Name: preparation of neutrally-charged, ph-responsive polymeric nanoparticles for cytosolic sirna delivery
Uploaded: 2019-05-02T15:00:00
Description: Watch this Scientific Journal Video about Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery at JoVE.com

The authors are grateful to Drs. Craig Duvall and Rebecca Cook for access to data and lab resources for conducting this research. The authors are grateful to the Vanderbilt Institute for Nanoscale Science and Engineering (VINSE) for access to DLS and TEM (NSF EPS 1004083) instruments. The authors are grateful to the National Science Foundation for supporting the Graduate Research Fellowship Program (NSF#1445197). The authors are grateful to the National Institutes of Health for financial support (NIH R01 EB019409). The authors are grateful to the Department of Defense Congressionally Directed Medical Research program for financial support (DOD CDMRP OR130302).

1. Preparation and characterization of si-NPs
<ol>
	<li>si-NP preparation
	<ol>
		<li>Dissolve polymer in 10 mM citric acid buffer (pH 4.0) at 3.33 mg/mL. Polymer can first be dissolved at 10x concentration in ethanol to ensure dissolution. 
		NOTE: Polymer can be dissolved at lower concentrations, but use at concentrations above 3.33 mg/mL can prevent homogenous NP formation.</li>
		<li>Add siRNA (50 &#956;M in diH2O) to result in N+:P- ratio of 10. Mix polymer and siRNA solutions...

<ol>
	<li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Elbashir, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duplexes+of+21-nucleotide+RNAs+mediate+RNA+interference+in+cultured+mammalian+cells.">Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.</a> Nature. 411 (6836), 494-498 (2001).</li><li>Soutschek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+silencing+of+an+endogenous+gene+by+systemic+administration+of+modified+siRNAs.">Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs.</a> Nature. 432 (7014), 173-178 (2004).</li><li>Hannon, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference.">RNA interference.</a> Nature. 418, 244 (2002).</li><li>Dykxhoorn, D. M., Palliser, D., Lieberman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+silent+treatment:+siRNAs+as+small+molecule+drugs.">The silent treatment: siRNAs as small molecule drugs.</a> Gene Therapy. 13 (6), 541-552 (2006).</li><li>Wittrup, A., Lieberman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knocking+down+disease:+a+progress+report+on+siRNA+therapeutics.">Knocking down disease: a progress report on siRNA therapeutics.</a> Nature Reviews Genetics. 16 (9), 543 (2015).</li><li>Li, H. E., Nelson, C. C., Evans, B., Duvall, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+Intracellular-Acting+Biologics+in+Pro-Apoptotic+Therapies.">Delivery of Intracellular-Acting Biologics in Pro-Apoptotic Therapies.</a> Current Pharmaceutical Design. 17 (3), 293-319 (2011).</li><li>Bartlett, D. W., Davis, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+siRNA+nuclease+stability+on+the+in+vitro+and+in+vivo+kinetics+of+siRNA-mediated+gene+silencing.">Effect of siRNA nuclease stability on the in vitro and in vivo kinetics of siRNA-mediated gene silencing.</a> Biotechnology and Bioengineering. 97 (4), 909-921 (2007).</li><li>Zuckerman, J. E., Choi, C. H., Han, H., Davis, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycation-siRNA+nanoparticles+can+disassemble+at+the+kidney+glomerular+basement+membrane.">Polycation-siRNA nanoparticles can disassemble at the kidney glomerular basement membrane.</a> Proceedings of the National Academy of Sciences USA. 109 (8), 3137-3142 (2012).</li><li>Dominska, M., Dykxhoorn, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breaking+down+the+barriers:+siRNA+delivery+and+endosome+escape.">Breaking down the barriers: siRNA delivery and endosome escape.</a> Journal of Cell Science. 123 (Pt 8), 1183-1189 (2010).</li><li>Gilleron, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Image-based+analysis+of+lipid+nanoparticle&#8211;mediated+siRNA+delivery,+intracellular+trafficking+and+endosomal+escape.">Image-based analysis of lipid nanoparticle&#8211;mediated siRNA delivery, intracellular trafficking and endosomal escape.</a> Nature Biotechnology. 31 (7), 638 (2013).</li><li>Sahay, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficiency+of+siRNA+delivery+by+lipid+nanoparticles+is+limited+by+endocytic+recycling.">Efficiency of siRNA delivery by lipid nanoparticles is limited by endocytic recycling.</a> Nature Biotechnology. 31 (7), 653-658 (2013).</li><li>Wittrup, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+lipid-formulated+siRNA+release+from+endosomes+and+target+gene+knockdown.">Visualizing lipid-formulated siRNA release from endosomes and target gene knockdown.</a> Nature Biotechnology. 33 (8), 870-876 (2015).</li><li>Kanasty, R., Dorkin, J. R., Vegas, A., Anderson, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+materials+for+siRNA+therapeutics.">Delivery materials for siRNA therapeutics.</a> Nature Materials. 12 (11), 967-977 (2013).</li><li>Adams, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patisiran,+an+RNAi+Therapeutic,+for+Hereditary+Transthyretin+Amyloidosis.">Patisiran, an RNAi Therapeutic, for Hereditary Transthyretin Amyloidosis.</a> New England Journal of Medicine. 379 (1), 11-21 (2018).</li><li>Dang, C. V., Reddy, E. P., Shokat, K. M., Soucek, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+'undruggable'+cancer+targets.">Drugging the 'undruggable' cancer targets.</a> Nature Reviews Cancer. 17 (8), 502 (2017).</li><li>Alexis, F., Pridgen, E., Molnar, L. K., Farokhzad, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Factors+affecting+the+clearance+and+biodistribution+of+polymeric+nanoparticles.">Factors affecting the clearance and biodistribution of polymeric nanoparticles.</a> Molecular Pharmaceutics. 5 (4), 505-515 (2008).</li><li>Verbaan, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fate+of+poly(2-dimethyl+amino+ethyl)methacrylate-based+polyplexes+after+intravenous+administration.">The fate of poly(2-dimethyl amino ethyl)methacrylate-based polyplexes after intravenous administration.</a> International Journal of Pharmaceutics. 214 (1-2), 99-101 (2001).</li><li>Lv, H., Zhang, S., Wang, B., Cui, S., Yan, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toxicity+of+cationic+lipids+and+cationic+polymers+in+gene+delivery.">Toxicity of cationic lipids and cationic polymers in gene delivery.</a> Journal of Controlled Release. 114 (1), 100-109 (2006).</li><li>Shi, J., Kantoff, P. W., Wooster, R., Farokhzad, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+nanomedicine:+progress,+challenges+and+opportunities.">Cancer nanomedicine: progress, challenges and opportunities.</a> Nature Reviews Cancer. 17 (1), 20 (2016).</li><li>Torchilin, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+delivery+of+macromolecular+drugs+based+on+the+EPR+effect.">Tumor delivery of macromolecular drugs based on the EPR effect.</a> Advanced Drug Delivery Reviews. 63 (3), 131-135 (2011).</li><li>Duncan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dawning+era+of+polymer+therapeutics.">The dawning era of polymer therapeutics.</a> Nature Reviews Drug Discovery. 2 (5), 347 (2003).</li><li>Tang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+the+optimal+size+of+anticancer+nanomedicine.">Investigating the optimal size of anticancer nanomedicine.</a> Proceedings of the National Academy of Sciences USA. 111 (43), 15344-15349 (2014).</li><li>Nelson, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Balancing+Cationic+and+Hydrophobic+Content+of+PEGylated+siRNA+Polyplexes+Enhances+Endosome+Escape,+Stability,+Blood+Circulation+Time,+and+Bioactivity+in+vivo.">Balancing Cationic and Hydrophobic Content of PEGylated siRNA Polyplexes Enhances Endosome Escape, Stability, Blood Circulation Time, and Bioactivity in vivo.</a> ACS Nano. 7 (10), 8870-8880 (2013).</li><li>Jackson, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zwitterionic+Nanocarrier+Surface+Chemistry+Improves+siRNA+Tumor+Delivery+and+Silencing+Activity+Relative+to+Polyethylene+Glycol.">Zwitterionic Nanocarrier Surface Chemistry Improves siRNA Tumor Delivery and Silencing Activity Relative to Polyethylene Glycol.</a> ACS Nano. , (2017).</li><li>Akinc, A., Thomas, M., Klibanov, A. M., Langer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+polyethylenimine-mediated+DNA+transfection+and+the+proton+sponge+hypothesis.">Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis.</a> The Journal of Gene Medicine. 7 (5), 657-663 (2005).</li><li>de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., Subramani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Firefly+luciferase+gene:+structure+and+expression+in+mammalian+cells.">Firefly luciferase gene: structure and expression in mammalian cells.</a> Molecular and Cellular Biology. 7 (2), 725-737 (1987).</li><li>Aggarwal, P., Hall, J. B., McLeland, C. B., Dobrovolskaia, M. A., McNeil, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanoparticle+interaction+with+plasma+proteins+as+it+relates+to+particle+biodistribution,+biocompatibility+and+therapeutic+efficacy.">Nanoparticle interaction with plasma proteins as it relates to particle biodistribution, biocompatibility and therapeutic efficacy.</a> Advanced Drug Delivery Reviews. 61 (6), 428-437 (2009).</li><li>Geng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shape+effects+of+filaments+versus+spherical+particles+in+flow+and+drug+delivery.">Shape effects of filaments versus spherical particles in flow and drug delivery.</a> Nature Nanotechnology. 2 (4), 249 (2007).</li><li>Chauhan, V. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+nanorods+and+nanospheres+for+real-time+in+vivo+probing+of+nanoparticle+shape-dependent+tumor+penetration.">Fluorescent nanorods and nanospheres for real-time in vivo probing of nanoparticle shape-dependent tumor penetration.</a> Angewandte Chemie International Edition. 50 (48), 11417-11420 (2011).</li><li>Chu, K. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma,+tumor+and+tissue+pharmacokinetics+of+Docetaxel+delivered+via+nanoparticles+of+different+sizes+and+shapes+in+mice+bearing+SKOV-3+human+ovarian+carcinoma+xenograft.">Plasma, tumor and tissue pharmacokinetics of Docetaxel delivered via nanoparticles of different sizes and shapes in mice bearing SKOV-3 human ovarian carcinoma xenograft.</a> Nanomedicine. 9 (5), 686-693 (2013).</li><li>Werfel, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+mTORC2+Inhibitor+Therapeutically+Blocks+Breast+Cancer+Cell+Growth+and+Survival.">Selective mTORC2 Inhibitor Therapeutically Blocks Breast Cancer Cell Growth and Survival.</a> Cancer Research. 78 (7), 1845-1858 (2018).</li><li>Sarett, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipophilic+siRNA+targets+albumin+in+situ+and+promotes+bioavailability,+tumor+penetration,+and+carrier-free+gene+silencing.">Lipophilic siRNA targets albumin in situ and promotes bioavailability, tumor penetration, and carrier-free gene silencing.</a> Proceedings of the National Academy of Sciences USA. 114 (32), E6490-E6497 (2017).</li><li>Williams, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+apoptotic+pathway+activation+increases+response+to+anti-estrogens+in+luminal+breast+cancers.">Intrinsic apoptotic pathway activation increases response to anti-estrogens in luminal breast cancers.</a> Cell Death and Disease. 9 (2), 21 (2018).</li><li>Evans, B. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+Vivo+Red+Blood+Cell+Hemolysis+Assay+for+the+Evaluation+of+pH-responsive+Endosomolytic+Agents+for+Cytosolic+Delivery+of+Biomacromolecular+Drugs.">Ex Vivo Red Blood Cell Hemolysis Assay for the Evaluation of pH-responsive Endosomolytic Agents for Cytosolic Delivery of Biomacromolecular Drugs.</a> Journal of Visualized Experiments. (73), e50166 (2013).</li><li>Werfel, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+Optimization+of+PEG+Architecture+and+Hydrophobic+Content+Improves+siRNA+Polyplex+Stability,+Pharmacokinetics,+and+Potency+In+vivo.">Combinatorial Optimization of PEG Architecture and Hydrophobic Content Improves siRNA Polyplex Stability, Pharmacokinetics, and Potency In vivo.</a> Journal of Controlled Release. , (2017).</li><li>Kilchrist, K. V., Evans, B. C., Brophy, C. M., Duvall, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism+of+Enhanced+Cellular+Uptake+and+Cytosolic+Retention+of+MK2+Inhibitory+Peptide+Nano-polyplexes.">Mechanism of Enhanced Cellular Uptake and Cytosolic Retention of MK2 Inhibitory Peptide Nano-polyplexes.</a> Cellular and Molecular Bioengineering. 9 (3), 368-381 (2016).</li><li>Kilchrist, K. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gal8+Visualization+of+Endosome+Disruption+Predicts+Carrier-Mediated+Biologic+Drug+Intracellular+Bioavailability.">Gal8 Visualization of Endosome Disruption Predicts Carrier-Mediated Biologic Drug Intracellular Bioavailability.</a> ACS Nano. , (2019).</li></ol>

The si-NPs described here are formed by electrostatic association of anionic siRNA and cationic polymers into polyion complexes (polyplexes). Electrostatic complexing of siRNA and the cationic DB block of PEG-DB polymers is facilitated by mixing at low pH (4.0). At pH 4.0, DMAEMA is highly protonated, and consequently the DB block is highly charged. This ensures that the polymers dissolve as unimers in solution as opposed to forming micelles and that DB complexes efficiently with siRNA. Subsequently, the pH of solution i...

Because siRNAs inhibit the translation of proteins from mRNA sequences, they can theoretically be used to drug all known pathologies1,2,3,4,5. However, the use of siRNA in medicine is limited by the comprehensively poor pharmacokinetic profile of siRNA molecules6,7. When injected intravenously, siRNAs are rapidly cleared through the kidneys and/or degraded by nucleases8,9. Due to its large size and negative charge, siRNA cannot enter cells or escape the endolysosomal pathway to access the RNA-Induced Silencing Complex (RISC) that resides in the cytosol10,11,12,13. Thus, extensive effort has focused on the design and implementation of siRNA delivery strategies14. This effort has largely focused on the development of lipid- and polymer-based nanoparticles which package siRNA, protect it from clearance and degradation in vivo, and initiate cellular uptake and endosomal escape through ionizable, cationic amine groups. Many pre-clinical successes have been reported and most recently, the first clinical success has been reported for nanoparticle-based hepatic siRNA delivery to treat hereditary transthyretin-mediated (hATTR) amyloidosis15.
There are many cancer-causing genes that are currently &#8220;undruggable&#8221; by conventional pharmacology (i.e., small molecule drugs), motivating the design of polymeric siRNA nanoparticles (si-NPs) to treat cancer16. However, there are a separate set of design parameters that must be considered for non-hepatic siRNA delivery. The delivery system must shield the cationic charge of the polyplex which causes agglutination within the systemic circulation17,18,19. For tumor delivery, specifically, si-NP stability is essential to endow long circulation and thus increased accumulation within tumors via the enhanced permeability and retention (EPR) effect20,21. Moreover, control over si-NP size is essential since only nanoparticles approximately 20 &#8211; 200 nm diameter in size leverage EPR22, and smaller si-NPs (~20 &#8211; 50 nm diameter) exhibit improved tumor penetration over larger sized nanoparticles and microparticles23.
To address these additional design constraints for systemic tumor delivery of siRNA following intravenous administration, neutrally-charged, pH-responsive si-NPs have been developed (Figure 1)24. These si-NPs are PEGylated, or most recently, Zwitterionated25, for neutral surface charge and resistance to protein adsorption and opsonization in circulation. Since they cannot rely solely on cationic character to drive intracellular delivery, extremely efficient endosomal escape is imperative for achieving potent gene silencing. Accordingly, the core of these si-NPs is composed of a highly endosomolytic core which is inert at extracellular pH (7.4), but which is triggered in a switch-like manner in the acidified conditions of the endolysosomal pathway [pH 6.8 (early endosomes) &#8211; 5.0 (lysosomes)]. Lastly, a mixture of cationic and hydrophobic content within the core of si-NPs provide both electrostatic and van der Waals stabilization forces, improving stability of the si-NPs in blood compared to merely cationic systems.
The integration of many functions into a relatively simple design is possible using Reversible Addition-Fragmentation chain Transfer (RAFT) controlled polymerization to produce polymers with complex architecture and precise composition. To produce si-NPs with neutral surface charge, pH-responsiveness, and NP stability, RAFT is used to synthesize poly(ethylene glycol-b-[2-(dimethylamino)ethyl methacrylate-co-butyl methacrylate]) (PEG-DB; Figure 1A). PEG-DB is electrostatically complexed with siRNA, forming si-NPs with a PEG corona and DB/siRNA core (Figure 1B). PEG forms an inert, neutrally-charged hydrophilic layer on the si-NP corona. The DB block consists of a 50:50 molar ratio of 2-(dimethylamino)ethyl methacrylate (DMAEMA) and butyl methacrylate (BMA). Cationic DMAEMA electrostatically complexes negatively-charged siRNA. BMA self-associates within the NP core by van der Waals interactions, increasing NP stability. Together, DMAEMA and BMA impart pH-dependent lipid bilayer-lytic behavior to the DB polymer block. At extracellular pH, the DB block is sequestered to the si-NP core and is inert to lipid bilayers. Under acidic conditions, such as those within the endolysosomal pathway, ionizable DMAEMA within the DB block facilitates the proton sponge effect, where endosomal buffering leads to osmotic swelling and rupture26. Additionally, hydrophobic BMA moieties within the DB block actively integrate into and lyse lipid bilayers, resulting in potent endosomolysis. Thus, siRNA is complexed with PEG-DB to form si-NPs that are neutrally-charged and highly stable at extracellular pH but which disrupt lipid bilayers at acidic pH, ensuring cytosolic delivery of the siRNA payload.
Herein are described the experimental procedures to produce si-NPs from PEG-DB. Methods to characterize the physicochemical parameters and bioactivity of si-NPs are presented and discussed. In order to rapidly assess si-NP bioactivity, luciferase is used as a model gene for knockdown studies. Firefly Luciferase is the protein responsible for the &#8216;glow&#8217; of fireflies27. Accordingly, mammalian cells transfected with the firefly luciferase gene produce a bioluminescent &#8216;glow&#8217; that can be captured using a luminometer to quantify levels of Luciferase expression. Here, we use Luciferase to assess bioactivity of si-NPs by delivering siRNA against Luciferase and quantifying the corresponding reduction in bioluminescence in Luciferase-expressing cells compared to cells that receive a scrambled siRNA.

<table>
	<tbody>
		<tr>
			<td>0.45 mm pore-size syringe filters</td>
			<td>Thermo Fisher Scientific</td>
			<td>F25133</td>
			<td>17 mm diameter, PTFE membrane</td>
		</tr>
		<tr>
			<td>0-14 pH test strips</td>
			<td>Millipore Sigma</td>
			<td>P4786</td>
			<td></td>
		</tr>
		<tr>
			<td>10x TAE buffer</td>
			<td>Thermo Fisher Scientific/Invitrogen</td>
			<td>AM9869</td>
			<td></td>
		</tr>
		<tr>
			<td>6-7.7 pH test strips</td>
			<td>Millipore Sigma</td>
			<td>P3536</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well black walled plates</td>
			<td>Corning</td>
			<td>3603</td>
			<td>Tissue-culture treated</td>
		</tr>
		<tr>
			<td>Agarose Powder</td>
			<td>Thermo Fisher Scientific/Invitrogen</td>
			<td>16500</td>
			<td></td>
		</tr>
		<tr>
			<td>Citric acid monohydrate</td>
			<td>Millipore Sigma</td>
			<td>C1909</td>
			<td></td>
		</tr>
		<tr>
			<td>dibasic sodium phosphate dihydrate</td>
			<td>Millipore Sigma</td>
			<td>71643</td>
			<td></td>
		</tr>
		<tr>
			<td>D-luciferin</td>
			<td>Thermo Fisher Scientific</td>
			<td>88294</td>
			<td>Monopotassium Salt</td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>11995065</td>
			<td>High glucose and pyruvate</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Millipore Sigma</td>
			<td>459836</td>
			<td></td>
		</tr>
		<tr>
			<td>ethidium bromide</td>
			<td>Thermo Fisher Scientific/Invitrogen</td>
			<td>15585011</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Gibco</td>
			<td>26140079</td>
			<td></td>
		</tr>
		<tr>
			<td>loading dye</td>
			<td>Thermo Fisher Scientific/Invitrogen</td>
			<td>R0611</td>
			<td></td>
		</tr>
		<tr>
			<td>Luciferase siRNA</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Antisense Strand Sequense: GAGGAGUUCAUUAUCAGUGCAAUUGUU Sense Strand Sequense: CAAUUGCACUGAUAAUGAACUCCT*C* *DNA bases</td>
		</tr>
		<tr>
			<td>MDA-MB-231 / Luciferase (Bsd) stable cells</td>
			<td>GenTarget Inc</td>
			<td>SC059-Bsd</td>
			<td>Luciferase-expressing cells sued to assess si-NP bioactivity</td>
		</tr>
		<tr>
			<td>monobasic sodium phosphate monohydrate</td>
			<td>Millipore Sigma</td>
			<td>S9638</td>
			<td></td>
		</tr>
		<tr>
			<td>Scarmbled siRNA</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Antisense Strand Sequense: AUACGCGUAUUAUACGCGAUUAACGAC Sense Strand Sequense: CGUUAAUCGCGUAUAAUACGCGUA*T* *DNA bases</td>
		</tr>
		<tr>
			<td>square polystyrene cuvettes</td>
			<td>Fisher Scientific</td>
			<td>14-955-129</td>
			<td>4.5 mL capacity</td>
		</tr>
		<tr>
			<td>TEM grids</td>
			<td>Ted Pella, Inc.</td>
			<td>1GC50</td>
			<td>PELCO Center-Marked Grids, 50 mesh, 3.0mm O.D., Copper</td>
		</tr>
		<tr>
			<td>Trisodium citrate dihydrate</td>
			<td>Millipore Sigma</td>
			<td>S1804</td>
			<td></td>
		</tr>
		<tr>
			<td>uranyl acetate</td>
			<td>Polysciences, Inc.</td>
			<td>21447-25</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation of neutrally-charged, ph-responsive polymeric nanoparticles for cytosolic sirna delivery

The success of siRNA as a targeted molecular medicine is dependent upon its efficient cytosolic delivery to cells within the tissue of pathology. Clinical success for treating previously &#8216;undruggable&#8217; hepatic disease targets with siRNA has been achieved. However, efficient tumor siRNA delivery necessitates additional pharmacokinetic design considerations, including long circulation time, evasion of clearance organs (e.g., liver and kidneys), and tumor penetration and retention. Here, we describe the preparation and in vitro physicochemical/biological characterization of polymeric nanoparticles designed for efficient siRNA delivery, particularly to non-hepatic tissues such as tumors. The siRNA nanoparticles are prepared by electrostatic complexation of siRNA and the diblock copolymer poly(ethylene glycol-b-[2-(dimethylamino)ethyl methacrylate-co-butyl methacrylate]) (PEG-DB) to form polyion complexes (polyplexes) where siRNA is sequestered within the polyplex core and PEG forms a hydrophilic, neutrally-charged corona. Moreover, the DB block becomes membrane-lytic as vesicles of the endolysosomal pathway acidify (&#60; pH 6.8), triggering endosomal escape and cytosolic delivery of siRNA. Methods to characterize the physicochemical characteristics of siRNA nanoparticles such as size, surface charge, particle morphology, and siRNA loading are described. Bioactivity of siRNA nanoparticles is measured using luciferase as a model gene in a rapid and high-throughput gene silencing assay. Designs which pass these initial tests (such as PEG-DB-based polyplexes) are considered appropriate for translation to preclinical animal studies assessing the delivery of siRNA to tumors or other sites of pathology.

Some essential characteristics of effective si-NPs for in vivo siRNA delivery are the proper size (~20 &#8211; 200 nm diameter), siRNA packaging, and gene silencing bioactivity. While this is not an exhaustive list (as addressed in the Discussion), these basic characteristics should be confirmed before considering further testing of a formulation.
Figure 2 illustrates the characterization of si-NP s...

Watch this Scientific Journal Video about Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery at JoVE.com

Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery

Methods to prepare and characterize the physicochemical properties and bioactivity of neutrally-charged, pH-responsive siRNA nanoparticles are presented. Criteria for successful siRNA nanomedicines such as size, morphology, surface charge, siRNA loading, and gene silencing are discussed.

The success of siRNA as a targeted molecular medicine is dependent upon its efficient cytosolic delivery to cells within the tissue of pathology. Clinical ...

The current protocol is significant because it allows researchers to produce siRNA loaded nanoparticles, and to adequately characterize these nanoparticles to ensure their suitability for administration to animals prior to subsequent studies. The advantage of this approach is to produce nanoparticles that increase the bioavailability of siRNA and to produce nanoparticles that are neutrally charged and thus suitable for systemic administration. This technique is impactful because siRNA nanoparticles can be applied to treat a myriad of diseases necessitating systemic administration including cancer, cardiovascular disease, and autoimmune disorders, among others.To begin, dissolve polymer in ethanol at a concentration of 33.3 milligrams per milliliter and stir to ensure dissolution. Then use a pipette to transfer polymer solution in 10 millimolar citric acid buffer to reach a concentration of 3.33 milligrams per milliliter. Add distilled water into a tube containing small interfering RNA to achieve a concentration of 50 micromolar.Mix the polymer and small interfering RNA solutions thoroughly in a tube by pipetting up and down to achieve a nitrogen to phosphate ratio of 10. Place the tube at ambient temperature for 30 minutes. Then add one milliliter of 10 millimolar phosphate buffer at pH eight to the tube to achieve a concentration of 0.28 milligrams per milliliter and mix gently either by pipetting or inverting the tube.To confirm that the final pH is neutral, around 7.2 to 7.5, pipette 10 microliters of the small interfering RNA nanoparticles solution onto the pH test strips. First, prepare a dynamic light scattering sample by filtering one milliliter of small interfering RNA nanoparticles at the concentration of 0.28 milligrams per milliliter through 0.45-micrometer pore size syringe filters into a square quartz or polystyrene cuvette. Then record size and surface charge measurements using a dynamic light scattering instrument according to the manufacturer's specifications.To confirm the size and morphology of small interfering RNA nanoparticles using transmission electron microscopy first add five microliters of filtered small interfering RNA nanoparticle solution at 0.28 milligram per milliliter to each TEM grid. Place the grids at ambient temperature for 60 seconds. Blot dry with filter paper for three seconds.Next, add five microliters of 3%uranyl acetate solution to each grid and incubate for 20 seconds. Blot dry for three seconds. Then place the grids in a desiccator to dry overnight before imaging under transmission electron microscopy.To perform agarose gel retardation, first add two grams of electrophoresis-grade agarose powder to 100 milliliters of 1X Tris-acetate-EDTA buffer at pH eight in a beaker to produce 2%agarose gel. Stir to suspend the agarose. Place the beaker uncovered in a microwave to heat for one to three minutes until all agarose is dissolved.Once cooled, add five microliters of ethidium bromide at the concentration of 10 milligrams per milliliter into the beaker and mix well. Then pour the agarose into a gel tray and place comb to produce wells. Let the gel dry for 30 minutes.Carefully remove the comb to leave behind loading wells, and pour 1X Tris-acetate-EDTA buffer into the gel tray to fill to the maximum fill line. Then place two microliter aliquots of loading dye with no SDS or reducing agents on paraffin film for each small interfering RNA nanoparticle formulation at different nitrogen to phosphate ratios. Pipette to mix 10 microliters of small interfering RNA nanoparticle solution with loading dye on paraffin film.Add the mixture to agarose gel wells. Plug the electrophoresis system to a power supply and run voltage source at 100 volts for 35 minutes or until samples have traversed 80%of gel length. Transfer the gel from the tray to a UV transilluminator and visualize the small interfering RNA bands on the UV transilluminator according to the manufacturer's specifications.Determine the optimum nitrogen to phosphate ratio based on the disappearance of small interfering RNA bands at the bottom of the gel. To knock down model gene luciferase, first seed luciferase-expressing cells in a 96-well black walled plate with DMEM in 10%FBS at a density of 2, 000 cells per well. Place the plate into an incubator overnight to allow the cells to adhere.In the morning remove media and add 10 microliters per well of small interfering RNA nanoparticles diluted into full serum media for a final small interfering RNA concentration of 100 nanomolar. Return the wells to the incubator for 24 hours to treat the cells with small interfering RNA nanoparticles. The next day, replace media with full serum media containing 150 micrograms per milliliter D-luciferin.Incubate the cells at room temperature for five minutes before measuring luminescence on a plate reader. Then repeat the media refreshment twice with fresh full serum media free of D-luciferin, followed by incubation for 24 hours. Replace the media with full serum media containing 150 milligrams per milliliter D-luciferin and incubate at room temperature for five minutes.Measure luminescence at the 48-hour time point. For longitudinal studies, leave lid on top of the well plate when outside of the biosafety cabinet to maintain cells under sterile conditions and continue the incubation after replacing luciferin-containing media with fresh full media. Dynamic light scattering measurements show that small interfering RNA nanoparticle one has an average diameter of 35 nanometers.The presence of a single peak with narrow peak width indicates unimodal distribution and low polydispersity. TEM measurements confirm the size measurement from dynamic light scattering suggests the presence of a uniform population of small interfering RNA nanoparticles and revealed the spherical morphology of the small interfering RNA nanoparticles. Too high concentration of polymer in the preparation step resulted for small interfering RNA nanoparticle two in undesirable diameter of greater than 200 nanometers, a multimodal and polydispersed population, and aggregates in solution forming no distinct particle morphology.Both small interfering RNA nanoparticles one and two display neutral surface charge indicated by near zero mean zeta potential values. Agarose gel retardation assay shows the disappearance of small interfering RNA bands at the gel bottom which indicates complexation of small interfering RNA to polymer. Polymer complexed small interfering RNA is unable to migrate through the gel and is thus visualized at the top of the gel nearby the loading wells.As the nitrogen to phosphate ratio is increased small interfering RNA complexation increases as indicated by decreased intensity of the small interfering RNA band at the gel bottom. Bioactive luciferase small interfering RNA nanoparticle one exhibits significantly diminished luciferase activity when compared to scrambled control. In contrast, luciferase small interfering RNA nanoparticle two is not considered bioactive.To produce consistent siRNA nanoparticles with desired physicochemical properties, one should use polymer solutions with appropriate concentrations and validate the pH of the buffer solutions at each step of the protocol. Using these methods in our research we've been able to produce siRNA nanoparticle-based therapies for previously undruggable cancer-causing genes and test the efficacy of these therapies in pre-clinical models of breast cancer.

preparation-neutrally-charged-ph-responsive-polymeric-nanoparticles

Research

JoVE Journal

Bioengineering

Formulation of Diblock Polymeric Nanoparticles through Nanoprecipitation Technique

Nanotechnology is a relatively new branch of science that involves harnessing the unique properties of particles that are nanometers in scale (nanoparticles). Nanoparticles can be engineered in a precise fashion where their size, composition and surface chemistry can be carefully controlled. This enables unprecedented freedom to modify some of the fundamental properties of their cargo, such as solubility, diffusivity, biodistribution, release characteristics and immunogenicity. Since their inception, nanoparticles have been utilized in many areas of science and medicine, including drug delivery, imaging, and cell biology1-4. However, it has not been fully utilized outside of "nanotechnology laboratories" due to perceived technical barrier. In this article, we describe a simple method to synthesize a polymer based nanoparticle platform that has a wide range of potential applications. 
The first step is to synthesize a diblock co-polymer that has both a hydrophobic domain and hydrophilic domain. Using PLGA and PEG as model polymers, we described a conjugation reaction using EDC/NHS chemistry5 (Fig 1). We also discuss the polymer purification process. The synthesized diblock co-polymer can self-assemble into nanoparticles in the nanoprecipitation process through hydrophobic-hydrophilic interactions.
The described polymer nanoparticle is very versatile. The hydrophobic core of the nanoparticle can be utilized to carry poorly soluble drugs for drug delivery experiments6. Furthermore, the nanoparticles can overcome the problem of toxic solvents for poorly soluble molecular biology reagents, such as wortmannin, which requires a solvent like DMSO. However, DMSO can be toxic to cells and interfere with the experiment. These poorly soluble drugs and reagents can be effectively delivered using polymer nanoparticles with minimal toxicity. Polymer nanoparticles can also be loaded with fluorescent dye and utilized for intracellular trafficking studies. Lastly, these polymer nanoparticles can be conjugated to targeting ligands through surface PEG. Such targeted nanoparticles can be utilized to label specific epitopes on or in cells7-10.

This article describes a nanoprecipitation method to synthesize polymer-based nanoparticles using diblock co-polymers. We will discuss the synthesis of diblock co-polymers, the nanoprecipitation technique, and potential applications.

Nanotechnology is a relatively new branch of science that involves harnessing the unique properties of particles that are nanometers in scale ...

Evaluation of Polymeric Gene Delivery Nanoparticles by Nanoparticle Tracking Analysis and High-throughput Flow Cytometry

Non-viral gene delivery using polymeric nanoparticles has emerged as an attractive approach for gene therapy to treat genetic diseases1 and as a technology for regenerative medicine2. Unlike viruses, which have significant safety issues, polymeric nanoparticles can be designed to be non-toxic, non-immunogenic, non-mutagenic, easier to synthesize, chemically versatile, capable of carrying larger nucleic acid cargo and biodegradable and/or environmentally responsive. Cationic polymers self-assemble with negatively charged DNA via electrostatic interaction to form complexes on the order of 100 nm that are commonly termed polymeric nanoparticles. Examples of biomaterials used to form nanoscale polycationic gene delivery nanoparticles include polylysine, polyphosphoesters, poly(amidoamines)s and polyethylenimine (PEI), which is a non-degradable off-the-shelf cationic polymer commonly used for nucleic acid delivery1,3 . Poly(beta-amino ester)s (PBAEs) are a newer class of cationic polymers4 that are hydrolytically degradable5,6 and have been shown to be effective at gene delivery to hard-to-transfect cell types such as human retinal endothelial cells (HRECs)7, mouse mammary epithelial cells8, human brain cancer cells9 and macrovascular (human umbilical vein, HUVECs) endothelial cells10.
A new protocol to characterize polymeric nanoparticles utilizing nanoparticle tracking analysis (NTA) is described. In this approach, both the particle size distribution and the distribution of the number of plasmids per particle are obtained11. In addition, a high-throughput 96-well plate transfection assay for rapid screening of the transfection efficacy of polymeric nanoparticles is presented. In this protocol, poly(beta-amino ester)s (PBAEs) are used as model polymers and human retinal endothelial cells (HRECs) are used as model human cells. This protocol can be easily adapted to evaluate any polymeric nanoparticle and any cell type of interest in a multi-well plate format.

A protocol for nanoparticle tracking analysis (NTA) and high-throughput flow cytometry to evaluate polymeric gene delivery nanoparticles is described. NTA is utilized to characterize the nanoparticle particle size distribution and the plasmid per particle distribution. High-throughput flow cytometry enables quantitative transfection efficacy evaluation for a library of gene delivery biomaterials.

Non-viral gene delivery using polymeric nanoparticles has emerged as an attractive approach for gene therapy to treat genetic diseases1 and as a ...

Programming Stem Cells for Therapeutic Angiogenesis Using Biodegradable Polymeric Nanoparticles

Controlled vascular growth is critical for successful tissue regeneration and wound healing, as well as for treating ischemic diseases such as stroke, heart attack or peripheral arterial diseases. Direct delivery of angiogenic growth factors has the potential to stimulate new blood vessel growth, but is often associated with limitations such as lack of targeting and short half-life in vivo. Gene therapy offers an alternative approach by delivering genes encoding angiogenic factors, but often requires using virus, and is limited by safety concerns. Here we describe a recently developed strategy for stimulating vascular growth by programming stem cells to overexpress angiogenic factors in situ using biodegradable polymeric nanoparticles. Specifically our strategy utilized stem cells as delivery vehicles by taking advantage of their ability to migrate toward ischemic tissues in vivo. Using the optimized polymeric vectors, adipose-derived stem cells were modified to overexpress an angiogenic gene encoding vascular endothelial growth factor (VEGF). We described the processes for polymer synthesis, nanoparticle formation, transfecting stem cells in vitro, as well as methods for validating the efficacy of VEGF-expressing stem cells for promoting angiogenesis in a murine hindlimb ischemia model.

We describe the method of programming stem cells to overexpress therapeutic factors for angiogenesis using biodegradable polymeric nanoparticles. Processes described include polymer synthesis, transfecting adipose-derived stem cells in vitro, and validating the efficacy of programmed stem cells to promote angiogenesis in a murine hindlimb ischemia model.

Controlled vascular growth is critical for successful tissue regeneration and wound healing, as well as for treating ischemic diseases such as stroke, ...

Microfluidic Fabrication of Polymeric and Biohybrid Fibers with Predesigned Size and Shape

A &#8220;sheath&#8221; fluid passing through a microfluidic channel at low Reynolds number can be directed around another &#8220;core&#8221; stream and used to dictate the shape as well as the diameter of a core stream.&#160;Grooves in the top and bottom of a microfluidic channel were designed to direct the sheath fluid and shape the core fluid.&#160;By matching the viscosity and hydrophilicity of the sheath and core fluids, the interfacial effects are minimized and complex fluid shapes can be formed.&#160;Controlling the relative flow rates of the sheath and core fluids determines the cross-sectional area of the core fluid.&#160;Fibers have been produced with sizes ranging from 300 nm to ~1 mm, and fiber cross-sections can be round, flat, square, or complex as in the case with double anchor fibers. Polymerization of the core fluid downstream from the shaping region solidifies the fibers.&#160;Photoinitiated click chemistries are well suited for rapid polymerization of the core fluid by irradiation with ultraviolet light.&#160;Fibers with a wide variety of shapes have been produced from a list of polymers including liquid crystals, poly(methylmethacrylate), thiol-ene and thiol-yne resins, polyethylene glycol, and hydrogel derivatives. Minimal shear during the shaping process and mild polymerization conditions also makes the fabrication process well suited for encapsulation of cells and other biological components.

Two adjacent fluids passing through a grooved microfluidic channel can be directed to form a sheath around a prepolymer core; thereby&#160;determining both shape and cross-section. Photoinitiated polymerization, such as thiol click chemistry, is well suited for rapidly solidifying the core fluid into a microfiber with predetermined size and shape.

A &#8220;sheath&#8221; fluid passing through a microfluidic channel at low Reynolds number can be directed around another &#8220;core&#8221; stream and ...

Harmonic Nanoparticles for Regenerative Research

In this visualized experiment, protocol details are provided for in vitro labeling of human embryonic stem cells (hESC) with second harmonic generation nanoparticles (HNPs). The latter are a new family of probes recently introduced for labeling biological samples for multi-photon imaging. HNPs are capable of doubling the frequency of excitation light by the nonlinear optical process of second harmonic generation with no restriction on the excitation wavelength.
Multi-photon based methodologies for hESC differentiation into cardiac clusters (maintained as long term air-liquid cultures) are presented in detail. In particular, evidence on how to maximize the intense second harmonic (SH) emission of isolated HNPs during 3D monitoring of beating cardiac tissue in 3D is shown. The analysis of the resulting images to retrieve 3D displacement patterns is also detailed.

Protocol details are provided for in vitro labeling human embryonic stem cells with second harmonic generating nanoparticles. Methodologies for hESC investigation by multi-photon microscopy and their differentiation into cardiac clusters are also presented.

In this visualized experiment, protocol details are provided for in vitro labeling of human embryonic stem cells (hESC) with second harmonic generation ...

Porous Silicon Microparticles for Delivery of siRNA Therapeutics

Small interfering RNA (siRNA) can be used to suppress gene expression, thereby providing a new avenue for the treatment of various diseases. However, the successful implementation of siRNA therapy requires the use of delivery platforms that can overcome the major challenges of siRNA delivery, such as enzymatic degradation, low intracellular uptake and lysosomal entrapment. Here, a protocol for the preparation and use of a biocompatible and effective siRNA delivery system is presented. This platform consists of polyethylenimine (PEI) and arginine (Arg)-grafted porous silicon microparticles, which can be loaded with siRNA by performing a simple mixing step. The silicon particles are gradually degraded over time, thereby triggering the formation of Arg-PEI/siRNA nanoparticles. This delivery vehicle provides a means for protecting and internalizing siRNA, without causing cytotoxicity. The major steps of polycation functionalization, particle characterization, and siRNA loading are outlined in detail. In addition, the procedures for determining particle uptake, cytotoxicity, and transfection efficacy are also described.

Delivery remains the main challenge for the therapeutic implementation of small interfering RNA (siRNA). This protocol involves the use of a multifunctional and biocompatible siRNA delivery platform, consisting of arginine and polyethylenimine grafted porous silicon microparticles.

Small interfering RNA (siRNA) can be used to suppress gene expression, thereby providing a new avenue for the treatment of various diseases. However, the ...

Polymeric Microneedle Array Fabrication by Photolithography

This manuscript describes the fabrication of polymeric microneedle (MN) arrays by photolithography. It involves a simple mold-free process by using a photomask consisting of embedded micro-lenses. Embedded micro-lenses were found to influence MN geometry (sharpness). Robust MN arrays with tip diameters ranging between 41.5 &#181;m &#177; 8.4 &#181;m and 71.6 &#181;m &#177; 13.7 &#181;m, with two different lengths (1,336 &#181;m &#177; 193 &#181;m and 957 &#181;m &#177; 171 &#181;m) were fabricated. These MN arrays may provide potential applications in delivery of low molecular and macromolecular therapeutic agents through skin.

Here, we present a protocol describing a mold-free fabrication process of the polymeric microneedles by photolithography.

This manuscript describes the fabrication of polymeric microneedle (MN) arrays by photolithography. It involves a simple mold-free process by using a ...

Fabricating Superhydrophobic Polymeric Materials for Biomedical Applications

Superhydrophobic materials, with surfaces possessing permanent or metastable non-wetted states, are of interest for a number of biomedical and industrial applications. Here we describe how electrospinning or electrospraying a polymer mixture containing a biodegradable, biocompatible aliphatic polyester (e.g., polycaprolactone and poly(lactide-co-glycolide)), as the major component, doped with a hydrophobic copolymer composed of the polyester and a stearate-modified poly(glycerol carbonate) affords a superhydrophobic biomaterial. The fabrication techniques of electrospinning or electrospraying provide the enhanced surface roughness and porosity on and within the fibers or the particles, respectively. The use of a low surface energy copolymer dopant that blends with the polyester and can be stably electrospun or electrosprayed affords these superhydrophobic materials. Important parameters such as fiber size, copolymer dopant composition and/or concentration, and their effects on wettability are discussed. This combination of polymer chemistry and process engineering affords a versatile approach to develop application-specific materials using scalable techniques, which are likely generalizable to a wider class of polymers for a variety of applications.

Two- and three-dimensional superhydrophobic polymeric materials are prepared by electrospinning or electrospraying biodegradable polymers blended with a lower surface energy polymer of similar composition.

Superhydrophobic materials, with surfaces possessing permanent or metastable non-wetted states, are of interest for a number of biomedical and industrial ...

Delivery of Therapeutic siRNA to the CNS Using Cationic and Anionic Liposomes

Prion diseases result from the misfolding of the normal, cellular prion protein (PrPC) to an abnormal protease resistant isomer called PrPRes. The emergence of prion diseases in wildlife populations and their increasing threat to human health has led to increased efforts to find a treatment for these diseases. Recent studies have found numerous anti-prion compounds that can either inhibit the infectious PrPRes isomer or down regulate the normal cellular prion protein. However, most of these compounds do not cross the blood brain barrier to effectively inhibit PrPRes formation in brain tissue, do not specifically target neuronal PrPC, and are often too toxic to use in animal or human subjects. 
We investigated whether siRNA delivered intravascularly and targeted towards neuronal PrPC is a safer and more effective anti-prion compound. This report outlines a protocol to produce two siRNA liposomal delivery vehicles, and to package and deliver PrP siRNA to neuronal cells. The two liposomal delivery vehicles are 1) complexed-siRNA liposome formulation using cationic liposomes (LSPCs), and 2) encapsulated-siRNA liposome formulation using cationic or anionic liposomes (PALETS). For the LSPCs, negatively charged siRNA is electrostatically bound to the cationic liposome. A positively charged peptide (RVG-9r [rabies virus glycoprotein]) is added to the complex, which specifically targets the liposome-siRNA-peptide complexes (LSPCs) across the blood brain barrier (BBB) to acetylcholine expressing neurons in the central nervous system (CNS). For the PALETS (peptide addressed liposome encapsulated therapeutic siRNA), the cationic and anionic lipids were rehydrated by the PrP siRNA. This procedure results in encapsulation of the siRNA within the cationic or anionic liposomes. Again, the RVG-9r neuropeptide was bound to the liposomes to target the siRNA/liposome complexes to the CNS. Using these formulations, we have successfully delivered PrP siRNA to AchR-expressing neurons, and decreased the PrPC expression of neurons in the CNS.

The goal of this protocol is to use cationic/anionic liposomes with a neuro-targeting peptide as a CNS delivery system to enable siRNA to cross the BBB. The optimization of a delivery system for treatments, like siRNA, would allow for more treatment options for prion and other neurodegenerative diseases.

Prion diseases result from the misfolding of the normal, cellular prion protein (PrPC) to an abnormal protease resistant isomer called PrPRes.  The ...

Manufacture and Drug Delivery Applications of Silk Nanoparticles

Silk is a promising biopolymer for biomedical and pharmaceutical applications due to its outstanding mechanical properties, biocompatibility and biodegradability, as well its ability to protect and subsequently release its payload in response to a trigger. While silk can be formulated into various material formats, silk nanoparticles are emerging as promising drug delivery systems. Therefore, this article covers the procedures for reverse engineering silk cocoons to yield a regenerated silk solution that can be used to generate stable silk nanoparticles. These nanoparticles are subsequently characterized, drug loaded and explored as a potential anticancer drug delivery system. Briefly, silk cocoons are reverse engineered first by degumming the cocoons, followed by silk dissolution and clean up, to yield an aqueous silk solution. Next, the regenerated silk solution is subjected to nanoprecipitation to yield silk nanoparticles &#8211; a simple but powerful method that generates uniform nanoparticles. The silk nanoparticles are characterized according to their size, zeta potential, morphology and stability in aqueous media, as well as their ability to entrap a chemotherapeutic payload and kill human breast cancer cells. Overall, the described methodology yields uniform silk nanoparticles that can be readily explored for a myriad of applications, including their use as a potential nanomedicine.

Nanoparticles are emerging as promising drug delivery systems for a broad range of indications. Here, we describe a simple yet powerful method to manufacture silk nanoparticles using reverse engineered Bombyx mori silk. These silk nanoparticles can be readily loaded with a therapeutic payload and subsequently explored for drug delivery applications.