben8, sowie Einzeller9, Pflanzen10, Fruchtfliegen11 gefördert , und verschiedene Säugetiere12.
Die Identität der Transkription, die Faktoren, die an zugänglich Loci gebunden sind durch Analyse der Anreicherung von ihrer Bindung Sequenzmotive oder Kombination von ATAC-Seq mit Chromatin Immunopräzipitation (ChIP) gefolgt von Hochdurchsatz-DNA-Sequenzierung (aufgedeckt werden können ChIP-seq). Dieser Ansatz ermöglicht die Identifizierung von Geschlecht-spezifische Transkriptionsfaktoren wichtig für die Blutbildung Maus13. Die unvoreingenommene und globale Natur der ATAC-Seq ermöglicht Studium der Genregulation in Organismen für die Reagenzien wie Antikörper gegen ChIP-Analyse nicht verfügbar sind. Z. B. evolutionäre Variationen in Cis-regulatorische Regionen wurden durch das Studium der kranialen Neuralleiste Zellen von Menschen und Schimpansen14, Entwicklungsstörungen Variationen in regulatorischen Elemente während der frühen Maus Embryogenese15, ändert in der regulatorischen Landschaft während einer Lebensdauer von einzelligen C. Owzarzaki9und die Entwicklung der Promotoren und Enhancer über 20 Säugetier Arten12.
ATAC-Seq war auch maßgeblich für die Messung von Chromatin Barrierefreiheit in Einzelzellen, so aufschlussreich Variabilität innerhalb Zell-Populationen, die in der Regel genomweite Studien7,16entzieht. ATAC-Seq kann darüber hinaus verwendet werden, um Veränderungen zu studieren, die in regulatorischen Regionen der DNA in Erkrankungen, auftreten, in denen Proben selten sind. Z. B. ATAC-Seq kann verwendet werden, um Veränderungen im regulatorischen Umfeld zu studieren, während der Beginn der akuten myeloischen Leukämie (AML)17 oder Ras-Onkogenese11angetrieben.

<table><tbody><tr><td>50 mL tubes</td><td>Lumitron</td><td>LUM-CFT011500-P</td><td>Can be from other vendors.</td></tr><tr><td>Microtubes</td><td>Axygen Inc</td><td>MCT-175-C</td><td>Can be from other vendors.</td></tr><tr><td>25 mL serological pipettes</td><td>Corning Costar</td><td>4489</td><td>Can be from other vendors.</td></tr><tr><td>Tissue culture flask</td><td>Lumitron</td><td>LUM-TCF-012-250-P</td><td>Can be from other vendors.</td></tr><tr><td>Countes Automated Cell Counter</td><td>Invitrogen</td><td>C10227</td><td></td></tr><tr><td>NucleoSpin Tissue</td><td>MACHEREY-NAGEL</td><td>740952.5</td><td></td></tr><tr><td>Peripheral blood mononuclear cells&amp;nbsp;(PBMC)</td><td>ATCC</td><td>&amp;nbsp;PCS&amp;shy;800&amp;shy;011</td><td>Can be from other vendors.</td></tr><tr><td>RPMI 1640 Medium</td><td>Biological Industries</td><td>01-103-1A</td><td>Can be from other vendors.</td></tr><tr><td>L-Glutamine Solution (200 mM)</td><td>Biological Industries</td><td>03-020-1B</td><td>Can be from other vendors.</td></tr><tr><td>Penicillin-Streptomycin</td><td>Biological Industries</td><td>03-031-1B</td><td>Can be from other vendors.</td></tr><tr><td>Fetal Bovine Serum (FBS),&amp;nbsp;Heat Inactivated, European Grade</td><td>Biological Industries</td><td>04-127-1</td><td>Can be from other vendors.</td></tr><tr><td>MACS CD4 microbeads, human</td><td>Miltenyi Biotec</td><td>130-045-101</td><td></td></tr><tr><td>MACS MS columns</td><td>Miltenyi Biotec</td><td>130-042-201</td><td></td></tr><tr><td>Anti-Human CD4 FITC</td><td>Biogems</td><td>06121-50</td><td></td></tr><tr><td>Mouse IgG1 Isotype Control FITC</td><td>Biogems</td><td>44212-50</td><td></td></tr><tr><td>Anti-Human CD3 (OKT3)</td><td>Tonbo biosciences</td><td>40-0037</td><td></td></tr><tr><td>Anti-Human CD28 SAFIRE Purified</td><td>Biogems</td><td>10311-25</td><td></td></tr><tr><td>Recombinant Human IL2</td><td>Peprotech</td><td>200-02</td><td></td></tr><tr><td>Recombinant Human IL4</td><td>Peprotech</td><td>200-04</td><td></td></tr><tr><td>Recombinant Human IL12 p70</td><td>Peprotech</td><td>200-12</td><td></td></tr><tr><td>In Vivo Ready Anti-Human IL-4 (MP4-25D2)</td><td>Tonbo</td><td>40-7048</td><td></td></tr><tr><td>LEAF&amp;nbsp;Purified anti-human IFN-&amp;gamma;</td><td>BioLegend</td><td>506513</td><td></td></tr><tr><td>NaCl, analytical grade</td><td>Carlo Erba</td><td>479687</td><td>Can be from other vendors.</td></tr><tr><td>Magnesium chloride, Hexahydrate, molecular biology grade</td><td>Calbiochem</td><td>442611</td><td>Can be from other vendors.</td></tr><tr><td>EDTA</td><td>MP Biomedicals</td><td>800682</td><td>Can be from other vendors.</td></tr><tr><td>Tris, ultra pure, 99.9% pure</td><td>MP Biomedicals</td><td>819620</td><td>Can be from other vendors.</td></tr><tr><td>NP-40 alternative (Nonylphenyl Polyethylene Glycol)</td><td>Calbiochem</td><td>492016</td><td>Can be from other vendors.</td></tr><tr><td>Protease Inhibitors</td><td>Sigma</td><td>P2714</td><td>this protease inhibitor coctail is a powder. To make 100 x solution dilute in 1 mL of molecular-biology grade water.</td></tr><tr><td>Magnetic solid phase reverse immobilization beads: AMPure XP beads</td><td>Beckman</td><td>63881</td><td></td></tr><tr><td>PCR purification kit</td><td>HyLabs</td><td>EX-GP200</td><td>Can be from other vendors.</td></tr><tr><td>Nextera DNA Library Preparation Kit (TDE1 transposase and TD buffer)</td><td>Illumina</td><td>FC-121-1030</td><td></td></tr><tr><td>NEBNext High-Fidelity 2 x PCR Master Mix</td><td>New England BioLabs</td><td>M0541</td><td></td></tr><tr><td>NEBNext Q5 Hot Start HiFi PCR Master Mix</td><td>New England BioLabs</td><td>M0543</td><td></td></tr><tr><td>SYBR Green I&amp;nbsp;</td><td>Invitrogen</td><td>S7585</td><td></td></tr><tr><td>&amp;nbsp;CFX Connect Real-Time PCR&amp;nbsp;Detection&amp;nbsp;System</td><td>Bio-rad</td><td>185-5200</td><td>Can be from other vendors.</td></tr><tr><td>CFX Manager Software</td><td>Bio-rad</td><td>1845000</td><td></td></tr><tr><td>master mix for qPCR: iTaq Universal SYBR Green Supermix</td><td>Bio-rad</td><td>172-5124</td><td>Can be from other vendors.</td></tr><tr><td>Qubit fluorometer 2.0</td><td>Invitrogen</td><td>Q32866</td><td></td></tr><tr><td>Qubit dsDNA HS Assay Kit</td><td>Invitrogen</td><td>Q32854</td><td></td></tr><tr><td>Magnet for eppendorf tubes</td><td>Invitrogen</td><td>12321D</td><td>Can be from other vendors.</td></tr><tr><td>Swing bucket cooling centrifuge with the buckets for 15 mL falcon tubes and eppendorf tubes</td><td>Thermo Scientific</td><td>75004527</td><td>Could be from other vendors. It is important that it has buckets for eppendorf tubes.</td></tr><tr><td>Thermo-shaker</td><td>MRC</td><td></td><td>Can be from other vendors.</td></tr><tr><td>High Sensitivity D1000 ScreenTape</td><td>Agilent Technologies</td><td>5067-5584</td><td></td></tr><tr><td>High Sensitivity D1000 Reagents</td><td>Agilent Technologies</td><td>5067-5585</td><td></td></tr><tr><td>4200 TapeStation system</td><td>Agilent Technologies</td><td>G2991AA</td><td>Tape-based platform for&amp;nbsp; electrophoresis</td></tr><tr><td>High Sensitivity DNA kit</td><td>Agilent Technologies</td><td>5067-4626</td><td>Reagent for high-sensitivity TapeStation analysis</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>Primer name and sequence</td><td>Company</td><td></td><td></td></tr><tr><td>Ad1_noMX: 5&#039;-AATGATACGGCGACCACCGAGA&lt;br/&gt; TCTACACTCGTCGGCAGCGTC&lt;br/&gt; AGATGTG-3&#039;</td><td>IDT</td><td></td><td>Ad1-noMx: 5&#039;-P5 sequence-transposase sequence-3&#039;</td></tr><tr><td>Ad2.1_TAAGGCGA: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[TCGCCTTA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.1_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.2_CGTACTAG: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[CTAGTACG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.2_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.3_AGGCAGAA: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[TTCTGCCT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.3_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.4_TCCTGAGC: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[GCTCAGGA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.4_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.5_GGACTCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGAGTCC]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.5_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.6_TAGGCATG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CATGCCTA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.6_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.7_CTCTCTAC: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[GTAGAGAG]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.7_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.8_CAGAGAGG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CCTCTCTG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.8_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.9_GCTACGCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGCGTAGC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.9_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.10_CGAGGCTG: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[CAGCCTCG]GTCTCGTGG&lt;br/&gt; GCTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.10_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.11_AAGAGGCA: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[TGCCTCTT]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.11_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.12_GTAGAGGA: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[TCCTCTAC]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.12_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.13_GTCGTGAT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ATCACGAC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.13_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.14_ACCACTGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACAGTGGT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.14_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.15_TGGATCTG: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CAGATCCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.15_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.16_CCGTTTGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACAAACGG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.16_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.17_TGCTGGGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACCCAGCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.17_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.18_GAGGGGTT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AACCCCTC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.18_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.19_AGGTTGGG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CCCAACCT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.19_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.20_GTGTGGTG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CACCACAC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.20_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.21_TGGGTTTC: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[GAAACCCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.21_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.22_TGGTCACA: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[TGTGACCA]GTCTCGTGGGC&lt;br/&gt;TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.22_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.23_TTGACCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGGTCAA]GTCTCGTGGGC&lt;br/&gt;TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.23_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.24_CCACTCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGAGTGG]GTCTCGTGGG&lt;br/&gt;CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.24_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>F1: 5&#039;-CCTTTTTATTTGCCCATACACTC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R1: 5&#039;-CCCAGATAGAAAGTTGGAGAGG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F2: 5&#039;-TTGAGGGATGCCATAACAGTC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R2: 5&#039;-CTGCTGAACAACATCCTTCAC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F3: 5&#039;-GGTTTGCAGGTTGCGTTG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R3: 5&#039;-AGAGGAATCTGGGAGTGACG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F4: 5&#039;-TGCTCATTCCGTTTCCCTAC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R4: 5&#039;-AGCCGGAAAGAAAGTTCCTG-3&#039;</td><td>IDT</td><td></td><td></td></tr></tbody></table>

mapping genome-wide accessible chromatin in primary human t lymphocytes by atac-seq

Test für Transposase zugänglichen Chromatin mit Hochdurchsatz-Sequenzierung (ATAC-Seq) ist eine Methode zur Identifizierung von offenen (zugänglich) Regionen des Chromatins. Diese Regionen sind regulatorische DNA-Elemente (z.B., Promotoren, Enhancer, Locus Kontrollregionen, Isolatoren), welche, die Transkription Faktoren binden. Mapping der zugänglichen Chromatin-Landschaft ist ein leistungsfähiger Ansatz zur Aufdeckung aktive regulatorische Elemente über das Genom. Diese Informationen dienen als eine unvoreingenommene Ansatz für die Entdeckung, das Netz der relevanten Transkriptionsfaktoren und Mechanismen der Chromatinstruktur, die Genprogramme Ausdruck zu regieren. ATAC-Seq ist eine robuste und sensible Alternative zu DNase ich Überempfindlichkeit Analyse gepaart mit Next Generation Sequencing (DNase-Seq) und Formaldehyd-gestützte Isolation der regulatorischen Elemente (Jahrmarkt-Seq) für genomweite Analyse von Chromatin Zugänglichkeit und die Sequenzierung von micrococcal Nuklease-Sensitive Websites (MNase-Seq) Nukleosom Positionierung zu bestimmen. Wir präsentieren Ihnen ein detailliertes ATAC-Seq-Protokoll optimiert für menschliche primäre d.h. CD4 +-Lymphozyten Immunzellen (T-Helfer 1 (Th1) und Th2-Zellen). Dieses umfassende Protokoll beginnt mit Zellernte, dann beschreibt das molekulare Verfahren von Chromatin Tagmentation, Probenvorbereitung für die Sequenzierung der nächsten Generation, und auch Methoden und Überlegungen für die computergestützten Analysen verwendet, um interpretieren Sie die Ergebnisse. Um Zeit und Geld zu sparen, haben wir darüber hinaus eingeführt Qualitätskontrollmaßnahmen zur Bewertung der ATAC-Seq-Bibliothek vor der Sequenzierung. Wichtig ist, erlauben die Grundsätze, die in diesem Protokoll präsentiert seine Anpassung an anderen menschlichen immun- und nicht-immunen Primärzellen und Zell-Linien. Diese Richtlinien werden auch nützlich für Labore die nicht geübt im Umgang mit Next Generation Sequencing-Methoden sind.

Das Endergebnis dieses Protokolls ist ein ATAC-Seq-Bibliothek von in der Regel 3-20 ng/µL. Bei der Ausführung auf ein System für die DNA-Integrität-Analyse (siehe Tabelle der Materialien/Geräte), sie zeigen Leiter aussehen2 (Abb. 3A). Die durchschnittliche Größe der DNA-Fragmente ist in der Regel ~ 450-530 bp.
Richtige Qualitätskontrolle der ATAC-Seq-...

Watch this Scientific Journal Video about Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq at JoVE.com

Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

Test für Transposase zugänglichen Chromatin gepaart mit Hochdurchsatz-Sequenzierung (ATAC-Seq) ist eine genomweite Methode zugänglich Chromatin aufzudecken. Dies ist ein Schritt für Schritt ATAC-Seq-Protokoll von molekularen bis die abschließende computergestützte Analyse, optimiert für menschlichen Lymphozyten (Th1/Th2). Dieses Protokoll kann von Wissenschaftlern ohne Vorkenntnisse in Next Generation Sequencing Methoden übernommen werden.

Mapping genomweite zugänglich Chromatin in primären menschlichen T-Lymphozyten durch ATAC-Seq

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions ...

mapping-genome-wide-accessible-chromatin-primary-human-t-lymphocytes

Research

JoVE Journal

Genetics

17.9K Aufrufe.  Bar-Ilan University. Test für Transposase zugänglichen Chromatin gepaart mit Hochdurchsatz-Sequenzierung (ATAC-Seq) ist eine genomweite Methode zugänglich Chromatin aufzudecken. Dies ist ein Schritt für Schritt ATAC-Seq-Protokoll von molekularen bis die abschließende computergestützte Analyse, optimiert für menschlichen Lymphozyten (Th1/Th2). Dieses Protokoll kann von Wissenschaftlern ohne Vorkenntnisse in Next Generation Sequencing Methoden übernommen werden.

Serie: Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

An Integrated Platform for Genome-wide Mapping of Chromatin States Using High-throughput ChIP-sequencing in Tumor Tissues

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of associated loci. In addition, the presence of specific modifications has been used to determine the position and identity non-coding functional elements such as enhancers. In recent years, chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq) has become a powerful tool in determining the genome-wide profiles of individual histone modifications. However, it has become increasingly clear that the combinatorial patterns of chromatin modifications, referred to as Chromatin States, determine the identity and nature of the associated genomic locus. Therefore, workflows consisting of robust high-throughput (HT) methodologies for profiling a number of histone modification marks, as well as computational analyses pipelines capable of handling myriads of ChIP-Seq profiling datasets, are needed for comprehensive determination of epigenomic states in large number of samples. The HT-ChIP-Seq workflow presented here consists of two modules: 1) an experimental protocol for profiling several histone modifications from small amounts of tumor samples and cell lines in a 96-well format; and 2) a computational data analysis pipeline that combines existing tools to compute both individual mark occupancy and combinatorial chromatin state patterns. Together, these two modules facilitate easy processing of hundreds of ChIP-Seq samples in a fast and efficient manner. The workflow presented here is used to derive chromatin state patterns from 6 histone mark profiles in melanoma tumors and cell lines. Overall, we present a comprehensive ChIP-seq workflow that can be applied to dozens of human tumor samples and cancer cell lines to determine epigenomic aberrations in various malignancies.

Here, we describe an optimized high-throughput ChIP-sequencing protocol and computational analyses pipeline for the determination of genome-wide chromatin state patterns from frozen tumor tissues and cell lines.

Eine integrierte Plattform für genomweite Kartierung von Chromatin Staaten mit hohem Durchsatz ChIP-Sequenzierung im Tumorgewebe

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of ...

Forschung

Krebsforschung

ATAC-seq Assay with Low Mitochondrial DNA Contamination from Primary Human CD4+ T Lymphocytes

ATAC-seq has become a widely used methodology in the study of epigenetics due to its rapid and simple approach to mapping genome-wide accessible chromatin. In this paper we present an improved ATAC-seq protocol that reduces contaminating mitochondrial DNA reads. While previous ATAC-seq protocols have struggled with an average of 50% contaminating mitochondrial DNA reads, the optimized&#160;lysis buffer introduced in this protocol reduces mitochondrial DNA contamination to an average of 3%. This improved ATAC-seq protocol allows for a near 50% reduction in the sequencing cost. We demonstrate how these high-quality ATAC-seq libraries can be prepared from activated CD4+ lymphocytes, providing step-by-step instructions from CD4+ lymphocyte isolation from whole blood through data analysis. This improved ATAC-seq protocol has been validated in a wide range of cell types and will be of immediate use to researchers studying chromatin accessibility.

Here, we present a protocol to perform an assay for transposase-accessible chromatin sequencing (ATAC-seq) on activated CD4+ human lymphocytes. The protocol has been modified to minimize contaminating mitochondrial DNA reads from 50% to 3% through the introduction of a new lysis buffer.

ATAC-Seq-Assay mit niedrigen mitochondriale DNA Kontamination von primären menschlichen CD4 + T-Lymphozyten

ATAC-seq has become a widely used methodology in the study of epigenetics due to its rapid and simple approach to mapping genome-wide accessible ...

Genetik

Adipocyte-Specific ATAC-Seq with Adipose Tissues Using Fluorescence-Activated Nucleus Sorting

Assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) is a robust technique that enables genome-wide chromatin accessibility profiling. This technique has been useful for understanding the regulatory mechanisms of gene expression in a range of biological processes. Although ATAC-seq has been modified for different types of samples, there have not been effective modifications of ATAC-seq methods for adipose tissues. Challenges with adipose tissues include the complex cellular heterogeneity, large lipid content, and high mitochondrial contamination. To overcome these problems, we have developed a protocol that allows adipocyte-specific ATAC-seq by employing fluorescence-activated nucleus sorting with adipose tissues from the transgenic reporter Nuclear tagging and Translating Ribosome Affinity Purification (NuTRAP) mouse. This protocol produces high-quality data with minimal wasted sequencing reads while reducing the amount of nucleus input and reagents. This paper provides detailed step-by-step instructions for the ATAC-seq method validated for the use of adipocyte nuclei isolated from mouse adipose tissues. This protocol will aid in the investigation of chromatin dynamics in adipocytes upon diverse biological stimulations, which will allow for novel biological insights.

We present a protocol for assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) specifically on adipocytes using nucleus sorting with adipose tissues isolated from transgenic reporter mice with nuclear fluorescence labeling.

Adipozyten-spezifischer ATAC-Seq mit Fettgewebe mittels fluoreszenzaktivierter Zellkernsortierung

Assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) is a robust technique that enables genome-wide chromatin ...

CATCH-UP: A High-Throughput Upstream-Pipeline for Bulk ATAC-Seq and ChIP-Seq Data

Assay for transposase-accessible chromatin (ATAC) and chromatin immunoprecipitation (ChIP), coupled with next-generation sequencing (NGS), have revolutionized the study of gene regulation. A lack of standardization in the analysis of the highly dimensional datasets generated by these techniques has made reproducibility difficult to achieve, leading to discrepancies in the published, processed data. Part of this problem is due to the diverse range of bioinformatic tools available for the analysis of these types of data. Secondly, a number of different bioinformatic tools are required sequentially to convert raw data into a fully processed and interpretable output, and these tools require varying levels of computational skills. Furthermore, there are many options for quality control that are not uniformly employed during data processing. We address these issues with a complete assay for transposase-accessible chromatin sequencing (ATAC-seq) and chromatin immunoprecipitation sequencing (ChIP-seq) upstream pipeline (CATCH-UP), an easy-to-use, Python-based pipeline for the analysis of bulk ChIP-seq and ATAC-seq datasets from raw fastq files to visualizable bigwig tracks and peaks calls. This pipeline is simple to install and run, requiring minimal computational knowledge. The pipeline is modular, scalable, and parallelizable on various computing infrastructures, allowing for easy reporting of methodology to enable reproducible analysis of novel or published datasets.

ATAC-seq and ChIP-seq allow detailed investigation of gene regulation; however, processing these data types is challenging and often inconsistent between research groups. We present CATCH-UP: an easy-to-use computational pipeline that allows standardized and reproducible data processing and analysis of new and published ATAC/ChIP-seq datasets.

Assay for transposase-accessible chromatin (ATAC) and chromatin immunoprecipitation (ChIP), coupled with next-generation sequencing (NGS), have ...

ATAC-Seq Optimization for Cancer Epigenetics Research

The assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) probes deoxyribonucleic acid (DNA) accessibility using the hyperactive Tn5 transposase. Tn5 cuts and ligates adapters for high-throughput sequencing within accessible chromatin regions. In eukaryotic cells, genomic DNA is packaged into chromatin, a complex of DNA, histones, and other proteins, which acts as a physical barrier to the transcriptional machinery. In response to extrinsic signals, transcription factors recruit chromatin remodeling complexes to enable access to the transcriptional machinery for gene activation. Therefore, identifying open chromatin regions is useful when monitoring enhancer and gene promoter activities during biological events such as cancer progression. Since this protocol is easy to use and has a low cell input requirement, ATAC-seq has been widely adopted to define open chromatin regions in various cell types, including cancer cells. For successful data acquisition, several parameters need to be considered when preparing ATAC-seq libraries. Among them, the choice of cell lysis buffer, the titration of the Tn5 enzyme, and the starting volume of cells are crucial for ATAC-seq library preparation in cancer cells. Optimization is essential for generating high-quality data. Here, we provide a detailed description of the ATAC-seq optimization methods for epithelial cell types.

ATAC-seq is a DNA sequencing method that uses the hyperactive mutant transposase, Tn5, to map changes in chromatin accessibility mediated by transcription factors. ATAC-seq enables the discovery of the molecular mechanisms underlying phenotypic alterations in cancer cells. This protocol outlines optimization procedures for ATAC-seq in epithelial cell types, including cancer cells.

ATAC-Seq Optimierung für die Krebsepigenetikforschung

The assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) probes deoxyribonucleic acid (DNA) accessibility using the ...

Isolierung von Zellkernen aus kardialen Vorläuferzellen der Maus mit Einzelzellauflösung

Nuclei Isolation from Mouse Cardiac Progenitor Cells for Epigenome and Gene Expression Profiling at Single-Cell Resolution

The developing heart is a complex structure containing various progenitor cells controlled by complex regulatory mechanisms. The examination of the gene expression and chromatin state of individual cells allows the identification of the cell type and state. Single-cell sequencing approaches have revealed a number of important characteristics of cardiac progenitor cell heterogeneity. However, these methods are generally restricted to fresh tissue, which limits studies with diverse experimental conditions, as the fresh tissue must be processed at once in the same run to reduce the technical variability. Therefore, easy and flexible procedures to produce data from methods such as single-nucleus RNA sequencing (snRNA-seq) and the single-nucleus assay for transposase-accessible chromatin with high-throughput sequencing (snATAC-seq) are needed in this area. Here, we present a protocol to rapidly isolate nuclei for subsequent single-nuclei dual-omics (combined snRNA-seq and snATAC-seq). This method allows the isolation of nuclei from frozen samples of cardiac progenitor cells and can be combined with platforms that use microfluidic chambers.

Autor im Rampenlicht: Zellkernisolierung aus kardialen Vorläuferzellen der Maus für die Erstellung von Epigenom- und Genexpressionsprofilen mit Einzelzellauflösung  

Here, we present a protocol describing cell nuclei preparation. After microdissection and enzymatic dissociation of cardiac tissue into single cells, the progenitor cells were frozen, followed by isolation of pure viable cells, which were used for single-nucleus RNA sequencing and the single-nucleus assay for transposase-accessible chromatin with high-throughput sequencing analyses.

Zellkernisolierung aus kardialen Vorläuferzellen der Maus für die Erstellung von Epigenom- und Genexpressionsprofilen mit Einzelzellauflösung

The developing heart is a complex structure containing various progenitor cells controlled by complex regulatory mechanisms. The examination of the gene ...

Entwicklungsbiologie

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

Generierung von High Quality Chromatin Immunpräzipitation DNA Vorlage für Hochdurchsatz-Sequenzierung (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Biologie

Multiplexed Analysis of Retinal Gene Expression and Chromatin Accessibility Using scRNA-Seq and scATAC-Seq

Powerful next generation sequencing techniques offer robust and comprehensive analysis to investigate how retinal gene regulatory networks function during development and in disease states. Single-cell RNA sequencing allows us to comprehensively profile gene expression changes observed in retinal development and disease at a cellular level, while single-cell ATAC-Seq allows analysis of chromatin accessibility and transcription factor binding to be profiled at similar resolution. Here the use of these techniques in the developing retina is described, and MULTI-Seq is demonstrated, where individual samples are labeled with a modified oligonucleotide-lipid complex, enabling researchers to both increase the scope of individual experiments and substantially reduce costs.

Here, the authors showcase the utility of MULTI-seq for phenotyping and subsequent paired scRNA-seq and scATAC-seq in characterizing the transcriptomic and chromatin accessibility profiles in retina.

Multiplexe Analyse der retinalen Genexpression und der Chromatinzugänglichkeit mittels scRNA-seq und scATAC-seq

Powerful next generation sequencing techniques offer robust and comprehensive analysis to investigate how retinal gene regulatory networks function during ...

Mapping genomweite zugänglich Chromatin in primären menschlichen T-Lymphozyten durch ATAC-Seq

Zusammenfassung

Weitere Videos entdecken

PLAYLIST