Name: microscopy-based assays for high-throughput screening of host factors involved in brucella infection of hela cells
Uploaded: 2016-08-05T14:00:00
Description: Watch this Scientific Journal Video about Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells at JoVE.com

This work was supported by grants 51RT 0_126008 and 51RTP0_151029 for the Research and Technology Development (RTD) project InfectX and TargetInfectX, respectively, in the frame of SystemsX.ch, the Swiss Initiative for Systems Biology. We acknowledge grant 310030B_149886 from the Swiss National Science Foundation (SNSF). Work of S.H.L and A.C. was supported by the International PhD Program "Fellowships for Excellence" of the Biozentrum. Simone Muntwiler is acknowledged for technical assistance. We would like to thank Dirk Bumann for providing pNF106 and Jean Celli for pJC43 and pJC44.

Note: All work with live Brucella abortus strains must be performed inside a biosafety level 3 (BSL3) laboratory considering all required regulations and safety precautions.
1. Preparation of Screening Plates and Culturing of Bacteria and Cells
<ol>
	<li>Preparation of Brucella abortus Starter Cultures
	<ol>
		<li>Streak Brucella abortus 2308 (B. abortus) from -80 &#176;C milk stock on a Tryptic Soy Agar (TSA) plate containing 50 &#181;g/ml kanamycin (TSA/...

<ol>
	<li>Pappas, G., Papadimitriou, P., Akritidis, N., Christou, L., Tsianos, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+global+map+of+human+brucellosis.">The new global map of human brucellosis.</a> Lancet Infect Dis. 6, 91-99 (2006).</li><li>Atluri, V. L., Xavier, M. N., de Jong, M. F., den Hartigh, A. B., Tsolis, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+of+the+human+pathogenic+Brucella+species+with+their+hosts.">Interactions of the human pathogenic Brucella species with their hosts.</a> Annu Rev Microbiol. 65, 523-541 (2011).</li><li>Guzman-Verri, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTPases+of+the+Rho+subfamily+are+required+for+Brucella+abortus+internalization+in+nonprofessional+phagocytes:+direct+activation+of+Cdc42.">GTPases of the Rho subfamily are required for Brucella abortus internalization in nonprofessional phagocytes: direct activation of Cdc42.</a> J Biol Chem. 276, 44435-44443 (2001).</li><li>Starr, T., Ng, T. W., Wehrly, T. D., Knodler, L. A., Celli, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+intracellular+replication+requires+trafficking+through+the+late+endosomal/lysosomal+compartment.">Brucella intracellular replication requires trafficking through the late endosomal/lysosomal compartment.</a> Traffic. 9, 678-694 (2008).</li><li>Boschiroli, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Brucella+suis+virB+operon+is+induced+intracellularly+in+macrophages.">The Brucella suis virB operon is induced intracellularly in macrophages.</a> Proc Natl Acad Sci U S A. 99, 1544-1549 (2002).</li><li>Celli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+evades+macrophage+killing+via+VirB-dependent+sustained+interactions+with+the+endoplasmic+reticulum.">Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum.</a> J Exp Med. 198, 545-556 (2003).</li><li>Porte, F., Liautard, J. P., Kohler, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acidification+of+phagosomes+containing+Brucella+suis+is+essential+for+intracellular+survival+in+murine+macrophages.">Early acidification of phagosomes containing Brucella suis is essential for intracellular survival in murine macrophages.</a> Infect Immun. 67, 4041-4047 (1999).</li><li>Anderson, T. D., Cheville, N. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+morphometric+analysis+of+Brucella+abortus-infected+trophoblasts+in+experimental+placentitis.+Bacterial+replication+occurs+in+rough+endoplasmic+reticulum.">Ultrastructural morphometric analysis of Brucella abortus-infected trophoblasts in experimental placentitis. Bacterial replication occurs in rough endoplasmic reticulum.</a> Am J Pathol. 124, 226-237 (1986).</li><li>Qin, Q. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+screen+of+endoplasmic+reticulum-associated+host+factors+reveals+a+role+for+IRE1alpha+in+supporting+Brucella+replication.">RNAi screen of endoplasmic reticulum-associated host factors reveals a role for IRE1alpha in supporting Brucella replication.</a> PLoS Pathog. 4, e1000110 (2008).</li><li>Ramo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+analysis+of+large-scale+RNAi+screens+for+pathogen+entry.">Simultaneous analysis of large-scale RNAi screens for pathogen entry.</a> BMC genomics. 15, 1162 (2014).</li><li>Kuhbacher, A., Gouin, E., Cossart, P., Pizarro-Cerda, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+InlC+secretion+to+investigate+cellular+infection+by+the+bacterial+pathogen+Listeria+monocytogenes.">Imaging InlC secretion to investigate cellular infection by the bacterial pathogen Listeria monocytogenes.</a> J Vis Exp. , e51043 (2013).</li><li>Kentner, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shigella+reroutes+host+cell+central+metabolism+to+obtain+high-flux+nutrient+supply+for+vigorous+intracellular+growth.">Shigella reroutes host cell central metabolism to obtain high-flux nutrient supply for vigorous intracellular growth.</a> Proc Natl Acad Sci U S A. 111, 9929-9934 (2014).</li><li>Celli, J., Salcedo, S. P., Gorvel, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brucella+coopts+the+small+GTPase+Sar1+for+intracellular+replication.">Brucella coopts the small GTPase Sar1 for intracellular replication.</a> Proc Natl Acad Sci U S A. 102, 1673-1678 (2005).</li><li>von Bargen, K., Gorvel, J. P., Salcedo, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Internal+affairs:+investigating+the+Brucella+intracellular+lifestyle.">Internal affairs: investigating the Brucella intracellular lifestyle.</a> FEMS microbiology reviews. 36, 533-562 (2012).</li><li>Kamentsky, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+structure,+function+and+compatibility+for+CellProfiler:+modular+high-throughput+image+analysis+software.">Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software.</a> Bioinformatics. 27, 1179-1180 (2011).</li></ol>

Bacterial pathogens have evolved numerous strategies to manipulate eukaryotic host cells to their benefit. Pathogens causing acute infections often show rapid proliferation which is accompanied by significant alarming of the immune system and loss of viability of infected cells. In contrast, Brucella and other pathogens that cause chronic infections manage to establish long-lasting interactions within host cells. Therefore, bacteria need to fine tune host cell functions to their benefit without disrupting cellul...

Brucella species are gram-negative, facultative intracellular pathogens belonging to the class of &#945;-Proteobacteria. They cause abortions and infertility in their natural hosts such as cattle, goats, or sheep resulting in severe economic losses in endemic areas. Brucellosis is one of the most important zoonotic diseases worldwide causing over half a million new human infections annually1. Transmission to human is most commonly caused by direct contact with infected animals or by ingestion of contaminated food such as unpasteurized milk. Symptoms of the febrile disease are unspecific, which causes difficulties in the diagnosis of brucellosis. If untreated, patients can develop a chronic infection with more severe symptoms such as arthritis, endocarditis, and neuropathy2.
On the cellular level Brucella is able to invade phagocytic and non-phagocytic cells and replicates within an intracellular compartment known as the Brucella-containing vacuole (BCV). Internalization of bacteria requires actin cytoskeleton rearrangements by Rac, Rho, and direct activation of Cdc423. Inside the eukaryotic host cell, the BCV traffics along the endocytic pathway and despite the interaction with lysosomes, bacteria manage to avoid degradation4. Acidification of the BCV by the vesicular ATPase is required to induce the expression of the bacterial type IV secretion system (T4SS)5. It is believed that bacterial effectors secreted by the T4SS are essential for Brucella to establish its replicative niche, since deletion of the T4SS6 or inhibition of the vesicular ATPase lead to defects in the establishment of the intracellular niche7. Bacteria do not replicate during the phase of trafficking until they reach an ER-derived vacuolar compartment8. Once intracellular proliferation occurs, the BCV is found in close association with ER markers such as calnexin and glucose-6-phosphatase6.
The molecular mechanisms by which Brucella enters cells, avoids lysosomal degradation, and finally replicates in an ER-like compartment remain largely unknown. Host factors involved in different steps of infection have mainly been identified by targeted approaches or a small scale small interfering RNA (siRNA) screen performed in Drosophila cells9. These have shed light on the contribution of individual host factors during Brucella infection but we are still far from a comprehensive understanding of the entire process.
Here, protocols that allow the identification of human host factors using large-scale RNA interference (RNAi) screening in combination with automated wide-field fluorescence microscopy and automated image analysis are presented. Reverse siRNA transfection of HeLa cells is performed as described earlier10,11 with minor modifications. The endpoint assay covers a large part of the Brucella intracellular lifecycle except the egress and the infection of neighboring cells. To further characterize the hits identified in the endpoint assay, a modified protocol to identify factors involved in early steps of the infection is used.
A Brucella abortus strain that constitutively expresses GFP is used for the endpoint assay where bacteria are allowed to infect cells for two days. During this time, bacteria enter cells, traffic to the ER-derived replicative niche, and replicate in the peri-nuclear space. The high levels of GFP signal can then be used to reliably detect individual cells which contain replicating bacteria.
To study Brucella entry in a high-throughput assay, it is important to be able to distinguish between intracellular and extracellular bacteria. The method presented here circumvents differential antibody staining of intracellular and extracellular bacteria. It is based on a Brucella strain expressing a tetracycline-inducible GFP in combination with constitutive expression of dsRed. The presence of a constitutive dsRed marker allows identification of all bacteria that are present in the sample. GFP expression is induced by the addition of the non-toxic tetracycline analog anhydrotetracycline (aTc) simultaneously with inactivation of extracellular bacteria by gentamicin (Gm). While the cell-impermeable antibiotic Gm kills extracellular bacteria, aTc can enter the host cell and induce GFP expression selectively in intracellular bacteria. This dual reporter allows the robust separation of single intracellular bacteria (GFP and dsRed signal) from extracellular bacteria (only dsRed signal) using wide-field microscopy. In order to reach detectable GFP expression by intracellular Brucella we have found that 4 hr of induction by aTc results in a reliable signal. Similar induction schemes to selectively express GFP in intracellular bacteria has been used previously to study intracellular Shigella12.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tryptic Soy Agar (TSA)</td>
			<td style="width:71px;">BD</td>
			<td style="width:119px;">236950</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tryptic Soy Broth (TSB)</td>
			<td style="width:71px;">Fluka</td>
			<td style="width:119px;">22092</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kanamycin sulfate</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">60615</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Skim milk</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">250 ml screw cap bottle</td>
			<td style="width:71px;">Corning</td>
			<td style="width:119px;">8396</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DMEM</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">D5796</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Calf Serum (FCS)</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">10270</td>
			<td style="width:167px;">Heat-inactivated</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.5%)</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">15400-054</td>
			<td style="width:167px;">10x stock solution, dilute 1:10 in PBS</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Scepte 2.0 Cell Counter</td>
			<td style="width:71px;">Merck Milipore</td>
			<td style="width:119px;">PHCC20060</td>
			<td style="width:167px;">Alternative cell counting devices can be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Greiner CELLSTAR 384-well plate</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">M2062</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Peelable aluminum foil</td>
			<td style="width:71px;">Costar</td>
			<td style="width:119px;">6570</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Reagent dispenser: &#34;Multidrop 384 Reagent Dispenser&#34;</td>
			<td style="width:71px;">Thermo Scientific</td>
			<td style="width:119px;">5840150</td>
			<td style="width:167px;">Alternative reagent dispenser can be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Transfection reagent: &#34;Lipofectamine RNAiMAX</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">13778-150</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="252">
			<td height="252" style="height:252px;width:216px;">Automated plate washer: &#34;Plate washer ELx50-16&#34;</td>
			<td style="width:71px;">BioTek</td>
			<td style="width:119px;">ELX5016</td>
			<td style="width:167px;">This plate washer contains a 16-channel manifold suitable for 384-well plates. It fits into a biosafety cabinet and has a lid covering the plate during washing which reduces the risk of aerosol production. Alternative plate washers with similar features could be used.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Gentamicin</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">G1397</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Anhydrotetracycline hydrochloride</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">37919</td>
			<td style="width:167px;">100 ug/ml solution in 100% ethanol is kept at -20&#176;C protected from light in aluminum-foil</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PBS</td>
			<td style="width:71px;">Gibco</td>
			<td style="width:119px;">20012</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="168">
			<td height="168" style="height:168px;width:216px;">Paraformaldehyde</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">P6148</td>
			<td style="width:167px;">Dissolve in 0.2 M HEPES buffer, pH 7.4. Store at -20&#176;C and thaw freshly the day before use. Caution, PFA is toxic by inhalation, in contact with skin and if swallowed.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">HEPES</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">H3375</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Triton X-100</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;">T9284</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DAPI</td>
			<td style="width:71px;">Roche</td>
			<td style="width:119px;">10236276001</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Scrambled siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">D-001810-10</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Kif11 siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">L-003317-00</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ARPC3 siRNA</td>
			<td style="width:71px;">Dharmacon</td>
			<td style="width:119px;">L-005284-00</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Brucella abortus 2308</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:216px;">pJC43 (apHT::GFP)</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;">Celli et al.12</td>
		</tr>
		<tr height="277">
			<td height="277" style="height:277px;width:216px;">pAC042.08 (apht::dsRed, tetO::tetR-GFP)</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;">Construction: pJC44 4 was digested with EcoRI followed by generation of blunt ends with Klenov enzyme and subsequent digestion with SalI. TetR-GFP was amplified from pNF106 using primer prAC090 and prAC092. Following digestion with SalI, the TetR-GFP product was ligated to the digested pJC44 vector.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Primer prAC090</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">TTTTTGAATTCTGGCAATTCCGACGTCTAAGAAACC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Primer prAC092</td>
			<td style="width:71px;">Sigma-Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:167px;">TTTTTGTCGACTTTGTCCTACTCAGGAGAGCGTTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">HeLa CCL-2</td>
			<td style="width:71px;">ATCC</td>
			<td style="width:119px;">CCL-2</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="231">
			<td height="231" style="height:231px;width:216px;">ImageXpress Micro</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">IXM IMAGING MSCOPE</td>
			<td style="width:167px;">Automated cellular imaging microscope equipped with a precision motorized Z-stage. Alternative systems for automated microscopy and alternative components for hard- and software specified below can be employed.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">High-Speed Laser Auto-Focus</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">1-2300-1037</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CFI Super Fluor 10x objective</td>
			<td style="width:71px;">Nikon&#160;</td>
			<td style="width:119px;">MRF00100</td>
			<td style="width:167px;">N.A 0.50, W.D 1.20mm, DIC Prism: 10x, Spring loaded</td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Photometrics CoolSNAP HQ Monochrome CCD Camera</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">1-2300-1060</td>
			<td style="width:167px;">1392 x 1040 imaging pixels, 6.45 x 6.45-&#181;m pixels, 12 bits digitization</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">MetaXpress software</td>
			<td style="width:71px;">Molecular Devices&#160;</td>
			<td style="width:119px;">9500-0100</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:216px;">LUI-Spectra-X-7</td>
			<td style="width:71px;">Lumencor</td>
			<td style="width:119px;">SPECTRA X V-XXX-YZ</td>
			<td style="width:167px;">Light engine. The following light sources are used: violet (DAPI), cyan (GFP), green/yellow (RFP)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-377/50-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF02-447/60-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for DAPI</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF409-Di03-25x36</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF02-472/30-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-520/35-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for GFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF495-Di03-25x36</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Single Band Exciter for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-562/40-25</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Single Band Emitter for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF01-624/40-25</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Single Band Dichroic for RFP</td>
			<td style="width:71px;">Semrock</td>
			<td style="width:119px;">FF593-Di03-25x36</td>
			<td></td>
		</tr>
	</tbody>
</table>

microscopy-based assays for high-throughput screening of host factors involved in brucella infection of hela cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Figure 1A shows an example of image analysis used to automatically identify infected cells in the endpoint assay. Nuclei of HeLa cells stained with DAPI were identified, a peri-nucleus of 8 pixels width surrounding the nucleus, and a Voronoi cell body by extension of the nucleus by 25 pixels were calculated. Since bacteria mainly proliferate in the peri-nuclear space, the GFP intensity in this area of the cell is the most robust measurement to discriminate between infecte...

Watch this Scientific Journal Video about Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells at JoVE.com

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

The overall goal of this high-throughput microscopy-based assay is to identify host factors involved in Brucella infection of HeLa cells. This method can help answer key questions in the host pathogen interaction field, such as identifying host proteins that either promote or prevent colonization by the intracellular pathogen Brucella. Main advantage of this technique is that the semi-automated workflow from the vet lab to image analysis allows for robots and efficient high-throughputs creating experiments.So this method can provide insight into Brucella host interactions using siRNA screens. Most of the protocol can be applied to other screening strategies. For example, or siRNA libraries.After culturing HeLa cells and preparing screening plates with siRNAs according to the text protocol thaw a black 384 well plate by centrifugation at 300 times G and room temperature for 20 minutes. Prepare transfection medium by using room temperature dmem without FCS. To dilute the transfection reagent one to 200 and carefully mix before use.Using a reagent dispenser add 25 microliters of transfection medium to each well of the 384 well plate and mix the solutions by moving the plate back and forth. Incubate the plate at room temperature for one hour to allow siRNA transfection reagent complex formation. In the meantime prepare HeLa cells by aspirating the culture medium and adding 2.5 milliliters of 0.05%trypsin EDTA in PBS to wash the subconfluent cells of a 75 square centimeter flask once.Then add 1.5 milliliters of fresh trypsin and transfer the flask to 37 degrees Celsius for two to three minutes until the cells round up. Use 10 milliliters of prewarmed dmem 60%FCS to resuspend the cells. Then, use an automated cell counter to count the cells before preparing a cell suspension of 10, 000 cells per milliliter in dmem with 16%FCS.Add 50 microliters of cell suspension to each well of transfection reagent. Resulting in 500 cells per well. Move the plate back and forth to evenly distribute the cells.Then, leave the plate at room temperature for five to 10 minutes to allow the cells to settle down. Use parafilm to seal the plate. And incubate it in a humid incubator on a prewarmed aluminum plate at 37 degrees Celsius with 5%C02 for 72 hours.Working with the class three pathogen B.abortus is dangerous and local biosafety regulations need to be followed which includes wearing a protective overall suit, protective gloves, mask, and goggles. One day, prior to infection, inoculate the previously determined amount of B.abortus starter culture in 50 milliliters of TSB KM medium. In a 250 milliliter screwcap bottle.Use parafilm to seal the bottle and grow bacteria overnight at 37 degrees Celsius and 100 RPM on a shaker to optical density 600.8 to 1.1. Measure the optical density 600 of the bacterial culture. And prepare the infection medium by diluting the bacterial culture in dmem 10%FCS to achieve the desired multiplicity of infection.Or, MOI. Using an automated plate washer exchange the transfection medium with 50 microliters of infection medium. Inside the hood transfer the plate into the centrifuge cage and centrifuge the 384 well plate at 400 times G and four degrees Celsius for 20 minutes.Then, use parafilm to seal the plate and incubate it on a prewarmed aluminum plate at 37 degrees Celsius and 5%C02 for four hours. After the incubation with the automated plate washer use dmem with 10%FCS containing 100 micrograms per milliliter of dentrimysen or GM to wash the cells to inactivate extracellular bacteria. Then, use parafilm to seal the plate and place it back on the prewarmed aluminum plate in the incubator for another 40 hours for the end point assay.To fix the cells, first use PBS to wash the wells. Then, exchange the PBS with 50 microliters of 3.7%PFA. In 2 at pH 7.4.And incubate the cells at room temperature for 20 minutes. After the incubation use 50 microliters of PBS to exchange the fixation medium. To stain the samples with the automated plate washer begin by using 50 microliters of 1%Triton X-100 in PBS for 10 minutes to permeabilize the cells.After using PBS to wash the cells three times add 50 microliters of PBS with one microgram per milliliter of DAPI and incubate at room temperature for 30 minutes. Then, use PBS to wash the cells three times before protecting them from light. Transfer the plate to the automated microscope.Set up the microscope parameters. Select the 10-X subjective. Then select the plate format corresponding to the 384 well plate.Acquire nine sites per well. Select Enable laser-based focusing. And, focus on plate and well bottom.Then, set first well acquired as the initial well for finding the sample and all sites for site autofocus. Next, for the DAPI channel manually adjust the Z offset for the focus. Then, press Find Sample to set the focus on the well bottom.Using the AutoExposure function get a good estimate for the exposure time. Manually correct the exposure time for the DAPI channel to ensure a wide dynamic range with low overexposure. Use this exposure time to image several sites throughout the plate.And adjust the exposure time manually until the brightest pixels reach approximately 80%of the maximal brightness over the sites. Repeat the steps to set the focus and exposure time, accordingly for all other channels. Then, start acquisition of the full plate.For the end point assay use the DAPI and GFP channels to image the full plate. To run an image analysis on stained cells in the end point assay, after calculating a shading model, according to the text protocol under View output settings select the input folder with the images and an output folder with the results. Then, define the text that the images have in common, and load the shading models.Click Start test mode and make sure the pause and displays setting for all modules are disabled. Enable the pause and display setting for module nine ImageMath. The enabled pause symbol will appear in yellow.The enabled display function will appear as an open eye. Next, click Run to run the analysis up to module nine. In module nine adjust the parameter multiply the second image by to a value that will suppress the DAPI signal in Brucella without suppressing the nuclei.To test the values for the module press Step. Right click on the newly opened image and set image contrast to log normalized. Repeatedly, step back to module nine.Adjust the parameter multiply the second image by and step over the module again until the Brucella signal is fully suppressed while at the same time black areas that indicate oversubtraction are minimized. Finding good parameters for certain modules requires gradually optimizing the parameters. It is definitely important to repeatedly step over the modules, trying different values and observe the effect on the displayed result.Enable pause and display for module 10. Identify primary objects. Set the parameter lower bound on threshold, high enough so that nuclei are segmented and background is ignored.To identify a good value step over the module then right click the input image and display the histogram where the peak typically indicates background. Starting from background intensity increase the parameter until the good segmentation of nuclei is achieved as displayed in the output image. The goal of the image analysis pipeline is to identify cells which contain replicating bacteria.This is achieved by setting different thresholds for the pathogen signal in the nucleus, peri-nucleus, and Voronoi cell body. Enable pause and display for module 15. Filter objects, as shown before and press Run.Set the parameter minimum value sufficiently high so that only cells with clearly visible Brucella in the nucleus are kept, and all others are filtered away. To identify a good value step over the module and display the output image. Increase the value stepwise until only cells with clearly visible Brucella at the nucleus are kept.After filtering for cells with bacteria in the peri-nucleus and Voronoi cell body in modules 16 and 17 according to the text protocol, exit the test mode and uncheck all the eye symbols next to the modules to make sure that none of the modules show their display prior to running the full analysis. Finally, press Analyze Images to start the analysis. When the analysis has finished inspect the resulting PNG images as well as the CSV spreadsheet to ensure that the analysis worked reliably throughout the plate.Carry out the entry assay and infection scoring according to the text protocol. This figure shows an example of image analysis used to automatically identify infected cells in the end point assay. Nuclei HeLa cells stained with DAPI were identified.A peri-nucleus of eight pixels width surrounding the nucleus. And a Voronoi cell body by extension of the nucleus, by 25 pixels, were calculated. A cell was considered infected if the pathogen signal exceeded the corresponding threshold in at least one compartment.Brucella requires acting rearrangements for successful engagement of host cells. Thus, depletion of ARP23 is a suitable positive control for siRNA screening. Depletion of ARPC3 reduced the number of cells with proliferating bacteria two days after infection.Compared to scrambled treated controlled cells. Automated image analysis quantifiably observed to decrease in infection of ARPC3 depleted HeLa cells compared to controlled cells in this graph. Depletion of ARPC3 also showed a reduction in Brucella infection in the entry assay compared to controlled cells.As seen by the reduced number of intracellular Brucella depicted in yellow. Finally, quantification of the infection by automated image analysis confirmed that the number of infected cells as well as the number of intracellular bacteria in infected cells was reduced by depletion of ARPC3. Once mastered, this protocol can give image analysis results within one and a half weeks after starting the experiment.While attempting this procedure it's important to carefully review the image analysis results to ensure that the chosen parameters perform well throughout the full plate. Following this procedure other methods like life cell imaging can be performed in order to answer additional questions. Like when you are trafficking a certain host factor interacts with Brucella.Or how depletion of a gene affects intracellular dynamics of infection. After it's development, this technique paved the way for researchers in the field of infection biology to explore host factors required for Brucella infection in a HeLa cell assay. After watching this video you should have a good understanding of how to identify host factors which promote, or prevent, the successful colonization of HeLa cells by the intracellular pathogen Brucella abortus.Don't forget that working with Brucella abortus can be extremely hazardous and local biosafety regulations have to be strictly followed.

microscopy-based-assays-for-high-throughput-screening-host-factors

Research

JoVE Journal

Immunology and Infection

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important for developing durable disease-resistant plants against wide range of pathogens. Virus-induced gene silencing (VIGS)-based forward genetics screening is a useful approach for identification of plant defense genes imparting nonhost resistance. Tobacco rattle virus (TRV)-based VIGS vector is the most efficient VIGS vector to date and has been efficiently used to silence endogenous target genes in Nicotiana benthamiana.

	In this manuscript, we demonstrate a forward genetics screening approach for silencing of individual clones from a cDNA library in N. benthamiana and assessing the response of gene silenced plants for compromised nonhost resistance against nonhost pathogens, Pseudomonas syringae pv. tomato T1, P. syringae pv. glycinea, and X. campestris pv. vesicatoria. These bacterial pathogens are engineered to express GFPuv protein and their green fluorescing colonies can be seen by naked eye under UV light in the nonhost pathogen inoculated plants if the silenced target gene is involved in imparting nonhost resistance. This facilitates reliable and faster identification of gene silenced plants susceptible to nonhost pathogens. Further, promising candidate gene information can be known by sequencing the plant gene insert in TRV vector. Here we demonstrate the high throughput capability of VIGS-mediated forward genetics to identify genes involved in nonhost resistance. Approximately, 100 cDNAs can be individually silenced in about two to three weeks and their relevance in nonhost resistance against several nonhost bacterial pathogens can be studied in a week thereafter. In this manuscript, we enumerate the detailed steps involved in this screening. VIGS-mediated forward genetics screening approach can be extended not only to identifying genes involved in nonhost resistance but also to studying genes imparting several biotic and abiotic stress tolerances in various plant species.

Virus-induced gene silencing is an useful tool for identifying genes involved in nonhost resistance of plants. We demonstrate the use of bacterial pathogens expressing GFPuv in identifying gene silenced plants susceptible to nonhost pathogens. This approach is easy, fast and facilitates large scale screening and similar protocol can be applied to studying various other plant-microbe interactions.


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since several decades, the sudden burst of multi- and extensively-drug resistant strains is a serious threat for the control of tuberculosis. Therefore, it is essential to identify new targets and pathways critical for the causative agent of the tuberculosis, Mycobacterium tuberculosis (Mtb) and to search for novel chemicals that could become TB drugs. One approach is to set&#160;up methods suitable for the genetic and chemical screens of large scale libraries enabling the search of a needle in a haystack. To this end, we developed a phenotypic assay relying on the detection of fluorescently labeled Mtb within fluorescently labeled host&#160;cells using automated confocal microscopy. This in vitro assay allows an image based quantification of the colonization process of Mtb&#160;into the host and was optimized for the 384-well microplate format, which is proper for screens of siRNA-, chemical compound- or Mtb mutant-libraries. The images are then processed for multiparametric analysis, which provides read&#160;out inferring on the pathogenesis of Mtb&#160;within host cells.

Here, we describe a phenotypic assay applicable to the High-throughput/High-content screens of small-interfering synthetic RNA (siRNA), chemical compound, and Mycobacterium tuberculosis mutant libraries. This method relies on the detection of fluorescently labeled Mycobacterium tuberculosis within fluorescently labeled host&#160;cell using automated confocal microscopy.

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

A Fluorescence-based Lymphocyte Assay Suitable for High-throughput Screening of Small Molecules

High-throughput screening (HTS) is currently the mainstay for the identification of chemical entities capable of modulating biochemical reactions or cellular processes. With the advancement of biotechnologies and the high translational potential of small molecules, a number of innovative approaches in drug discovery have evolved, which explains the resurgent interest in the use of HTS. The oncology field is currently the most active research area for drug screening, with no major breakthrough made for the identification of new immunomodulatory compounds targeting transplantation-related complications or autoimmune ailments. Here, we present a novel in vitro murine fluorescent-based lymphocyte assay easily adapted for the identification of new immunomodulatory compounds. This assay uses T or B cells derived from a transgenic mouse, in which the Nur77 promoter drives GFP expression upon T- or B-cell receptor stimulation. As the GFP intensity reflects the activation/transcriptional activity of the target cell, our assay defines a novel tool to study the effect of given compound(s) on cellular/biological responses. For instance, a primary screening was performed using 4,398 compounds in the absence of a &#34;target hypothesis&#34;, which led to the identification of 160 potential hits displaying immunomodulatory activities. Thus, the use of this assay is suitable for drug discovery programs exploring large chemical libraries prior to further in vitro/in vivo validation studies.

We present in the current study a novel fluorescence-based assay using lymphocytes derived from a transgenic mouse. This assay is suitable for high-throughput screening (HTS) of small molecules endowed with the capacity of either inhibiting or promoting lymphocyte activation.

High-throughput screening (HTS) is currently the mainstay for the identification of chemical entities capable of modulating biochemical reactions or ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory response by the endothelial layer is crucial to efficiently fight against harmful inputs and aid in the recovery of damaged areas. When the endothelial cells are exposed to an inflammatory environment, such as the outer component of gram-negative bacteria membrane, lipopolysaccharide (LPS), they express soluble pro-inflammatory cytokines, such as Ccl5, Cxcl1 and Cxcl10, and trigger the activation of circulating leukocytes. In addition, the expression of adhesion molecules E-selectin, VCAM-1 and ICAM-1 on the endothelial surface enables the interaction and adhesion of the activated leukocytes to the endothelial layer, and eventually the extravasation towards the inflamed tissue. In this scenario, the endothelial function must be tightly regulated because excessive or defective activation in the leukocyte recruitment could lead to inflammatory-related disorders. Since many of these disorders do not have an effective treatment, novel strategies with a focus on the vascular layer must be investigated. We propose comprehensive assays that are useful to the search of novel endothelial regulators that modify leukocyte function. We analyze endothelial activation by using specific expression targets involved in leukocyte recruitment (such as, cytokines, chemokines, and adhesion molecules) with several techniques, including: real-time quantitative polymerase chain reaction (RT-qPCR), western-blot, flow cytometry and adhesion assays. These approaches determine endothelial function in the inflammatory context and are very useful to perform screening assays to characterize novel endothelial inflammatory regulators that are potentially valuable for designing new therapeutic strategies.

Vascular endothelium tightly controls leukocyte recruitment. Inadequate leukocyte extravasation contributes to human inflammatory diseases. Therefore, searching for novel regulatory elements of endothelial activation is necessary to design improved therapies for inflammatory disorders. Here, we describe a comprehensive methodology to characterize novel endothelial regulators that can modify leukocyte trafficking during inflammation.

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. However, these screens are typically conducted in cells that are naturally permissive to the viral pathogen under study. Therefore, the robust replication of viruses in control conditions may limit the dynamic range of these screens. Furthermore, these screens may be unable to easily identify cellular defense pathways that restrict virus replication if the virus is well-adapted to the host and capable of countering antiviral defenses. In this article, we describe a new paradigm for exploring virus-host interactions through the use of screens that center on naturally abortive infections by arboviruses such as vesicular stomatitis virus (VSV). Despite the ability of VSV to replicate in a wide range of dipteran insect and mammalian hosts, VSV undergoes a post-entry, abortive infection in a variety of cell lines derived from lepidopteran insects, such as the gypsy moth (Lymantria dispar). However, these abortive VSV infections can be &#34;rescued&#34; when host cell antiviral defenses are compromised. We describe how VSV strains encoding convenient reporter genes and restrictive L. dispar cell lines can be paired to set-up screens to identify host factors involved in arbovirus restriction. Furthermore, we also show the utility of these screening tools in the identification of virally encoded factors that rescue VSV replication during coinfection or through ectopic expression, including those encoded by mammalian viruses. The natural restriction of VSV replication in L. dispar cells provides a high signal-to-noise ratio when screening for the conditions that promote VSV rescue, thus enabling the use of simplistic luminescence- and fluorescence-based assays to monitor the changes in VSV replication. These methodologies are valuable for understanding the interplay between host antiviral responses and viral immune evasion factors.

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

High-throughput Measurement of Plasma Membrane Resealing Efficiency in Mammalian Cells

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In response to these damages, complex molecular machineries rapidly reseal the plasma membrane to restore its barrier function and maintain cell survival. Despite 60 years of research in this field, we still lack a thorough understanding of the cell resealing machinery. With the goal of identifying cellular components that control plasma membrane resealing or drugs that can improve resealing, we have developed a fluorescence-based high-throughput assay that measures the plasma membrane resealing efficiency in mammalian cells cultured in microplates. As a model system for plasma membrane damage, cells are exposed to the bacterial pore-forming toxin listeriolysin O (LLO), which forms large 30-50 nm diameter proteinaceous pores in cholesterol-containing membranes. The use of a temperature-controlled multi-mode microplate reader allows for rapid and sensitive spectrofluorometric measurements in combination with brightfield and fluorescence microscopy imaging of living cells. Kinetic analysis of the fluorescence intensity emitted by a membrane impermeant nucleic acid-binding fluorochrome reflects the extent of membrane wounding and resealing at the cell population level, allowing for the calculation of the cell resealing efficiency. Fluorescence microscopy imaging allows for the enumeration of cells, which constitutively express a fluorescent chimera of the nuclear protein histone 2B, in each well of the microplate to account for potential variations in their number and allows for eventual identification of distinct cell populations. This high-throughput assay is a powerful tool expected to expand our understanding of membrane repair mechanisms via screening for host genes or exogenously added compounds that control plasma membrane resealing.

Here we describe a high-throughput fluorescence-based assay that measures the plasma membrane resealing efficiency through fluorometric and imaging analyses in living cells. This assay can be used for screening drugs or target genes that regulate plasma membrane resealing in mammalian cells.

In their physiological environment, mammalian cells are often subjected to mechanical and biochemical stresses that result in plasma membrane damage. In ...

High Throughput Co-culture Assays for the Investigation of Microbial Interactions

The study of interactions between microorganisms has led to numerous discoveries, from novel antimicrobials to insights in microbial ecology. Many approaches used for the study of microbial interactions require specialized equipment and are expensive and time intensive. This paper presents a protocol for co-culture interaction assays that are inexpensive, scalable to large sample numbers, and easily adaptable to numerous experimental designs. Microorganisms are cultured together, with each well representing one pairwise combination of microorganisms. A test organism is cultured on one side of each well and first incubated in monoculture. Subsequently, target organisms are simultaneously inoculated onto the opposite side of each well using a 3D-printed inoculation stamp. After co-culture, the completed assays are scored for visual phenotypes, such as growth or inhibition. These assays can be used to confirm phenotypes or identify patterns among isolates of interest. Using this simple and effective method, users can analyze combinations of microorganisms rapidly and efficiently. This co-culture approach is applicable to antibiotic discovery as well as culture-based microbiome research and has already been successfully applied to both applications.

The co-culture interaction assays presented in this protocol are inexpensive, high throughput, and simple. These assays can be used to observe microbial interactions in co-culture, identify interaction patterns, and characterize the inhibitory potential of a microbial strain of interest against human and environmental pathogens.