Diese Arbeit wurde durch die neue Fakultät Start Fonds an der North Carolina State University Guozhou Xu unterstützt.

Hinweis: Eine Insekt Zelle/Baculovirus-System mit veränderten Expressionsvektoren sekretorischen Pflanze Proteinexpression und Kristallisation wird verwendet.
1. Änderung eines Baculovirus Ausdruck Vektors mit der GP67-Signalpeptid für Pflanze Proteinexpression Sekretion
<ol><li>Ein DNA-Fragment mit einer 5' BglII schneiden Seite13, die GP67 Sekretion Signalsequenz und eine Multi-Klonen Website mit NotI, BamHI EcoRI, StuI, SalI, SpeI, XbaI, PstI und XhoI (Abbildung 1A) zu synthetisieren. Hinweis: Da BglII und BamHI verdaut DNA führte in den gleichen Klebstoffen enden, der linearisierte Vektor kann auf das verdaute DNA-Fragment verbinden, während die BglII und BamHI Seiten nacheinander geglühten Ligatur zu einer Sequenz mutiert werden werden, die nicht von spaltbaren entweder BglII oder BamHI14.</li>
	<li>Digest 4 µg DNA mit BglII und XhoI und 4 µg ein Ausdruck Vektor-DNA mit BamHI und XhoI14. Mischen Sie 10 Einheiten jedes Restriktionsenzym mit der DNA in einem 1 x Konzentration Reaktion Puffer (50 mM Kalium Acetat, 20 mM Tris-Acetat, 10 mM Magnesium-Acetat und 100 µg/mL BSA, pH 7,9 bei 25 ° C) und inkubieren Sie die Mischung bei 37 ° C für 4 h.<ol>
<li>Reinigen Sie die ausgeschnittenen DNA-Fragment und den linearisierten Vektor-DNA durch eine DNA-Gel Extraction Kit15.</li>
	</ol>
</li>
	<li>Mix 100 ng der linearisierten Vektor-DNA mit 400 ng der verdauten DNA fragment in einem 10-µL Ligatur Reaktionsgemisch mit 1 x T4 DNA-Ligase Reaktion Puffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, und 10 mM DTT, pH 7,5 bei 25 ° C) und 5 Einheiten der T4-DNA Ligase. Inkubieren Sie die Reaktionsmischung bei 16 ° C 16 h.</li>
	<li>Verwandeln Sie 5 µL der Ligatur Mischung in 100 µL DH5α kompetente Zellen nach einem standard Umwandlung Protokoll und wählen Sie die daraus resultierenden Kolonien auf eine Ampicillin-LB-Agar-Platte-16. Nehmen Sie 5-10 Kolonien und wachsen Sie jede Kolonie in 2 mL LB-Medium mit 100 µg/mL Ampicillin bei 220 u/min und 37 ° C in einem schütteln Inkubator für 16 h.</li>
	<li>Extrahieren Sie jedes Plasmid DNA mit einem DNA-Miniprep Kit17 und bestätigen Sie die Klone durch DNA-Sequenzierung mit einem Primer AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>PCR-verstärken das A. Thaliana TDR gen fragment Codierung Rückstände 30-642 von einem synthetischen TDR-gen zu konstruieren (Grundierung weiterleiten: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, rückwärts-Primer: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Verstärken Sie die DNA für 30 Zyklen in einem DNA-Polymerase-Reaktion-Puffer mit einem 0,5 mM dNTP-Mix, 0,2 µM Primer, 0,1 µg der Schablone DNA, 0,4 mM MgCl2und 1 Reaktionseinheit der DNA-Polymerase.<ol>
<li>Für die PCR-Zyklus-Schritte festlegen der anfänglichen Denaturierung bei 95 ° C für 30 s und dann 30 Zyklen der Denaturierung bei 95 ° C für 30 s, bei 55 ° C für 30 s und Erweiterung bei 72 ° C für 1 min, mit der letzten Erweiterung bei 72 ° C für 5 min glühen.</li>
	</ol>
</li>
	<li>Die PCR-Fragment und den modifizierten Vektor mit NotI und BamHI Einschränkung Endonuklease Enzyme zu verdauen. Verbinden Sie das Gen-Fragment mit der linearisierten Vektor. Mix 100 ng der linearisierten Vektor-DNA mit 400 ng der verdauten DNA fragment in einem 10-µL Ligatur Reaktionsgemisch mit T4 DNA-Ligase Reaktion Puffer und 5 Einheiten des T4 DNA-Ligase. Inkubieren Sie die Reaktionsmischung bei 16 ° C 16 h.</li>
	<li>Verwandeln Sie 5 µL der Ligatur Mischung in 100 µL DH5α kompetente Zellen nach einem standard Umwandlung Protokoll und wählen Sie die daraus resultierenden Kolonien auf eine Ampicillin-LB-Agar-Platte-16. Bestätigen Sie die korrekte Klone durch DNA-Sequenzierung.</li>
</ol>(2) Änderung des Baculovirus Ausdruck Vektor mit der Insekten Hemolin Signalpeptid für Pflanze Proteinexpression Sekretion
<ol><li>Ein DNA-Fragment mit einer 5' BglII schneiden Seite13, das Insekt Hemolin Sekretion Signalsequenz und eine Multi-Klonen Website mit NotI, BamHI EcoRI, StuI, SalI, SpeI, XbaI, PstI und XhoI (Abbildung 1 b) zu synthetisieren.</li>
	<li>Digest 4 µg DNA mit BglII und XhoI und 4 µg ein Ausdruck Vektor-DNA mit BamHI und XhoI14. Mischen Sie 10 Einheiten jedes Restriktionsenzym mit der DNA in einem 1 x Konzentration Reaktion Puffer (50 mM Kalium Acetat, 20 mM Tris-Acetat, 10 mM Magnesium-Acetat und 100 µg/mL BSA, pH 7,9 bei 25 ° C) und inkubieren Sie die Mischung bei 37 ° C für 4 h.<ol>
<li>Reinigen Sie die ausgeschnittenen DNA-Fragment und den linearisierten Vektor-DNA durch eine DNA-Gel Extraction Kit15.</li>
	</ol>
</li>
	<li>Mix 100 ng der linearisierten Vektor-DNA mit 400 ng der verdauten DNA fragment in einem 10-µL Ligatur Reaktionsgemisch mit 1 x T4 DNA-Ligase Reaktion Puffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, und 10 mM DTT, pH 7,5 bei 25 ° C) und 5 Einheiten der T4-DNA Ligase. Inkubieren Sie die Reaktionsmischung bei 16 ° C 16 h.</li>
	<li>Verwandeln Sie 5 µL der Ligatur Mischung in 100 µL kompetente Zellen DH5α, und wählen Sie die Kolonien auf eine Ampicillin-LB-Agar-Platte. Nehmen Sie 5-10 Kolonien und wachsen Sie jede Kolonie in einem 2-mL LB-Medium mit 100 µg/mL Ampicillin bei 220 u/min und 37 ° C in einem schütteln Inkubator für 16 h.</li>
	<li>Plasmid-DNA mit einem DNA-Miniprep Kit17 extrahieren und die Klone durch DNA-Sequenzierung mit einem Primer AGTATTTTACTGTTTTCGTAACAG bestätigen.</li>
	<li>PCR-verstärken A. Thaliana Pollen Rezeptor-Kinase 3 (PRK3) Gen Fragment Codierung Rückstände 20-237 aus einem synthetischen PRK3 genkonstrukt (Grundierung weiterleiten: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, rückwärts-Primer: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Verstärken Sie die DNA für 30 Zyklen in einem DNA-Polymerase-Reaktion-Puffer mit einem 0,5 mM dNTP-Mix, 0,2 µM Primer, 0,1 µg der Schablone DNA, 0,4 mM MgCl2und 1 Reaktionseinheit der DNA-Polymerase.<ol>
<li>Für die PCR-Zyklus-Schritte festlegen der anfänglichen Denaturierung bei 95 ° C für 30 s und dann 30 Zyklen der Denaturierung bei 95 ° C für 30 s, Glühen bei 55 ° C für 30 s und Erweiterung bei 72 ° C für 30 s in jedem Zyklus, und die letzte Erweiterung bei 72 ° C für 5 Minuten.</li>
	</ol>
</li>
	<li>Die PCR-Fragment und den modifizierten Vektor mit NotI und BamHI Einschränkung Endonuklease Enzyme zu verdauen. Verbinden Sie das Gen-Fragment mit der linearisierten Vektor. Mix 100 ng der linearisierten Vektor-DNA mit 400 ng der verdauten DNA fragment in einem 10-µL Ligatur Reaktionsgemisch mit T4 DNA-Ligase Reaktion Puffer und 5 Einheiten des T4 DNA-Ligase. Inkubieren Sie die Reaktionsmischung bei 16 ° C 16 h.</li>
	<li>Verwandeln Sie 5 µL der Ligatur Mischung in 100 µL DH5α kompetente Zellen nach einem standard Umwandlung Protokoll und wählen Sie die daraus resultierenden Kolonien auf eine Ampicillin-LB-Agar-Platte-16. Bestätigen Sie die korrekte Klone durch DNA-Sequenzierung.</li>
</ol>3. Produktion und Verstärkung des Baculovirus baut das rekombinante Protein Expressionskassette beherbergen
<ol><li>Einsatz 100 ng des Plasmids Konstrukt, 40 µL kompetente Zellen DH10Bac nach dem Protokoll des Baculovirus Ausdruck System1zu verwandeln. Inkubieren Sie die Verwandlung-Platten bei 37 ° C für 48 h.</li>
	<li>Zwei weiße Kolonien von jeder Transformation Platte abholen, jede Kolonie in 2 mL LB-Medium mit 50 µg/mL Kanamycin, 7 µg/mL Gentamicin und 10 µg/mL Tetracyclin zu impfen. Folgen Sie das Protokoll des Baculovirus Ausdruck System1 zu extrahieren und die Bacmid DNA zu überprüfen. Aliquoten jedes DNA in zwei Röhren mit jeweils 20 µL und speichern Sie die Rohre bei-20 ° C. Hinweis: Die folgenden Schritte erfordern eine aseptische Operation.</li>
	<li>Wachsen einer Monoschicht Sf9 Zellen in der Kultur Medien mit 10 % fetalen bovine Serum (FBS) und 100 µg/mL (oder 100 I.U./mL) Penicillin-Streptomycin Antibiotika bei 27 ° C bis 80 % Zusammenfluss in einem 6-Well-Platte. Schätzen Sie den Prozentsatz der Mündung ausgehend vom prozentualen Anteil der überdachte Fläche auf der Gewebekultur-Platte.</li>
	<li>Bereiten Sie die folgenden Lösungen in zwei sterile 1,5 mL Zentrifuge Röhren.<ol>
<li>Röhre 1: Für jede Transfektion verdünnen Sie 20 µL Bacmid DNA in 100 µL unsupplemented Sf9 Zellkulturmedium ohne Antibiotika. Mischen Sie die Verdünnung von flicking die Seite des Röhrchens vorsichtig.</li>
		<li>Rohr 2: Für jede Transfektion verdünnen Sie 8 µL Lipid Transfection Reagens in 100 µL unsupplemented Sf9 Zellkulturmedium ohne Antibiotika. Mischen Sie die Verdünnung von oben und unten für 6 X pipettieren gründlich.</li>
	</ol>
</li>
	<li>Kombinieren Sie die beiden Lösungen, mischen Sie sie sanft durch pipettieren langsam rauf und runter für 3 X und inkubieren sie 20-40 min bei Raumtemperatur.</li>
	<li>Waschen jede Vertiefung der Monolage Sf9 Zellen 2 X mit 3 mL unsupplemented Sf9 Zellkulturmedium ohne Antibiotika. Fügen Sie für jede Transfektion 0,8 mL unsupplemented Sf9 Zellkulturmedium ohne Antibiotika zu jedes Röhrchen enthält die Lipid-DNA-Mischung hinzu. Mischen Sie der Inhalt der Röhren durch pipettieren langsam rauf und runter für 3 X vorsichtig. Aspirieren Sie waschen Medien von den Platten und überlagern Sie die Proben mit der Transfektion Mischung zu.</li>
	<li>Nach der Zugabe der Transfektion Mischung inkubieren der transfizierten Platte für 5 h bei 27 ° C. Ersetzen Sie die Transfektion Medien mit der kompletten Sf9 Zellkulturmedium mit 10 % FBS und 100 µg/mL (oder 100 I.U./mL) Penicillin-Streptomycin Antibiotika. Inkubieren Sie die transfizierte Platte bei 27 ° C für 4D.</li>
	<li>Ernte und verstärken die rekombinante Baculovirus.<ol>
<li>Den überstand der infizierten Platte in ein steriles 15 mL konische Röhrchen nach 4D Inkubation abholen. Drehen Sie den Überstand bei 1010 X g für 5 min, die Zelle Ablagerungen zu entfernen. Verwerfen Sie das Pellet zu und Dekantieren Sie den überstand in ein sauberes Röhrchen und bewahren sie bei 4 ° C für bis zu 1 Jahr. Hinweis: Dies ist der P0-Virus. Es kann für einen längeren Zeitraum hinweg regelmäñig und bei-80 ° C gelagert werden.</li>
		<li>Um jede rekombinanten Virus zu verstärken, wird eine Monolage Sf9 Zellen auf eine 150-mm-Platte 80 % Zusammenfluss. Aspirieren Sie die Medien von der Platte, der Zellen-Anhänger auf die Platte 2 mL des P0 Virus hinzu und inkubieren Sie die Platte für 1 h in einem Inkubator 27 ° C. Rocken Sie die Platte alle 15 min um das Medium mit den Zellen zu mischen.<ol>
<li>Fügen Sie 25 mL des kompletten Graces Medium mit 10 % FBS und 100 µg/mL (oder 100 I.U./mL) Penicillin-Streptomycin Antibiotika. Inkubieren Sie die Platte für 3-d in einem Inkubator 27 ° C, die P1-Passage-Virus zu erhalten.</li>
		</ol>
</li>
		<li>Sammeln des Überstands der infizierten Platte in ein steriles 50 mL konische Röhrchen und Spin 1010 X g für 5 min, die Zelle Ablagerungen zu entfernen. Den überstand in ein sauberes Röhrchen dekantieren und bis zu 1 Jahr bei 4 ° C lagern. Hinweis: Das P1-Virus kann regelmäñig und bei-80 ° C gelagert für einen längeren Zeitraum hinweg sein.</li>
		<li>Um den Virus von P1 auf P2 Passage zu verstärken, wachsen Sie einem monomolekularen Film Sf9 Zellen auf eine 150-mm-Platte zu 90 % Zusammenfluss, Aspirieren Sie die Medien der Platte, Platte 2 mL des P1-Virus hinzu, und 1 h in einem Inkubator 27 ° C inkubieren.</li>
		<li>Wiederholen Sie die Schritte 3.8.2 und 3.8.3, P2 und P3 Passagen der Viren zu erhalten. Lagern Sie die P3-Virus nicht mehr als 2 Monate.</li>
	</ol>
</li>
</ol>(4) Protein-Expression, Reinigung mit NiNTA und Kristallisation
<ol><li>Kultur 1 L Hi5 Insektenzellen in der Nährmedien mit 100 µg/mL (oder 100 I.U./mL) Penicillin-Streptomycin Antibiotika zu einer Dichte von 2 x 106 bei 100 u/min in einem Inkubator Shaker 27 ° C. Spin-down der Zellen bei 570 X g für 5 min, Dekantieren des Überstandes, Aufschwemmen der Zellen in 20 mL des frisch hergestellten P3-Virus und bei Zimmertemperatur aufbewahren, denn 1 h. sanft schütteln Spin auf die Zellen 1 x alle 15 min aufzuwirbeln.</li>
	<li>Übertragen Sie die Zellen auf 1 L von Nährmedien mit 100 µg/mL (oder 100 I.U./mL) Penicillin-Streptomycin Antibiotika, Kulturzellen bei 100 u/min in einem 27 ° C Inkubator Shaker für 72 h Spin die Zellen bei 1.010 X g für 5 min und den überstand zu sammeln.</li>
	<li>Einsatz-pH-Indikator Streifen passen den pH-Wert des Überstands bis 8,0 durch Zugabe von 0,1 M HCl oder 0,1 M NaOH und Bindung Puffer auf eine Endkonzentration, mit 20 mM Tris-Puffer bei pH 8.0, 100 mM NaCl, und 5 mM Imidazol hinzufügen. Fügen Sie ein gewisses Maß an NiNTA Harz (10-40 mL) basierend auf den geschätzten Ertrag des His-Tags rekombinanten Proteins ausgedrückt.<ol>
<li>Mischen Sie die Lösung auf eine magnetische rühren bei niedriger Drehzahl bei 4 ° C für 1 h waschen das Harz und eluieren Sie gebundenen Proteins nach dem standard NiNTA Reinigung Protokoll18.</li>
	</ol>
</li>
	<li>Vorbehaltlich der gereinigten Proteins Ionenaustausch und gel Filtration Chromatographie sowie andere Protein Reinigungsmethoden, um eine homogene Probe zu erzielen. Hinweis: Für die TDR ektodomäne, 20 mM Tris, pH 8, 100 mM NaCl dienten als Gel Filtration Puffer. Für die PRK3 ektodomäne, 20 mM Bis-Tris, pH 6, 100 mM NaCl dienten als bevorzugte Gel Filtration Puffer.</li>
</ol>

<ol>
	<li>Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+using+the+baculovirus-insect+cell+expression+system.">Protein production using the baculovirus-insect cell expression system.</a> Biotechnology Progress. 30, 1-18 (2014).</li><li>Khan, S., Ng, M. L., Tan, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+severe+acute+respiratory+syndrome+coronavirus+3a+protein+and+the+assembly+of+coronavirus-like+particles+in+the+baculovirus+expression+system.">Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system.</a> Methods in Molecular Biology. 379, 35-50 (2007).</li><li>Possee, R. D., King, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+Transfer+Vectors.">Baculovirus Transfer Vectors.</a> Methods in Molecular Biology. 1350, 51-71 (2016).</li><li>Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+establishment+of+two+cell+lines+from+the+insect+Spodoptera+frugiperda+(Lepidoptera;+Noctuidae).">The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae).</a> In Vitro. 13, 213-217 (1977).</li><li>Hink, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Established+insect+cell+line+from+the+cabbage+looper,+Trichoplusia+ni.">Established insect cell line from the cabbage looper, Trichoplusia ni.</a> Nature. 226, 466-467 (1970).</li><li>Davis, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+recombinant+protein+production+of+eight+insect+cell+lines.">Comparative recombinant protein production of eight insect cell lines.</a> In Vitro Cellular &amp; Development Biology - Animal. 29A, 388-390 (1993).</li><li>Wickham, T. J., Nemerow, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+growth+methods+and+recombinant+protein+production+in+BTI-Tn-5B1-4+insect+cells+using+the+baculovirus+expression+system.">Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system.</a> Biotechnology Progress. 9, 25-30 (1993).</li><li>Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+expression+of+alkaline+phosphatase+as+a+reporter+gene+for+evaluation+of+production,+glycosylation+and+secretion.">Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion.</a> Nature Biotechnology. 10, 1148-1150 (1992).</li><li>Murphy, C. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+expression,+secretion,+and+large-scale+purification+of+recombinant+HIV-1+gp120+in+insect+cell+using+the+baculovirus+egt+and+p67+signal+peptides.">Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides.</a> Protein Expression and Purification. 4, 349-357 (1993).</li><li>Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemolin:+an+insect-immune+protein+belonging+to+the+immunoglobulin+superfamily.">Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily.</a> Science. 250, 1729-1732 (1990).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+CLE+peptide+perception+by+plant+receptors+implicated+from+structural+and+functional+analyses+of+TDIF-TDR+interactions.">Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions.</a> PLoS One. 12, e0175317 (2017).</li><li>Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Extracellular+Domain+of+Pollen+Receptor+Kinase+3+is+structurally+similar+to+the+SERK+family+of+co-receptors.">The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors.</a> Scientific Reports. 8, 2796 (2018).</li><li>Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Total+synthesis+of+a+gene.">Total synthesis of a gene.</a> Science. 203, 614-625 (1979).</li><li>Bahl, C. P., Marians, K. J., Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+for+inserting+specific+DNA+sequences+into+cloning+vehicles.">A general method for inserting specific DNA sequences into cloning vehicles.</a> Gene. 1, 81-92 (1976).</li><li>Xu, W., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Characterization+of+Vaccine-Derived+Polioviruses,+Relevance+for+the+Global+Polio+Eradication+Initiative.">Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative.</a> Methods in Molecular Biology. 1387, 213-226 (2016).</li><li>Hanahan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+transformation+of+Escherichia+coli+with+plasmids.">Studies on transformation of Escherichia coli with plasmids.</a> Journal of Molecular Biology. 166, 557-580 (1983).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Reddy, B. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+purification+of+the+alpha+subunit+of+the+epithelial+sodium+channel,+ENaC.">Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC.</a> Protein Expression and Purification. 117, 67-75 (2016).</li><li>Harris, T. J., Emtage, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+heterologous+genes+in+E.+coli.">Expression of heterologous genes in E. coli.</a> Microbiological Sciences. 3, 28-31 (1986).</li><li>Kaur, J., Kumar, A., Kaur, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimization+of+heterologous+protein+expression+in+E.+coli:+Roadblocks+and+reinforcements.">Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements.</a> International Journal of BIological Macromolecules. 106, 803-822 (2018).</li><li>Guo, Y., Yang, F., Tang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+of+Protein+Secretion+in+Yeast+and+Animal+Cells.">An Overview of Protein Secretion in Yeast and Animal Cells.</a> Methods in Molecular Biology. 1662, 1-17 (2017).</li><li>Blight, M. A., Chervaux, C., Holland, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+pathway+in+Escherichia+coli.">Protein secretion pathway in Escherichia coli.</a> Current Opinion in Biotechnology. 5, 468-474 (1994).</li><li>Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+protein+secretion+in+yeast:+strategies+and+impact+on+protein+production.">Engineering of protein secretion in yeast: strategies and impact on protein production.</a> Applied Microbiology and Biotechnology. 86, 403-417 (2010).</li><li>Wormald, M. R., Dwek, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycoproteins:+glycan+presentation+and+protein-fold+stability.">Glycoproteins: glycan presentation and protein-fold stability.</a> Structure. 7, R155-R160 (1999).</li><li>Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+and+History+of+Glyco-Engineering+in+Insect+Expression+Systems.">An Overview and History of Glyco-Engineering in Insect Expression Systems.</a> Methods in Molecular Biology. 1321, 131-152 (2015).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-ray+crystallographic+studies+of+the+extracellular+domain+of+the+first+plant+ATP+receptor,+DORN1,+and+the+orthologous+protein+from+Camelina+sativa.">X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa.</a> Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).</li><li>Aricescu, A. R., Owens, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+recombinant+glycoproteins+in+mammalian+cells:+towards+an+integrative+approach+to+structural+biology.">Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology.</a> Current Opinion in Structural Biology. 23, 345-356 (2013).</li><li>Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scale-up+of+hydrophobin-assisted+recombinant+protein+production+in+tobacco+BY-2+suspension+cells.">Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells.</a> Plant Biotechnology Journal. 12, 402-410 (2014).</li><li>Dohi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+virus-mediated+expression+of+a+foreign+protein+in+suspension-cultured+plant+cells.">Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells.</a> Archives of Virology. 151, 1075-1084 (2006).</li></ol>

Die Autoren haben nichts preisgeben.

Angesichts der Vielfalt in Größe und Stabilität von den Tausenden der Proteine in den biologischen Systemen vorhanden, ist es oft für eine Forschung empirische Labor zu entscheiden, welche heterologen Expressionssystem muss für den Ausdruck eines spezifischen Proteins gewählt werden. E. Coli Expressionssystems ist oft die erste Wahl für Protein-Expression durch die kurze Lebensdauer der Bakterien, low-cost der Nährmedien und relativer Leichtigkeit Scale-up19. Für den Ausdruck der...

Es ist unerlässlich für ein Forschungslabor in der Lage, große Mengen an homogene rekombinante Proteine für Biochemische und biophysikalische Charakterisierungen, speziell für x-ray kristallographischen Studien sein. Es gibt viele etablierte heterologen Expressionssysteme wie Escherichia coli, Hefe, Insektenzellen, Säugerzellen, Pflanzenzellen, etc. unter ihnen, das Baculovirus-vermittelten Insekt Ausdruck Zellsystem ist eines der wichtigsten häufig verwendeten Techniken, große Mengen von strukturell gefalteten großformatigen rekombinante eukaryotic Proteine für Protein Kristallisation1produzieren.
Expressionsvektoren des Expressionssystems Baculovirus wurden entwickelt, um eine starke Polyhedrin oder P10-Promoter zu produzieren eine hohe Ausbeute an rekombinanten intrazelluläre Proteine2,3enthalten. Um eine rekombinante Baculovirus zu machen, ist das Gen des Interesses in ein Insekt Vektor mit den Polyhedrin (Polh) Locus des Genoms Autographa Californica Multi-Nucleopolyhedroviral geklont. Das entstehende Konstrukt dann sequenziert und seine korrekte offenen Leserahmen (ORF) überprüft. Das richtige Konstrukt wird dann in die Wirtszelle Insekt durch den Prozess der Transfektion eingeführt. Das Gen des Interesses wird durch homologe Rekombination in das virale Genom eingefügt. Dieses Ereignis führt zu die Produktion von das rekombinante virale Genom, welche dann repliziert, rekombinante produzieren Virus Partikel1treibt.
Die Insekten, die am häufigsten in Expressionssystems dienen Sf9 und hoch fünf (Hi5) Zellen sind. Sf9 Zellen eine klonale Isolat Sf21, abgeleitet aus den pupal Eierstockkrebs Zellen von Spodoptera Frugiperda, und Hi5 Zellen eine klonale isolieren die elterliche Trichoplusia ni Eierstock Zelle Zeile TN-3684,5abgeleitet. Co Transfektionen, Virus-Verstärkung und Plaque-Assays sind auf Sf9 Zellen durchgeführt, während Hi5 Zellen in der Regel ausgewählt werden, um größere Mengen von rekombinanten Proteinen6zu produzieren. Es ist erwähnenswert, dass die Hi5-Zellen nicht geeignet für die Erzeugung und Verstärkung des Virus Stammarten wegen ihrer Tendenz, mutierte Viren zu produzieren. Traditionell gilt ein Temperaturbereich von 25-30 ° C gut für den Anbau von Insektenzellen. Allerdings wurde berichtet, dass 27-28 ° C die optimale Temperatur für die Insekten Zelle Wachstum und Infektion7,8 ist.
Die Einführung einer starken Signal-Sequenz vor das Gen ist für die hohe Expression von die sekretierten Proteine erforderlich. Die Signalsequenz würde effizient übersetzten rekombinanten Proteins in das endoplasmatische Retikulum für Protein Sekretion und Post-translationalen Modifikationen notwendig für die korrekte Faltung und Stabilisierung3führen. Signal-Peptid-Sequenzen, wurden wie z. B. das Baculovirus Protein GP64/67, Honigbiene Melittin, und andere, umhüllen ausgewählt, um den Ausdruck des sekretorischen rekombinante Proteine in das Baculovirus-vermittelten Expression Systeme3zu erleichtern. Die Einführung der Signalpeptid des GP67 hat sich gezeigt, um den Ausdruck Ertrag eines sekretierten rekombinanten Proteins, im Vergleich mit der intrinsischen Signalpeptid des Ziel-gen9zu verbessern. Hemolin ist ein Hämolymphe Protein der riesigen Seide Motte Hyalophora Cecropia, Bakterien-Infektion10induziert. Die Signal-Peptid-Sequenz des Gens ist aufgrund der relativ hohen induzierten Ausdruck lässt sich Sekretion Expression rekombinanter Proteine in das Baculovirus-Insekt Zellsystem zu vermitteln.
Die A. Thaliana Tracheary Elements Differenzierung hemmenden Faktor-Rezeptor (TDR) und Pollen Rezeptor-Kinase 3 (PRK3) beide zu der Leucin-reiche Wiederholung Rezeptor-wie Kinase (LRR-RLK) Pflanzenfamilie der Proteine11,12 gehören . Um die Struktur und Funktion dieser Familie der Pflanze die Rezeptor-Proteine, sowie die strukturelle und biochemische Charakterisierung von anderen abgesondert Pflanzeneiweiß zu erleichtern zu studieren, hat das Baculovirus-Insekt Zelle Ausdruck System, modifiziert Protein-Qualität und Ertrag zu verbessern. Die extrazellulären Domänen der TDR und PRK3 wurden erfolgreich mit zwei modifizierte Expressionsvektoren in dem Ausdruck Baculovirus-Insekt Zellsystem geäußert. Sowohl die extrazellulären Domänen der TDR und PRK3 Proteine haben kristallisiert. Dieser Artikel berichtet der Ausdruck und die Reinigung von großen Mengen von rekombinanten sekretierten Pflanzeneiweiß mit zwei modifizierte Baculovirus Expressionsvektoren durch den Einbau eines GP67 oder einer Hemolin Signalsequenz zwischen dem Projektträger und mehreren Klonen Seiten.

<table>
	<tbody>
		<tr>
			<td>Incubator shaker</td>
			<td>VWR</td>
			<td>Model Excella E25</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>VWR</td>
			<td>Model 2005</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>BECKMAN</td>
			<td>Model J-6</td>
			<td>with a swing bucket rotor</td>
		</tr>
		<tr>
			<td>Herculase II Fusion DNA Polymerase</td>
			<td>Agilent</td>
			<td>600677-51</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Thermal Cycler</td>
			<td>BIO-RAD</td>
			<td>Model C1000 Touch</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Incubator shaker</td>
			<td>New Brunswick Scientific</td>
			<td>Model I 24</td>
			<td>For growing baceria culture</td>
		</tr>
		<tr>
			<td>Customer DNA synthesis</td>
			<td>GENSCRIPT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3136S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>BglII</td>
			<td>New England Biolabs</td>
			<td>R0144S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>NotI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3189S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>XhoI</td>
			<td>New England Biolabs</td>
			<td>R0146S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td>M0202T</td>
			<td>DNA ligation</td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td>DNA purification from Agorase gel</td>
		</tr>
		<tr>
			<td>QIAprep Spin Miniprep Kit</td>
			<td>Qiagen</td>
			<td>27104</td>
			<td>Plasmid DNA purification from bacteria culture</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Thermo Fisher Scientific</td>
			<td>15510-019</td>
			<td>For DNA gel electropherosis</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH5&#945; competen cell</td>
			<td>Invitrogen</td>
			<td>18-258-012</td>
			<td>For transformation of DNA ligation mixture</td>
		</tr>
		<tr>
			<td>Lennox L LB Broth</td>
			<td>Research Product International Corp.</td>
			<td>L24066-5000.0</td>
			<td>For making bacteria culture</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Thermo Fisher Scientific</td>
			<td>11593-019</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Kanamycin Sulfate</td>
			<td>Thermo Fisher Scientific</td>
			<td>15160-054</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Thermo Fisher Scientific</td>
			<td>64-75-5</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Gentamicin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15710-064</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH10Bac competent cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>10361-012</td>
			<td>For making bacmid DNA</td>
		</tr>
		<tr>
			<td>S.O.C. Medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>15544-034</td>
			<td>For DNA transformation</td>
		</tr>
		<tr>
			<td>CellFECTIN II Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>10362-101</td>
			<td>Insect cell transfection reagent</td>
		</tr>
		<tr>
			<td>Bac-to-Bac Expression System</td>
			<td>Thermo Fisher Scientific</td>
			<td>10359-016</td>
			<td>Baculovirus-insect cells expression kit</td>
		</tr>
		<tr>
			<td>Bluo-gal</td>
			<td>Thermo Fisher Scientific</td>
			<td>15519-028</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Thermo Fisher Scientific</td>
			<td>15529-019</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>pFastBac1</td>
			<td>Thermo Fisher Scientific</td>
			<td>10360014</td>
			<td>Baculorirus expression vector</td>
		</tr>
		<tr>
			<td>Sf9 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>11496015</td>
			<td>Sf9 monolayer cells</td>
		</tr>
		<tr>
			<td>Hi5 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>B85502</td>
			<td>High Five insect cells</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, unsupplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11595030</td>
			<td>Sf9 cell transfection minimum medium</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, supplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11605102</td>
			<td>Sf9 monolayer cell culture complete medium</td>
		</tr>
		<tr>
			<td>Sf-900 II SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10902104</td>
			<td>Sf9 suspension cell culture medium without FBS</td>
		</tr>
		<tr>
			<td>Express Five SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10486025</td>
			<td>Hi5 cell culture medium</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140122</td>
			<td>100 ml (10,000 I.U./ml)</td>
		</tr>
		<tr>
			<td>L-Glutamine (200 mM)&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>25030081</td>
			<td>100 ml</td>
		</tr>
		<tr>
			<td>FBS Certified</td>
			<td>Thermo Fisher Scientific</td>
			<td>16000-044</td>
			<td>500 ml</td>
		</tr>
		<tr>
			<td>6-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>08-772-1B</td>
			<td>Flat-bottom</td>
		</tr>
		<tr>
			<td>150 mm plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>353025</td>
			<td>100/case</td>
		</tr>
		<tr>
			<td>1.5 ml Microcentrifuge Tubes</td>
			<td>USA Scientific</td>
			<td>1415-2500</td>
			<td>500 tubes/bag</td>
		</tr>
		<tr>
			<td>15 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1475-0511</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>50 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1500-1211</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>Ni-NTA Superflow</td>
			<td>Qiagen</td>
			<td>30430</td>
			<td>NiNTA resin</td>
		</tr>
		<tr>
			<td>pH-indicator strips</td>
			<td>EMD Millipore Corporation</td>
			<td>1.09535.0001</td>
			<td>pH 0 - 14</td>
		</tr>
	</tbody>
</table>

modifying baculovirus expression vectors to produce secreted plant proteins in insect cells

Es war eine Herausforderung für die Wissenschaftler rekombinante sekretorischen eukaryotic Proteine für strukturelle und biochemische Studien zum Ausdruck bringen. Das Baculovirus-vermittelten Insekt Ausdruck Zellsystem ist eines der Systeme verwendet, um rekombinante eukaryotic sekretorische Proteine mit einigen Post-translationalen Modifikationen auszudrücken. Die sekretorischen Proteine müssen durch die sekretorischen Wege für Protein Glycosylation, Disulfid-Bindungen-Bildung und andere Post-translationalen Modifikationen weitergeleitet werden. Um die vorhandenen Insekten Zelle Ausdruck von sekretorischen Pflanzeneiweiß zu verbessern, wird ein Baculovirus Expressionsvektor durch die Zugabe von entweder ein GP67 oder ein Hemolin Signal Peptidsequenz zwischen dem Veranstalter und Klonen von mehreren Seiten geändert. Dieses neu gestaltete modifizierte vektorsystem produziert erfolgreich eine hohe Ausbeute an löslichen recombinant sekretierten Pflanze Rezeptorproteine von Arabidopsis Thaliana. Zwei der zum Ausdruck gebrachten pflanzlichen Proteinen, die extrazellulären Domänen von Arabidopsis TDR und PRK3 Plasma Membranrezeptoren, wurden für x-ray kristallographische Untersuchungen kristallisiert. Das modifizierte vektorsystem ist ein verbessertes Werkzeug, das potentiell für die Expression rekombinanter sekretorische Proteine im Tierreich als auch verwendet werden kann.

Wie in Abbildung 1dargestellt, wurden zwei modifizierte pFastBac1 Baculovirus Expressionsvektoren verwendet, um auszudrücken die sekretierten Proteine mit der GP67 oder der Hemolin Signalsequenz, die intrinsische Signalsequenz des Zielgens zu ersetzen. Die virale GP67 haben Insekt Hemolin Gene nachgewiesen und zu hohen Sekretion Ausdruck Niveaus in den Zellen haben. Fusionsproteine mit einem dieser beiden Signalsequenzen sollen Sekretion Ausdruck Ebenen verb...

Watch this Scientific Journal Video about Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells at JoVE.com

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Pflanzliche Proteine in Insektenzellen abgesondert ändern Baculovirus Expressionsvektoren herstellen

Hier präsentieren wir Ihnen die Protokolle zur Nutzung von Insekten Zell- und Baculovirus Protein Expressionssystems zu produzieren große Mengen an Pflanzeneiweiß abgesondert für Protein Kristallisation. Ein Baculovirus Expressionsvektor wurde entweder mit GP67 oder Insekt Hemolin Signalpeptid für Pflanze Sekretion Proteinexpression in Insektenzellen geändert.

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The ...

modifying-baculovirus-expression-vectors-to-produce-secreted-plant

Research

JoVE Journal

Biochemistry

11.4K Aufrufe.  North Carolina State University. Hier präsentieren wir Ihnen die Protokolle zur Nutzung von Insekten Zell- und Baculovirus Protein Expressionssystems zu produzieren große Mengen an Pflanzeneiweiß abgesondert für Protein Kristallisation. Ein Baculovirus Expressionsvektor wurde entweder mit GP67 oder Insekt Hemolin Signalpeptid für Pflanze Sekretion Proteinexpression in Insektenzellen geändert.

Serie: Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug used to treat depression and anxiety by binding to the serotonin transporter with high-affinity, blocking serotonin reuptake. Here we report an efficient procedure and a set of tools to stabilize, express, purify, and crystallize serotonin transporter-antibody complexes bound to S-citalopram and other antidepressants. Mutations which stabilize the serotonin transporter were identified using an S-citalopram binding assay. Serotonin transporter expressed in baculovirus-transduced HEK293S GnTI- cells, was reconstituted into proteoliposomes and used to raise high-affinity antibodies. We have developed a strategy to discover antibodies that are useful for structural studies. A straightforward approach for the expression of antibody fragments in Sf9 cells has also been established. Transporter-antibody complexes purified using this procedure are well-behaved and readily crystallize, producing complexes with S-citalopram that diffract X-rays to 3-4 &#197; resolution. The strategies developed here can be utilized to determine the structure of other challenging membrane proteins.

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

This manuscript describes how to screen for thermostabilizing mutations, purify the human serotonin transporter, generate high affinity antibodies, and crystallize the serotonin transporter-antibody complex bound to the antidepressant drug S-citalopram. This protocol can be adapted to the study of other challenging membrane transporters, receptors, and channels.

Thermostabilization, Expression, Reinigung und Kristallisation des menschlichen Serotonin-Transporter-Bound<em&gt; S</em&gt; -Citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Forschung

Biochemie

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from the oxidation of reduced compounds such as nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2). The complete annotation of the Arabidopsis thaliana genome has established it as the most widely used plant model system, and thus the need to purify mitochondria from a variety of organs (leaf, root, or flower) is necessary to fully utilize the tools that are now available for Arabidopsis to study mitochondrial biology. Mitochondria are isolated by homogenization of the tissue using a variety of approaches, followed by a series of differential centrifugation steps producing a crude mitochondrial pellet that is further purified using continuous colloidal density gradient centrifugation. The colloidal density material is subsequently removed by multiple centrifugation steps. Starting from 100 g of fresh leaf tissue, 2 - 3 mg of mitochondria can be routinely obtained. Respiratory experiments on these mitochondria display typical rates of 100 - 250 nmol O2 min-1 mg total mitochondrial protein-1 (NADH-dependent rate) with the ability to use various substrates and inhibitors to determine which substrates are being oxidized and the capacity of the alternative and cytochrome terminal oxidases. This protocol describes an isolation method of mitochondria from Arabidopsis thaliana leaves using continuous colloidal density gradients and an efficient respiratory measurements of purified plant mitochondria.

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

As mitochondria are only a small percentage of the plant cell, they need to be purified for a range of studies. Mitochondria can be isolated from a variety of plant organs by homogenization, followed by differential and density gradient centrifugation to obtain a highly purified mitochondrial fraction.

Isolation und Atemwege Messungen der Mitochondrien von Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a chemical defense because it has antimicrobial activity and is considered a natural insecticide. Caffeine can also produce negative allelopathic effects that prevent the growth of surrounding plants. In addition, people around the world consume caffeine for its analgesic and stimulatory effects. Due to interest in the technological applications of caffeine, research on the biosynthetic pathway of this compound has grown. These studies have primarily focused on understanding the biochemical and molecular mechanisms that regulate the biosynthesis of caffeine. In vitro tissue culture has become a useful system for studying this biosynthetic pathway. This article will describe a step-by-step protocol for the quantification of caffeine and for measuring the transcript levels of the gene (CCS1) encoding caffeine synthase (CS) in cell suspensions of C. arabica L. as well as its activity.

This protocol describes an efficient methodology for the extraction and quantification of caffeine in cell suspensions of C. arabica L. and an experimental process for evaluating the enzymatic activity of caffeine synthase with the expression level of the gene that encodes this enzyme.

Koffein-Extraktion, enzymatische Aktivität und Genexpression von Koffein-Synthase aus Anlage Zellsuspensionen

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Dissipative Microgravimetry to Study the Binding Dynamics of the Phospholipid Binding Protein Annexin A2 to Solid-supported Lipid Bilayers Using a Quartz Resonator

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic properties of the absorbed/immobilized mass on sensor surfaces, allowing the measurements of the interaction of proteins with solid-supported surfaces, such as lipid bilayers, in real-time and with a high sensitivity. Annexins are a highly conserved group of phospholipid-binding proteins that interact reversibly with the negatively charged headgroups via the coordination of calcium ions. Here, we describe a protocol that was employed to quantitatively analyze the binding of annexin A2 (AnxA2) to planar lipid bilayers prepared on the surface of a quartz sensor. This protocol is optimized to obtain robust and reproducible data and includes a detailed step-by-step description. The method can be applied to other membrane-binding proteins and bilayer compositions.

Here, we present an experimental protocol that can be employed to determine the binding affinities and mode of interaction of label-free phospholipid-binding protein annexin A2 with immobilized solid-supported bilayers (SLB) by simultaneously measuring the mass uptake and the viscoelastic properties of the protein annexin A2.

Dissipative Microgravimetry die Bindung Dynamik der Phospholipid-bindende Protein Annexin A2, solide unterstützt Lipid Bilayer mit einem Quarz-Resonator zu studieren

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic ...

How to Quantify the Fraction of Photoactivated Fluorescent Proteins in Bulk and in Live Cells

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells and protein ensembles. Thus far, no method has been available to quantify in bulk and in live cells how many of the PA-FPs expressed are photoactivated to fluoresce.
Here, we present a protocol involving internal rulers, i.e., genetically coupled spectrally distinct (photoactivatable) fluorescent proteins, to ratiometrically quantify the fraction of all PA-FPs expressed in a cell that are switched on to be fluorescent. Using this protocol, we show that different modes of photoactivation yielded different photoactivation efficiencies. Short high-power photoactivation with a confocal laser scanning microscope (CLSM) resulted in up to four times lower photoactivation efficiency than hundreds of low-level exposures applied by CLSM or a short pulse applied by widefield illumination. While the protocol has been exemplified here for (PA-)GFP and (PA-)Cherry, it can in principle be applied to any spectrally distinct photoactivatable or photoconvertible fluorescent protein pair and any experimental set-up.

Here, we present a protocol that involves genetically coupled spectrally distinct photoactivatable and fluorescent proteins. These fluorescent protein chimeras permit quantification of the PA-FP fraction that is photoactivated to be fluorescent, i.e., the photoactivation efficiency. The protocol reveals that different modes of photoactivation yield different photoactivation efficiencies.

Wie den Anteil der photoaktiviert fluoreszierende Proteine in großen Mengen und in lebenden Zellen zu quantifizieren

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological functions. Such interactions can be highly dynamic, meaning the interacting subunits are constantly associated and dissociated at certain rates. While measuring the binding affinity using techniques such as quantitative pull-down reveals the strength of the interaction, studying the binding kinetics provides insights on how fast the interaction occurs and how long each complex can exist. Furthermore, measuring the kinetics of an interaction in the presence of an additional factor, such as a protein exchange factor or a drug, helps reveal the mechanism by which the interaction is regulated by the other factor, providing important knowledge for the advancement of biological and medical research. Here, we describe a protocol for measuring the binding kinetics of a protein complex that has a high intrinsic association rate and can be dissociated quickly by another protein. The method uses fluorescence resonance energy transfer to report the formation of the protein complex in vitro, and it enables monitoring the fast association and dissociation of the complex in real time on a stopped-flow fluorimeter. Using this assay, the association and dissociation rate constants of the protein complex are quantified.

Protein-protein interactions are critical for biological systems, and studies of the binding kinetics provide insights into the dynamics and function of protein complexes. We describe a method that quantifies the kinetic parameters of a protein complex using fluorescence resonance energy transfer and the stopped-flow technique. &#160;

In-vitro-Fluoreszenz Resonanz Energietransfer verwenden, um die Dynamik der Proteinkomplexe auf einer Millisekunde Zeitskala studieren

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this superfamily generally display multi-functionality, involving mainly hydrolase and decarboxylase mechanisms. This article presents a series of consecutive methods for the expression and purification of FAHD proteins, mainly FAHD protein 1 (FAHD1) orthologues among species (human, mouse, nematodes, plants, etc.). Covered methods are protein expression in E. coli, affinity chromatography, ion exchange chromatography, preparative and analytical gel filtration, crystallization, X-ray diffraction, and photometric assays. Concentrated protein of high levels of purity (&#62;98%) may be employed for crystallization or antibody production. Proteins of similar or lower quality may be employed in enzyme assays or used as antigens in detection systems (Western-Blot, ELISA). In the discussion of this work, the identified enzymatic mechanisms of FAHD1 are outlined to describe its hydrolase and decarboxylase bi-functionality in more detail.

Expression and purification of fumarylacetoacetate hydrolase domain-containing proteins is described with examples (expression in E. coli, FPLC). Purified proteins are used for crystallization and antibody production and employed for enzyme assays. Selected photometric assays are presented to display the multi-functionality of FAHD1 as oxaloacetate decarboxylase and acylpyruvate hydrolase.

Expression, Reinigung, Kristallisation und Enzym-Assays von Fumarylacetoacetat-Hydrolase-Domänen-haltigen Proteinen

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Obtaining High-Quality Transcriptome Data from Cereal Seeds by a Modified Method for Gene Expression Profiling

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality RNA is often hindered by high starch and sugar content. These compounds can reduce both the yield and the quality of the extracted total RNA. The deterioration in quantity and quality of total RNA can subsequently have a significant impact on the downstream transcriptomic analyses, which may not accurately reflect the spatial and/or temporal variation in the gene expression profile of the samples being tested. In this protocol, we describe an optimized method for extraction of total RNA with sufficient quantity and quality to be used for whole transcriptome analysis of cereal grains. The described method is suitable for several downstream applications used for transcriptomic profiling of developing, germinating, and mature cereal seeds. The method of transcriptome profiling using a microarray platform is shown. This method is specifically designed for gene expression profiling of cereals with described genome sequences. The detailed procedure from microarray handling to final quality control is described. This includes cDNA synthesis, cRNA labelling, microarray hybridization, slide scanning, feature extraction, and data quality validation. The data generated by this method can be used to characterize the transcriptome of cereals during germination, in various stages of grain development, or at different biotic or abiotic stress conditions. The results presented here exemplify high-quality transcriptome data amenable for downstream bioinformatics analyses, such as the determination of differentially expressed genes (DEGs), characterisation of gene regulatory networks, and conducting transcriptome-wide association study (TWAS).

A method for transcriptome profiling of cereals is presented. The microarray-based gene expression profiling starts with the isolation of high-quality total RNA from cereal grains and continues with the generation of cDNA. After cRNA labelling and microarray hybridization, recommendations are given for signal detection and quality control.

Beschaffung hochwertiger Transkriptomdaten von Getreidesamen durch eine modifizierte Methode zur Genexpressionsprofilierung

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality ...

Transverse Sectioning of Mature Rice (Oryza sativa L.) Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm phenotyping can be used to classify genotypes based on SG morphotype using scanning electron microscopic (SEM) analysis. SGs can be visualized using SEM by slicing through the kernel (pericarp, aleurone layers, and endosperm) and exposing the organellar contents. Current methods require the rice kernel to be embedded in plastic resin and sectioned using a microtome or embedded in a truncated pipette tip and sectioned by hand using a razor blade. The former method requires specialized equipment and is time-consuming, while the latter introduces a new host of problems depending on rice genotype. Chalky rice varieties, particularly, pose a problem for this type of sectioning due to the friable nature of their endosperm tissue. Presented here is a technique for preparing translucent and chalky rice kernel sections for microscopy, requiring only pipette tips and a scalpel blade. Preparing the sections within the confines of a pipette tip prevents rice kernel endosperm from shattering (for translucent or &#8216;vitreous&#8217; phenotypes) and crumbling (for chalky phenotypes). Using this technique, endosperm cell patterning and the structure of intact SGs can be observed.

Transverse Sectioning of Mature Rice Oryza sativa L. Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

This protocol allows for the preparation of transverse sections of cereal seeds (e.g., rice) for the analysis of endosperm and starch granule morphology using scanning electron microscopy.

Querschnitt von reifem Reis (Oryza sativa L.) Kerne für die Rasterelektronenmikroskopie-Bildgebung mit Pipettenspitzen als Immobilisierungsunterstützung

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm ...

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based phosphoproteomics has transformed the way of studying plant signal transduction. However, requirement of lots of starting materials and prolonged MS measurement time to achieve the depth of coverage has been the limiting factor for the high throughput study of global phosphoproteomic changes in plants. To improve the sensitivity and throughput of plant phosphoproteomics, we have developed a stop and go extraction (stage) tip based phosphoproteomics approach coupled with Tandem Mass Tag (TMT) labeling for the rapid and comprehensive analysis of plant phosphorylation perturbation in response to osmotic stress. Leveraging the simplicity and high throughput of stage tip technique, the whole procedure takes approximately one hour using two tips to finish phosphopeptide enrichment, fractionation, and sample cleaning steps, suggesting an easy-to-use and high efficiency of the approach. This approach not only provides an in-depth plant phosphoproteomics analysis (&#62; 11,000 phosphopeptide identification) but also demonstrates the superior separation efficiency (&#60; 5% overlap) between adjacent fractions. Further, multiplexing has been achieved using TMT labeling to quantify the phosphoproteomic changes of wild-type and snrk2 decuple mutant plants. This approach has successfully been used to reveal the phosphorylation events of Raf-like kinases in response to osmotic stress, which sheds light on the understanding of early osmotic signaling in land plants.

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Presented here is a phosphoproteomic approach, namely stop and go extraction tip based phosphoproteomic, which provides high-throughput and deep coverage of Arabidopsis phosphoproteome. This approach delineates the overview of osmotic stress signaling in Arabidopsis.

Pflanzliche Proteine in Insektenzellen abgesondert ändern Baculovirus Expressionsvektoren herstellen

PLAYLIST