Name: circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr
Uploaded: 2016-06-26T14:00:00
Description: Watch this Scientific Journal Video about Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR at JoVE.com

Supported by funding from the Italian Association for Cancer Research (AIRC) to MF (MFAG 11676) and to MN (Special Program Molecular Clinical Oncology - 5 per mille n. 9980, 2010/15) and from the Italian Ministry of Instruction, University and Research FIRB 2011 to MN (Project RBAPIIBYNP).

MicroRNA Isolation from Plasma or Serum
Note: Plasma and serum preparation is a relevant step in circulating miRNA quantification. There is no preferred procedure for plasma and serum preparation. The only important thing to consider is that all the samples from the same experiment must be processed using exactly the same workflow. Start from 200 &#181;l serum or plasma. Total RNA can be isolated from serum or plasma using commercially available kits.
1. Protocol for Total RNA (including mi...

<ol>
	<li>Arroyo, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Argonaute2+complexes+carry+a+population+of+circulating+microRNAs+independent+of+vesicles+in+human+plasma.">Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma.</a> Proc Natl Acad Sci U S A. 108, 5003-5008 (2011).</li><li>Skog, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glioblastoma+microvesicles+transport+RNA+and+proteins+that+promote+tumour+growth+and+provide+diagnostic+biomarkers.">Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers.</a> Nat Cell Biol. 10, 1470-1476 (2008).</li><li>Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+are+transported+in+plasma+and+delivered+to+recipient+cells+by+high-density+lipoproteins.">MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins.</a> Nat Cell Biol. 13, 423-433 (2011).</li><li>Braicu, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exosomes+as+divine+messengers:+are+they+the+Hermes+of+modern+molecular+oncology.">Exosomes as divine messengers: are they the Hermes of modern molecular oncology.</a> Cell Death Differ. 22, 34-45 (2015).</li><li>Creemers, E. E., Tijsen, A. J., Pinto, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs:+novel+biomarkers+and+extracellular+communicators+in+cardiovascular+disease.">Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease.</a> Circ Res. 110, 483-495 (2012).</li><li>Guay, C., Regazzi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+as+novel+biomarkers+for+diabetes+mellitus.">Circulating microRNAs as novel biomarkers for diabetes mellitus.</a> Nat Rev Endocrinol. 9, 513-521 (2013).</li><li>Schwarzenbach, H., Nishida, N., Calin, G. A., Pantel, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+relevance+of+circulating+cell-free+microRNAs+in+cancer.">Clinical relevance of circulating cell-free microRNAs in cancer.</a> Nat Rev Clin Oncol. 11, 145-156 (2014).</li><li>Moldovan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodological+challenges+in+utilizing+miRNAs+as+circulating+biomarkers.">Methodological challenges in utilizing miRNAs as circulating biomarkers.</a> J Cell Mol Med. 18, 371-390 (2014).</li><li>Tiberio, P., Callari, M., Angeloni, V., Daidone, M. G., Appierto, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Challenges+in+Using+Circulating+miRNAs+as+Cancer+Biomarkers.">Challenges in Using Circulating miRNAs as Cancer Biomarkers.</a> Biomed Res Int. 2015, 731479 (2015).</li><li>Jarry, J., Schadendorf, D., Greenwood, C., Spatz, A., van Kempen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+validity+of+circulating+microRNAs+in+oncology:+five+years+of+challenges+and+contradictions.">The validity of circulating microRNAs in oncology: five years of challenges and contradictions.</a> Mol Oncol. 8, 819-829 (2014).</li><li>Witwer, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+MicroRNA+Biomarker+Studies:+Pitfalls+and+Potential+Solutions.">Circulating MicroRNA Biomarker Studies: Pitfalls and Potential Solutions.</a> Clin Chem. 61, 56-63 (2015).</li><li>Miotto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+Circulating+miRNAs+by+Droplet+Digital+PCR:+Comparison+of+EvaGreen-+and+TaqMan-Based+Chemistries.">Quantification of Circulating miRNAs by Droplet Digital PCR: Comparison of EvaGreen- and TaqMan-Based Chemistries.</a> Cancer Epidemiol Biomarkers Prev. 23, 2638-2642 (2014).</li><li>Ferracin, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+of+cell-free+microRNAs+in+cancer+patients.">Absolute quantification of cell-free microRNAs in cancer patients.</a> Oncotarget. , (2015).</li><li>Mangolini, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+and+prognostic+microRNAs+in+the+serum+of+breast+cancer+patients+measured+by+droplet+digital+PCR.">Diagnostic and prognostic microRNAs in the serum of breast cancer patients measured by droplet digital PCR.</a> Biomarker Research. , (2015).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nat Methods. 10, 1003-1005 (2013).</li><li>Mestdagh, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+quantitative+miRNA+expression+platforms+in+the+microRNA+quality+control+(miRQC)+study.">Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study.</a> Nat Methods. 11, 809-815 (2014).</li></ol>

Circulating miRNAs are present in blood at extremely low concentrations and the amount of RNA that can be extracted from plasma and serum samples is low. For this reason, they are difficult to quantify with other techniques such as microarray and RNA sequencing. Moreover, there is a generalized lack of agreement on data normalization and the presence of endogenous &#34;reference&#34; miRNAs in the blood. In this context, a sensitive technology like droplet digital PCR, capable of counting the number of miRNA copies per m...

MicroRNAs (miRNAs) are released into blood circulation by potentially all the cells of the organism, as a consequence of active release or necrotic and apoptotic processes. Cell-free miRNAs have been detected in the bloodstream either as free stable molecules or linked to lipoproteins or enveloped inside exosomes and microvesicles 1-3. They are believed to function as cell-to-cell communicators 4, and their amount changes in the presence of cancer, cardiac disorders or autoimmune diseases 5-7. Their accurate and reproducible quantification is the basis for their evaluation as disease biomarkers. However, for several reasons already described elsewhere 8,9, miRNA quantification in serum or plasma, as well as other body fluids, could be very challenging 10,11. We recently developed a method for the absolute quantification of circulating miRNAs, based on miRNA-specific LNA primers and DNA-binding dye droplet digital PCR (ddPCR) technology 12. This methodology has been applied to the validation of miRNA breast cancer biomarkers 13,14. 
After the partitioning of each reverse-transcribed miRNA molecule inside a nanoliter-sized droplet, it is possible to count the copy number of each miRNA in each sample, basically counting the number of green, and therefore positive, fluorescent droplets. As soon as a PCR reaction occurs, a positive count is achieved, without the need to establish a standard curve or taking PCR efficiency into account in target amount calculation, as it happens with quantitative RT-PCR (RT-qPCR). In addition, ddPCR proved to be more sensitive and accurate than RT-qPCR in circulating miRNA quantification 15. In this article we present the detailed protocol of this methodology, discussing the most relevant steps andspecifically considering serum and plasma clinical samples.

<table >
	
		
		
		
		
	
	<tbody>
		<tr >
			<td >miRNeasy Mini Kit</td>
			<td >Qiagen</td>
			<td >217004</td>
			<td >Columns for total RNA, including miRNA, extraction from serum/plasma</td>
		</tr>
		<tr >
			<td >100 nmole RNA oligo Cel-miR-39-3p</td>
			<td >Integrated DNA Technologies</td>
			<td >Custom</td>
			<td >Sequence: UCACCGGGUGUAAAUCAGCUUG</td>
		</tr>
		<tr >
			<td >Universal cDNA synthesis kit II, 8-64 rxns</td>
			<td >Exiqon</td>
			<td >203301</td>
			<td >Kit for microRNA reverse transcription</td>
		</tr>
		<tr >
			<td >MicroRNA LNA PCR primer set&#160;</td>
			<td >Exiqon</td>
			<td >204000-206xxx and 2100000-21xxxxx</td>
			<td >Primers for miRNA amplification inside droplets</td>
		</tr>
		<tr >
			<td >QX200 droplet generator</td>
			<td >BioRad</td>
			<td >186-4002</td>
			<td >Instrument used for droplet reading</td>
		</tr>
		<tr >
			<td >QX200 droplet reader</td>
			<td >BioRad</td>
			<td >186-4003</td>
			<td >Instrument used for droplet generation</td>
		</tr>
		<tr >
			<td >QuantaSoft software</td>
			<td >BioRad</td>
			<td >186-3007</td>
			<td >Software for data collection and analysis</td>
		</tr>
		<tr >
			<td >PX1 PCR plate sealer</td>
			<td >BioRad</td>
			<td >181-4000</td>
			<td >Plate sealer</td>
		</tr>
		<tr >
			<td >DG8 droplet generator cartridges and gaskets</td>
			<td >BioRad</td>
			<td >186-4008</td>
			<td >Cartridges used to mix sample and oil to generate droplets</td>
		</tr>
		<tr >
			<td >QX200 ddPCR EvaGreen supermix</td>
			<td >BioRad</td>
			<td >186-4033/36</td>
			<td >PCR supermix</td>
		</tr>
		<tr >
			<td >QX200 droplet generator oil for EvaGreen dye</td>
			<td >BioRad</td>
			<td >186-4005</td>
			<td >Oil for droplet generation</td>
		</tr>
	</tbody>
</table>

circulating microrna quantification using dna-binding dye chemistry and droplet digital pcr

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been linked to a disease state and has the potential to be used as disease biomarker. A sensitive and accurate method for circulating microRNA quantification using a dye-based chemistry and droplet digital PCR technology has been recently developed. Specifically, using Locked Nucleic Acid (LNA)-based miRNA-specific primers with a green fluorescent DNA-binding dye in a compatible droplet digital PCR system it is possible to obtain the absolute quantification of specific miRNAs. Here, we describe how performing this technique to assess miRNA amount in biological fluids, such as plasma and serum, is both feasible and effective.

The absolute amount of specific miRNAs per ml of plasma or serum can be determined using a green fluorescent DNA-binding dye and droplet digital PCR technology. Figure 1 presents the process of positive-droplets selection, which determines the final miRNA concentration (copies/&#181;l) in the amplification reaction calculated by the analysis software. The amount of each miRNA in the blood is very different, being some miRNA species more abundant than others. Using a 1:50 ...

Watch this Scientific Journal Video about Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR at JoVE.com

Circulating MicroRNA Quantification Using DNA-binding Dye Chemistry and Droplet Digital PCR

A sensitive and accurate method for cell-free microRNAs quantification using a dye-based chemistry and droplet digital PCR technology is described.

Circulating (of cell-free) microRNAs (miRNAs) are released from cells into the blood stream. The amount of specific microRNAs in the circulation has been ...

The overall goal of this procedure is to quantify circulating microRNAs and biological fluids, such as plasma or serum, using droplet digital PCR technology. The method can help answer question in the biomarket field. By identifying diagnostic and prognostic, biomarketing cancer.The main advantage of this technique is at the high sensitivity. It can be used to quantify also the less abundant microRNAs without requiring an androgynous reference gene. Implication of this method extend toward cancer diagnostic because it has the potential to identify people with early stage cancer.It can also be applied to other diseases such as neurological or cardiac disorders. Generally, individuals need to pay attention to the manipulation of droplets before thermal cycling step to avoid their disruption. Hence, a visual demonstration of the droplet generation is critical because the droplets can be destroyed by careless manipulation or too fast pipetting.Begin this procedure by isolating plasma or serum microRNAs. Then reverse transcribing and diluting them as described in the accompanying document. Remove the EvaGreen master mix microRNA primer set and cDNA from the freezer and allow them to thaw at room temperature.After it has thawed, invert the master mix tube several times. And then spin down all of the reagents. Prepare a droplet digital, or ddPCR mix working solution according to the instructions in the accompanying document.Prepare enough for up to eight samples with a no-template control for each condition plus an excess of 10%Once assembled, thoroughly mix and spin down the ddPCR mix. Note that technical replicates are not required due to the high-reproducibility of this technology. After the spin, dispense 12 microliters of ddPCR mix into each well of a 96-well PCR plate.Add eight microliters of diluted cDNA template to each well. Then insert the droplet generator cartridge into the cartridge holder. To the middle row of the droplet generator cartridge, carefully transfer 20 microliters of each prepared sample.Avoid introducing air bubbles to the bottom of the well. Fill each of the oil wells in the bottom row with 70 microliters of droplet generator oil. Hook the gasket over the cartridge holder.Insert into the droplet generator and close the lid to start the droplet generation. When the droplet generation has finished, open the lid, remove the cartridge from the droplet generator, and remove the disposable gasket. The top wells of the cartridge contain the droplets.Slowly and smoothly transfer 40 microliters from each of the eight top wells into a single column of a 96-well PCR plate. Immediately seal the plate with foil to avoid evaporation. Within 30 minutes of sealing the plate, begin thermal cycling using the PCR protocol described in table three of the accompanying document.Power on the droplet reader. Then move the plate from the thermal cycler to the droplet reader. Place the 96-well PCR plate containing the post-PCR droplets into the base of the plate holder in the droplet reader.Place the top of the plate holder on the PCR plate. Firmly press both release tabs down to secure the PCR plate in the holder. Start the QuantaLife software from the system PC.Click Setup and open the template data file which has information about the samples, target genes, and assays.From the left-side navigation bar, select Run. A Run Options window will appear. From the Dye Set menu, select EVA, and click OK to start the droplet reading.Once the run is complete, use the 2D Amplitude plot in the analysis software to select the positive droplets. To select the positive droplets, use the lasso tool from the left-side navigation bar. Next, click on the Events tab to check the number of positive and total droplets.A total number of 18, 000 droplets are usually achieved with probeless ddPCR. Then click on the Concentration tab to visualize the final sample of concentration. Finally use the Export.CSV to export the microRNA concentration values. The mRNA miR-181a-5p was quantified in two plasma samples, S1 and S2, using 0.5 and one microliter primer concentration at annealing temperatures of 58 and 60 degrees Celsius. This figure presents the copies of microRNA per microliter in the amplification reaction for each condition.PCR positive droplets for each sample are shown in blue, and negative droplets are shown in black. As can be seen here, the control sample has no positive droplets as expected. Performing the PCR at 60 degrees Celsius with using either a 0.5 or one microliter of primer resulted in a better separation of positive and negative droplets.In this figure, the error bars represent the Poisson 95%confidence interval. And here, the number of positive droplets shown in blue, are compared to the total number of droplets, shown in green. Taken together, these data demonstrate that the droplet digital PCR can be used to determine the absolute number of copies of microRNA per microliter of a biological fluid.After watching this video, you should have a good understanding on how to perform a mRNA quantification using droplet digital PCR. Once mastered, 96 samples can be analyzed in just a few hours, which is an optimal output for a clinical setting. After each development, this technique pave the way to the field of liquid biopsy to explore microRNA and other nucleic acid as disease biomarkers.

circulating-microrna-quantification-using-dna-binding-dye-chemistry

Research

JoVE Journal

Bioengineering

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the research and pharmaceutical communities. To study miRNAs, it is essential that the quantification of microRNA levels is accurate and robust. By comparing wild-type to small RNA deficient mouse embryonic stem cells (mESC), we revealed a lack of accuracy and robustness in previous published multiplex qRT-PCR techniques. Here, we describe an optimized method, including purifying away excessive primers from previous multiplex steps before singleplex real time detection, which dramatically increases the accuracy and robustness of the technique. Furthermore, we explain how performing the technique on a microfluidic chip at nanoliter volumes significantly reduces reagent costs and permits time effective high throughput miRNA expression profiling.

Here we describe an optimized multiplex reverse transcriptase quantitative PCR (qRT-PCR) protocol in combination with a microfluidic platform as a cost and time effective high-throughput screening tool for microRNA (miRNA) expression levels, especially when working with limited amounts of sample.

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the ...

Fluorescence detection methods for microfluidic droplet platforms

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that accompany system miniaturisation. Advantages include the ability to efficiently process nano- to femoto- liter volumes of sample, facile integration of functional components, an intrinsic predisposition towards large-scale multiplexing, enhanced analytical throughput, improved control and reduced instrumental footprints.1
In recent years much interest has focussed on the development of droplet-based (or segmented flow) microfluidic systems and their potential as platforms in high-throughput experimentation.2-4 Here water-in-oil emulsions are made to spontaneously form in microfluidic channels as a result of capillary instabilities between the two immiscible phases. Importantly, microdroplets of precisely defined volumes and compositions can be generated at frequencies of several kHz. Furthermore, by encapsulating reagents of interest within isolated compartments separated by a continuous immiscible phase, both sample cross-talk and dispersion (diffusion- and Taylor-based) can be eliminated, which leads to minimal cross-contamination and the ability to time analytical processes with great accuracy. Additionally, since there is no contact between the contents of the droplets and the channel walls (which are wetted by the continuous phase) absorption and loss of reagents on the channel walls is prevented.
Once droplets of this kind have been generated and processed, it is necessary to extract the required analytical information. In this respect the detection method of choice should be rapid, provide high-sensitivity and low limits of detection, be applicable to a range of molecular species, be non-destructive and be able to be integrated with microfluidic devices in a facile manner. To address this need we have developed a suite of experimental tools and protocols that enable the extraction of large amounts of photophysical information from small-volume environments, and are applicable to the analysis of a wide range of physical, chemical and biological parameters. Herein two examples of these methods are presented and applied to the detection of single cells and the mapping of mixing processes inside picoliter-volume droplets. We report the entire experimental process including microfluidic chip fabrication, the optical setup and the process of droplet generation and detection.

Droplet-based microfluidic platforms are promising candidates for high throughput experimentation since they are able to generate picoliter, self-compartmentalized vessels inexpensively at kHz rates. Through integration with fast, sensitive and high resolution fluorescence spectroscopic methods, the large amounts of information generated within these systems can be efficiently extracted, harnessed and utilized.

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

Detection and Isolation of Circulating Melanoma Cells using Photoacoustic Flowmetry

Circulating tumor cells (CTCs) are those cells that have separated from a macroscopic tumor and spread through the blood and lymph systems to seed secondary tumors1,2,3. CTCs are indicators of metastatic disease and their detection in blood samples may be used to diagnose cancer and monitor a patient&prime;s response to therapy. Since CTCs are rare, comprising about one tumor cell among billions of normal blood cells in advanced cancer patients, their detection and enumeration is a difficult task. We exploit the presence of pigment in most melanoma cells to generate photoacoustic, or laser induced ultrasonic waves in a custom flow cytometer for detection of circulating melanoma cells (CMCs)4,5. This process entails separating a whole blood sample using centrifugation and obtaining the white blood cell layer. If present in whole blood, CMCs will separate with the white blood cells due to similar density. These cells are resuspended in phosphate buffered saline (PBS) and introduced into the flowmeter. Rather than a continuous flow of the blood cell suspension, we induced two phase flow in order to capture these cells for further study. In two phase flow, two immiscible liquids in a microfluidic system meet at a junction and form alternating slugs of liquid6,7. PBS suspended white blood cells and air form microliter slugs that are sequentially irradiated with laser light. The addition of a surfactant to the liquid phase allows uniform slug formation and the user can create different sized slugs by altering the flow rates of the two phases. Slugs of air and slugs of PBS with white blood cells contain no light absorbers and hence, do not produce photoacoustic waves. However, slugs of white blood cells that contain even single CMCs absorb laser light and produce high frequency acoustic waves. These slugs that generate photoacoustic waves are sequestered and collected for cytochemical staining for verification of CMCs.

We have developed a flow cytometer using laser induced ultrasound to detect circulating melanoma cells as an early indicator of metastatic disease.

Circulating tumor cells (CTCs) are those cells that have separated from a macroscopic tumor and spread through the blood and lymph systems to seed ...

Diagnosis of Neoplasia in Barrett&#8217;s Esophagus using Vital-dye Enhanced Fluorescence Imaging

The ability to differentiate benign metaplasia in Barrett&#8217;s Esophagus (BE) from neoplasia in vivo remains difficult as both tissue types can be flat and indistinguishable with white light imaging alone. As a result, a modality that highlights glandular architecture would be useful to discriminate neoplasia from benign epithelium in the distal esophagus. VFI is a novel technique that uses an exogenous topical fluorescent contrast agent to delineate high grade dysplasia and cancer from benign epithelium. Specifically, the fluorescent images provide spatial resolution of 50 to 100 &#956;m&#160;and a field of view up to 2.5 cm,&#160;allowing endoscopists to visualize glandular morphology. Upon excitation, classic Barrett&#8217;s metaplasia appears as continuous, evenly-spaced glands and an overall homogenous morphology; in contrast, neoplastic tissue appears crowded with complete obliteration of the glandular framework. Here we provide an overview of the instrumentation and enumerate the protocol of this new technique. While VFI affords a gastroenterologist with the glandular architecture of suspicious tissue, cellular dysplasia cannot be resolved with this modality. As such, one cannot morphologically distinguish Barrett&#8217;s metaplasia from BE with Low-Grade Dysplasia via this imaging modality. By trading off a decrease in resolution with a greater field of view, this imaging system can be used at the very least as a red-flag imaging device to target and biopsy suspicious lesions; yet, if the accuracy measures are promising, VFI may become the standard imaging technique for the diagnosis of neoplasia (defined as either high grade dysplasia or cancer) in the distal esophagus.

Vital-dye enhanced fluorescence imaging (VFI) is a novel in vivo technique that combines high-resolution epithelial imaging with exogenous topical fluorescent contrast to highlight glandular morphology and delineate neoplasia (high grade dysplasia and cancer) in the distal esophagus.

The ability to differentiate benign metaplasia in Barrett&#8217;s Esophagus (BE) from neoplasia in vivo remains difficult as both tissue types can be flat ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have witnessed a tremendous increase in interest in EVs. EVs have been shown to play important roles in various physiological and pathological processes, including coagulation, immune responses, and cancer. In addition, EVs have potential as therapeutic agents, for instance as drug delivery vehicles or as regenerative medicine. Because of their small size (50 to 1,000 nm) accurate quantification and size profiling of EVs is technically challenging.
This protocol describes how tunable resistive pulse sensing (tRPS) technology, using the qNano system, can be used to determine the concentration and size of EVs. The method, which relies on the detection of EVs upon their transfer through a nano sized pore, is relatively fast, suffices the use of small sample volumes and does not require the purification and concentration of EVs. Next to the regular operation protocol an alternative approach is described using samples spiked with polystyrene beads of known size and concentration. This real-time calibration technique can be used to overcome technical hurdles encountered when measuring EVs directly in biological fluids.

Extracellular vesicles play important roles in physiological and pathological processes, including coagulation, immune responses, and cancer or as potential therapeutic agents in drug delivery or regenerative medicine. This protocol presents methods for the quantification and size characterization of isolated and non-isolated extracellular vesicles in various fluids using tunable resistive pulse sensing.

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

Multicolor Fluorescence Detection for Droplet Microfluidics Using Optical Fibers

Fluorescence assays are the most common readouts used in droplet microfluidics due to their bright signals and fast time response. Applications such as multiplex assays, enzyme evolution, and molecular biology enhanced cell sorting require the detection of two or more colors of fluorescence. Standard multicolor detection systems that couple free space lasers to epifluorescence microscopes are bulky, expensive, and difficult to maintain. In this paper, we describe a scheme to perform multicolor detection by exciting discrete regions of a microfluidic channel with lasers coupled to optical fibers. Emitted light is collected by an optical fiber coupled to a single photodetector. Because the excitation occurs at different spatial locations, the identity of emitted light can be encoded as a temporal shift, eliminating the need for more complicated light filtering schemes. The system has been used to detect droplet populations containing four unique combinations of dyes and to detect sub-nanomolar concentrations of fluorescein.

Multicolor fluorescence detection in droplet microfluidics typically involves bulky and complex epifluorescence microscope-based detection systems. Here we describe a compact and modular multicolor detection scheme that utilizes an array of optical fibers to temporally encode multicolor data collected by a single photodetector.

Fluorescence assays are the most common readouts used in droplet microfluidics due to their bright signals and fast time response. Applications such as ...

Quantifying Microorganisms at Low Concentrations Using Digital Holographic Microscopy (DHM)

Accurately detecting and counting sparse bacterial samples has many applications in the food, beverage, and pharmaceutical processing industries, in medical diagnostics, and for life detection by robotic missions to other planets and moons of the solar system. Currently, sparse bacterial samples are counted by culture plating or epifluorescence microscopy. Culture plates require long incubation times (days to weeks), and epifluorescence microscopy requires extensive staining and concentration of the sample. Here, we demonstrate how to use off-axis digital holographic microscopy (DHM) to enumerate bacteria in very dilute cultures (100-104 cells/mL). First, the construction of the custom DHM is discussed, along with detailed instructions on building a low-cost instrument. The principles of holography are discussed, and a statistical model is used to estimate how long videos should be to detect cells, based on the optical performance characteristics of the instrument and the concentration of the bacterial solution (Table 2). Video detection of cells at 105, 104, 103, and 100 cells/mL is demonstrated in real time using un-reconstructed holograms. Reconstruction of amplitude and phase images is demonstrated using an open-source software package.

Quantifying Microorganisms at Low Concentrations Using Digital Holographic Microscopy DHM

Digital holographic microscopy (DHM) is a volumetric technique that allows imaging samples 50-100X thicker than brightfield microscopy at comparable resolution, with focusing performed post-processing. Here DHM is used for identifying, counting, and tracking microorganisms at very low densities and compared with optical density measurements, plate count, and direct count.

Accurately detecting and counting sparse bacterial samples has many applications in the food, beverage, and pharmaceutical processing industries, in ...

A Droplet-Based Microfluidic Approach and Microsphere-PCR Amplification for Single-Stranded DNA Amplicons

Droplet-based microfluidics enable the reliable production of homogeneous microspheres in the microfluidic channel, providing controlled size and morphology of the obtained microsphere. A microsphere copolymerized with an acrydite-DNA probe was successfully fabricated. Different methods such as asymmetric PCR, exonuclease digestion, and isolation on streptavidin-coated magnetic beads can be used to synthesize single-stranded DNA (ssDNA). However, these methods cannot efficiently use large amounts of highly purified ssDNA. Here, we describe a microsphere-PCR protocol detailing how ssDNA can be efficiently amplified and separated from dsDNA simply by pipetting from a PCR reaction tube. The amplification of ssDNA can be applied as potential reagents for the DNA microarray and DNA-SELEX (Systematic evolution of ligands by exponential enrichment) processes.

This work provides a method for the fabrication of droplet-based microfluidic platforms and the application of polyacrylamide microspheres for microsphere-PCR amplification. The microsphere-PCR method makes it possible to obtain single-stranded DNA amplicons without separating double-stranded DNA.

Droplet-based microfluidics enable the reliable production of homogeneous microspheres in the microfluidic channel, providing controlled size and ...

Bulk Droplet Vitrification for Primary Hepatocyte Preservation

Vitrification is a promising ice-free alternative for classic slow-freezing (at approximately 1 &#176;C/min) cryopreservation of biological samples. Vitrification requires extremely fast cooling rates to achieve transition of water into the glass phase while avoiding injurious ice formation. Although pre-incubation with cryoprotective agents (CPA) can reduce the critical cooling rate of biological samples, high concentrations are generally needed to enable ice-free cryopreservation by vitrification. As a result, vitrification is hampered by CPA toxicity and restricted to small samples that can be cooled fast. It was recently demonstrated that these inherent limitations can be overcome by bulk droplet vitrification. Using this novel method, cells are first pre-incubated with a low intracellular CPA concentration. Leveraging rapid osmotic dehydration, the intracellular CPA is concentrated directly ahead of vitrification, without the need to fully equilibrate toxic CPA concentrations. The cellular dehydration is performed in a fluidic device and integrated with continuous high throughput generation of large sized droplets that are vitrified in liquid nitrogen. This ice-free cryopreservation method with minimal CPA toxicity is suitable for large cell quantities and results in increased hepatocyte viability and metabolic function as compared to classical slow-freezing cryopreservation. This manuscript describes the methods for successful bulk droplet vitrification in detail.

This manuscript describes an ice-free cryopreservation method for large quantities of rat hepatocytes whereby primary cells are pre-incubated with cryoprotective agents at a low concentration and vitrified in large droplets.

Vitrification is a promising ice-free alternative for classic slow-freezing (at approximately 1 &#176;C/min) cryopreservation of biological samples. ...

High Throughput Yeast Strain Phenotyping with Droplet-Based RNA Sequencing

The powerful tools available to edit yeast genomes have made this microbe a valuable platform for engineering. While it is now possible to construct libraries of millions of genetically distinct strains, screening for a desired phenotype remains a significant obstacle. With existing screening techniques, there is a tradeoff between information output and throughput, with high-throughput screening typically being performed on one product of interest. Therefore, we present an approach to accelerate strain screening by adapting single cell RNA sequencing to isogenic picoliter colonies of genetically engineered yeast strains. To address the unique challenges of performing RNA sequencing on yeast cells, we culture isogenic yeast colonies within hydrogels and spheroplast prior to performing RNA sequencing. The RNA sequencing data can be used to infer yeast phenotypes and sort out engineered pathways. The scalability of our method addresses a critical obstruction in microbial engineering.

A bottleneck in the &#8216;design-build-test&#8217; cycle of microbial engineering is the speed at which we can perform functional screens of strains. We describe a high-throughput method for strain screening applied to hundreds to thousands of yeast cells per experiment that utilizes droplet-based RNA sequencing.

The powerful tools available to edit yeast genomes have made this microbe a valuable platform for engineering. While it is now possible to construct ...