Ce travail a été soutenu par les fonds de démarrage nouvelle faculté de North Carolina State University pour Guozhou Xu.

NOTE : Un système de cellule/baculovirus insectes avec des vecteurs d’expression modifiées pour l’expression de la protéine sécrétoire plante et cristallisation est utilisé.
1. modification d’un vecteur d’Expression Baculovirus avec le Peptide Signal GP67 pour Expression de sécrétion des protéines végétales
<ol><li>Synthétiser un fragment d’ADN contenant un 5' BglII coupe site13, la séquence de signaux de sécrétion GP67 et un site multi clonage avec NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI et XhoI (Figure 1 a). NOTE : Puisque les BglII et BamHI digéré ADN a permis aux mêmes fins adhésifs, le vecteur linéarisé peut ligaturer pour le fragment d’ADN digéré, tandis que les sites BamHI tant BglII dans la séquence de ligature recuite vont être mutés à une séquence qui n’est pas CLIVABLES par BglII ou BamHI14.</li>
	<li>Digest 4 µg d’ADN avec BglII et XhoI et 4 µg d’un vecteur d’expression ADN avec BamHI et XhoI14. Mélanger 10 unités de chaque enzyme de restriction avec l’ADN dans un 1 x tampon de réaction de concentration (acétate de potassium 50 mM, 20 mM Tris-acétate, acétate de magnésium de 10 mM et 100 µg/mL de BSA, pH 7,9 à 25 ° C) et laisser incuber le mélange à 37 ° C pendant 4 h.<ol>
<li>Purifier le fragment d’ADN excisé et le vecteur linéarisé ADN par un ADN gel extraction kit15.</li>
	</ol>
</li>
	<li>Mélanger 100 ng du vecteur ADN linéarisé avec 400 ng d’ADN digéré fragment dans un mélange de réaction de ligature de 10 µL contenant 1 x tampon de réaction T4 DNA ligase (50 mM Tris-HCl 10 mM MgCl2, ATP 1 mM et 10 mM DTT, pH de 7,5 à 25 ° C) et de 5 unités d’ADN T4 ligase. Incuber le mélange réactionnel à 16 ° C pendant 16 h.</li>
	<li>Transformer 5 µL du mélange ligature dans 100 µL de cellules capables de DH5α suite à un protocole de transformation standard, puis sélectionnez les colonies qui en résulte sur une plaque de gélose LB ampicillin16. Prendre 5-10 colonies et grandir chaque colonie dans 2 mL de milieu LB contenant 100 ampicilline µg/mL à 220 tr/mn et 37 ° C dans un incubateur à agitation pendant 16 h.</li>
	<li>Extraire chaque ADN plasmidique avec un DNA miniprep kit17 et confirmer les clones par séquençage de l’ADN d’une amorce de AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>PCR-amplifier le gène TDR a. thaliana fragment encodage résidus 30-642 d’un gène synthétique de TDR construire (avant apprêt : CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, apprêt inverse : GC GGATCC LTC GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Amplifier l’ADN pour 30 cycles dans un tampon de réaction de polymérase d’ADN contenant un mélange dNTP de 0,5 mM, 0,2 µM élémentaires, 0,1 µg d’ADN, 0,4 mM MgCl2et 1 unité de réaction de l’ADN polymérase.<ol>
<li>Pour les étapes du cycle de PCR, définir la dénaturation initiale à 95 ° C pendant 30 s et puis 30 cycles de dénaturation à 95 ° C pendant 30 s, recuit à 55 ° C pendant 30 s et l’extension à 72 ° C pendant 1 min, avec une extension finale à 72 ° C pendant 5 min.</li>
	</ol>
</li>
	<li>Digérer le fragment PCR tant le vecteur mis à jour l’avec NotI et BamHI enzymes endonucléases de restriction. Ligaturer le fragment de gène avec le vecteur linéarisé. Mélanger 100 ng du vecteur ADN linéarisé avec 400 ng d’ADN digéré fragment dans un mélange de réaction de ligature de 10 µL contenant du tampon de réaction T4 DNA ligase et 5 unités de T4 DNA ligase. Incuber le mélange réactionnel à 16 ° C pendant 16 h.</li>
	<li>Transformer 5 µL du mélange ligature dans 100 µL de cellules capables de DH5α suite à un protocole de transformation standard, puis sélectionnez les colonies qui en résulte sur une plaque de gélose LB ampicillin16. Confirmer les clones correctes par séquençage de l’ADN.</li>
</ol>2. modification d’un vecteur d’Expression Baculovirus avec le Peptide Signal Hemolin insectes pour Expression de sécrétion des protéines végétales
<ol><li>Synthétiser un fragment d’ADN contenant un 5' BglII coupe site13, la séquence de signaux de sécrétion insectes hemolin et un site multi clonage avec NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI et XhoI (Figure 1 b).</li>
	<li>Digest 4 µg d’ADN avec BglII et XhoI et 4 µg d’un vecteur d’expression ADN avec BamHI et XhoI14. Mélanger 10 unités de chaque enzyme de restriction avec l’ADN dans un 1 x tampon de réaction de concentration (acétate de potassium 50 mM, 20 mM Tris-acétate, acétate de magnésium de 10 mM et 100 µg/mL de BSA, pH 7,9 à 25 ° C) et laisser incuber le mélange à 37 ° C pendant 4 h.<ol>
<li>Purifier le fragment d’ADN excisé et le vecteur linéarisé ADN par un ADN gel extraction kit15.</li>
	</ol>
</li>
	<li>Mélanger 100 ng du vecteur ADN linéarisé avec 400 ng d’ADN digéré fragment dans un mélange de réaction de ligature de 10 µL contenant 1 x tampon de réaction T4 DNA ligase (50 mM Tris-HCl 10 mM MgCl2, ATP 1 mM et 10 mM DTT, pH de 7,5 à 25 ° C) et de 5 unités d’ADN T4 ligase. Incuber le mélange réactionnel à 16 ° C pendant 16 h.</li>
	<li>Transformer 5 µL du mélange ligature dans 100 µL de cellules capables de DH5α, puis sélectionnez les colonies sur une gélose au ampicilline LB. Prendre 5-10 colonies et grandir chaque colonie dans un milieu LB de 2 mL contenant 100 µg/mL d’ampicilline à 220 tr/mn et 37 ° C dans un incubateur à agitation pendant 16 h.</li>
	<li>Extraire l’ADN de plasmide avec un DNA miniprep kit17 et confirmer les clones par séquençage de l’ADN d’une amorce de AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>PCR-amplifier a. thaliana Pollen Receptor Kinase 3 (PRK3) fragment du gène codant des résidus 20-237 d’un synthétique PRK3 gène chimère (avant apprêt : CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, apprêt inverse : CGC GGATCC LTC GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Amplifier l’ADN pour 30 cycles dans un tampon de réaction de polymérase d’ADN contenant un mélange dNTP de 0,5 mM, 0,2 µM élémentaires, 0,1 µg d’ADN, 0,4 mM MgCl2et 1 unité de réaction de l’ADN polymérase.<ol>
<li>Pour les étapes du cycle de PCR, définir la dénaturation initiale à 95 ° C pendant 30 s et puis 30 cycles de dénaturation à 95 ° C pendant 30 s, recuit à 55 ° C pendant 30 s et l’extension à 72 ° C pendant 30 s au sein de chaque cycle et l’extension finale à 72 ° C pendant 5 min.</li>
	</ol>
</li>
	<li>Digérer le fragment PCR tant le vecteur mis à jour l’avec NotI et BamHI enzymes endonucléases de restriction. Ligaturer le fragment de gène avec le vecteur linéarisé. Mélanger 100 ng du vecteur ADN linéarisé avec 400 ng d’ADN digéré fragment dans un mélange de réaction de ligature de 10 µL contenant du tampon de réaction T4 DNA ligase et 5 unités de T4 DNA ligase. Incuber le mélange réactionnel à 16 ° C pendant 16 h.</li>
	<li>Transformer 5 µL du mélange ligature dans 100 µL de cellules capables de DH5α suite à un protocole de transformation standard, puis sélectionnez les colonies qui en résulte sur une plaque de gélose LB ampicillin16. Confirmer les clones correctes par séquençage de l’ADN.</li>
</ol>3. la production et l’Amplification de Baculovirus construit nourrissait la Cassette d’Expression de protéine recombinante
<ol><li>Utilisez 100 ng de plasmide construct de transformer 40 µL de cellules capables de DH10Bac selon le protocole du système baculovirus expression1. La transformation incuber à 37 ° C pendant 48 h.</li>
	<li>Ramasser les deux colonies blanches de chaque plaque de transformation, inoculer chaque colonie dans 2 mL de milieu LB contenant 50 µg/mL kanamycine, gentamicine 7 de µg/mL et 10 tétracycline µg/mL. Suivre le protocole du système expression baculovirus1 d’extraire et de vérifier la bacmid ADN. Aliquote chaque ADN dans deux tubes avec 20 µL de chaque et stockez les tubes à-20 ° C. Remarque : Les étapes suivantes nécessitent une opération aseptique.</li>
	<li>Atteindre une monocouche de cellules Sf9 dans les antibiotiques pénicilline-streptomycine de milieux de culture avec 10 % sérum fœtal (SVF) et 100 µg/mL (ou 100 UI/ml) à 27 ° C 80 % confluent en une plaque 6 puits. Estimer le pourcentage de confluence basée sur le pourcentage de surface couverte sur la plaque de culture de tissus.</li>
	<li>Préparer les solutions suivantes dans deux tubes à centrifuger de 1,5 mL stérile.<ol>
<li>Tube 1 : Pour chaque transfection, diluer 20 µL de bacmid ADN dans 100 µL de milieu de culture cellulaire sans additifs Sf9 sans antibiotiques. Mélanger doucement la dilution en effleurant la paroi du tube.</li>
		<li>Tube 2 : Pour chaque transfection, diluer 8 µL de réactif de transfection de lipides dans 100 µL de milieu de culture cellulaire sans additifs Sf9 sans antibiotiques. Bien mélanger la dilution par pipetage de haut en bas pour 6 x.</li>
	</ol>
</li>
	<li>Combiner les deux solutions, mélangez-les délicatement en pipettant également lentement de haut en bas pour x 3 et les incuber pendant 20 à 40 minutes à température ambiante.</li>
	<li>Lavez chaque puits de la monocouche Sf9 cellules 2 x avec 3 mL de milieu de culture cellulaire sans additifs Sf9 sans antibiotiques. Pour chaque transfection, ajouter 0,8 mL de milieu de culture cellulaire sans additifs Sf9 sans antibiotiques dans chaque tube contenant le mélange de lipides-ADN. Mélanger doucement le contenu des tubes de pipetage lentement de haut en bas pour 3 x. Aspirer les médias de lavage des plaques et superposer les échantillons avec le mélange de transfection.</li>
	<li>Après l’ajout du mélange transfection, incuber la plaque transfectée pendant 5 h à 27 ° C. Remplacer les médias de transfection avec le milieu de culture de cellules Sf9 complet contenant 10 % FBS et 100 µg/mL (ou 100 UI/ml) antibiotiques pénicilline-streptomycine. Incuber la plaque transfectée à 27 ° C, pendant 4 jours.</li>
	<li>Récolter et amplifier le baculovirus recombinant.<ol>
<li>Recueillir le liquide surnageant de la plaque infecté dans un tube conique stérile de 15 mL après 4 jours d’incubation. Faites tourner le surnageant à 1010 x g pendant 5 min éliminer les débris cellulaires. Ignorer le culot et éliminer le surnageant dans un tube propre et conserver à 4 ° C pendant 1 an. NOTE : Ceci est le virus P0. Il peut être aliquotés et congelés à-80 ° C pour une plus longue période de temps.</li>
		<li>Pour amplifier chaque virus recombinant, poussent une monocouche de cellules Sf9 sur un plat de 150 millimètres au confluent de 80 %. Aspirer les médias de la plaque, ajouter 2 mL du virus P0 à l’adhérent de cellules à la plaque et incuber la plaque dans une étuve à 27 ° C pendant 1 heure. Balancer la plaque toutes les 15 min pour mélanger le milieu avec les cellules.<ol>
<li>Ajouter 25 mL de médias de Grace complet contenant 10 % FBS et 100 µg/mL (ou 100 UI/ml) antibiotiques pénicilline-streptomycine. Incuber les plaques pendant 3 jours dans une étuve à 27 ° C pour obtenir le virus de passage de P1.</li>
		</ol>
</li>
		<li>Recueillir le liquide surnageant de la plaque infecté dans un tube conique stérile de 50 mL et un essorage à 1010 x g pendant 5 min éliminer les débris cellulaires. Décanter le liquide surnageant dans un tube propre et conserver à 4 ° C pendant 1 an. Remarque : Le virus P1 peut être aliquotés et congelés à-80 ° C pour une plus longue période de temps.</li>
		<li>Pour amplifier le virus de P1 à P2 passage, cultiver une monocouche de cellules Sf9 sur un plateau de 150 mm à 90 % confluence, aspirer les médias de la plaque, ajouter 2 mL du virus P1 à la plaque et il incuber pendant 1 heure dans une étuve à 27 ° C.</li>
		<li>Répétez les étapes 3.8.2 et 3.8.3 pour obtenir les passages P2 et P3 des virus. Ne stockez pas le virus P3 pendant plus de 2 mois.</li>
	</ol>
</li>
</ol>4. protein Expression, Purification avec NiNTA et cristallisation
<ol><li>La culture 1 L de Hi5 cellules d’insectes dans les antibiotiques pénicilline-streptomycine de milieux de culture avec 100 µg/mL (ou 100 UI/ml) à une densité de 2 x 106 à 100 tr/min dans un shaker incubateur de 27 ° C. Tournez en bas les cellules à 570 x g pendant 5 min, éliminer le surnageant, remettre en suspension les cellules dans 20 mL du virus P3 fraîchement produit et gardez-le à température ambiante pour 1 h. agiter doucement le flacon de spin pour remettre en suspension les cellules 1 x toutes les 15 min.</li>
	<li>Les cellules de transfert à 1 L d’antibiotiques pénicilline-streptomycine 100 µg/mL (ou 100 UI/ml), les milieux de culture, la culture des cellules à 100 tr/min dans un shaker incubateur de 27 ° C pendant 72 h. Spin down les cellules à 1 010 x g pendant 5 min et recueillir le surnageant.</li>
	<li>Indicateur de pH d’utilisation des bandes pour ajuster le pH du liquide surnageant à 8.0 en ajoutant 0,1 M HCl ou NaOH 0,1 M et ajouter le tampon de liaison à une concentration finale, contenant un tampon Tris 20 mM à pH 8,0, 100 mM NaCl et imidazole de 5 mM. Ajouter une certaine quantité de résine NiNTA (10 à 40 mL) basée sur le rendement estimé de la protéine recombinante His-tag.<ol>
<li>Mélanger la solution sur une agitation magnétique avec une vitesse réduite à 4 ° C pendant 1 h. lavage la résine et Éluer la protéine liée suivant le protocole de purification standard NiNTA18.</li>
	</ol>
</li>
	<li>Sous réserve de la protéine purifiée de l’échange d’ions et la chromatographie par filtration, mais aussi d’autres méthodes de purification des protéines, pour obtenir un échantillon homogène de gel. Remarque : Pour le TDR ectodomaine, Tris, 20 mM, pH 8, 100 mM NaCl étaient utilisés comme tampon de gel filtration. Pour l’ectodomaine PRK3, 20 mM bis-Tris, pH 6, 100 mM NaCl servaient de tampon préféré gel filtration.</li>
</ol>

<ol>
	<li>Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+using+the+baculovirus-insect+cell+expression+system.">Protein production using the baculovirus-insect cell expression system.</a> Biotechnology Progress. 30, 1-18 (2014).</li><li>Khan, S., Ng, M. L., Tan, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+severe+acute+respiratory+syndrome+coronavirus+3a+protein+and+the+assembly+of+coronavirus-like+particles+in+the+baculovirus+expression+system.">Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system.</a> Methods in Molecular Biology. 379, 35-50 (2007).</li><li>Possee, R. D., King, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+Transfer+Vectors.">Baculovirus Transfer Vectors.</a> Methods in Molecular Biology. 1350, 51-71 (2016).</li><li>Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+establishment+of+two+cell+lines+from+the+insect+Spodoptera+frugiperda+(Lepidoptera;+Noctuidae).">The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae).</a> In Vitro. 13, 213-217 (1977).</li><li>Hink, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Established+insect+cell+line+from+the+cabbage+looper,+Trichoplusia+ni.">Established insect cell line from the cabbage looper, Trichoplusia ni.</a> Nature. 226, 466-467 (1970).</li><li>Davis, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+recombinant+protein+production+of+eight+insect+cell+lines.">Comparative recombinant protein production of eight insect cell lines.</a> In Vitro Cellular &amp; Development Biology - Animal. 29A, 388-390 (1993).</li><li>Wickham, T. J., Nemerow, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+growth+methods+and+recombinant+protein+production+in+BTI-Tn-5B1-4+insect+cells+using+the+baculovirus+expression+system.">Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system.</a> Biotechnology Progress. 9, 25-30 (1993).</li><li>Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+expression+of+alkaline+phosphatase+as+a+reporter+gene+for+evaluation+of+production,+glycosylation+and+secretion.">Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion.</a> Nature Biotechnology. 10, 1148-1150 (1992).</li><li>Murphy, C. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+expression,+secretion,+and+large-scale+purification+of+recombinant+HIV-1+gp120+in+insect+cell+using+the+baculovirus+egt+and+p67+signal+peptides.">Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides.</a> Protein Expression and Purification. 4, 349-357 (1993).</li><li>Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemolin:+an+insect-immune+protein+belonging+to+the+immunoglobulin+superfamily.">Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily.</a> Science. 250, 1729-1732 (1990).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+CLE+peptide+perception+by+plant+receptors+implicated+from+structural+and+functional+analyses+of+TDIF-TDR+interactions.">Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions.</a> PLoS One. 12, e0175317 (2017).</li><li>Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Extracellular+Domain+of+Pollen+Receptor+Kinase+3+is+structurally+similar+to+the+SERK+family+of+co-receptors.">The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors.</a> Scientific Reports. 8, 2796 (2018).</li><li>Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Total+synthesis+of+a+gene.">Total synthesis of a gene.</a> Science. 203, 614-625 (1979).</li><li>Bahl, C. P., Marians, K. J., Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+for+inserting+specific+DNA+sequences+into+cloning+vehicles.">A general method for inserting specific DNA sequences into cloning vehicles.</a> Gene. 1, 81-92 (1976).</li><li>Xu, W., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Characterization+of+Vaccine-Derived+Polioviruses,+Relevance+for+the+Global+Polio+Eradication+Initiative.">Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative.</a> Methods in Molecular Biology. 1387, 213-226 (2016).</li><li>Hanahan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+transformation+of+Escherichia+coli+with+plasmids.">Studies on transformation of Escherichia coli with plasmids.</a> Journal of Molecular Biology. 166, 557-580 (1983).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Reddy, B. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+purification+of+the+alpha+subunit+of+the+epithelial+sodium+channel,+ENaC.">Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC.</a> Protein Expression and Purification. 117, 67-75 (2016).</li><li>Harris, T. J., Emtage, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+heterologous+genes+in+E.+coli.">Expression of heterologous genes in E. coli.</a> Microbiological Sciences. 3, 28-31 (1986).</li><li>Kaur, J., Kumar, A., Kaur, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimization+of+heterologous+protein+expression+in+E.+coli:+Roadblocks+and+reinforcements.">Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements.</a> International Journal of BIological Macromolecules. 106, 803-822 (2018).</li><li>Guo, Y., Yang, F., Tang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+of+Protein+Secretion+in+Yeast+and+Animal+Cells.">An Overview of Protein Secretion in Yeast and Animal Cells.</a> Methods in Molecular Biology. 1662, 1-17 (2017).</li><li>Blight, M. A., Chervaux, C., Holland, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+pathway+in+Escherichia+coli.">Protein secretion pathway in Escherichia coli.</a> Current Opinion in Biotechnology. 5, 468-474 (1994).</li><li>Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+protein+secretion+in+yeast:+strategies+and+impact+on+protein+production.">Engineering of protein secretion in yeast: strategies and impact on protein production.</a> Applied Microbiology and Biotechnology. 86, 403-417 (2010).</li><li>Wormald, M. R., Dwek, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycoproteins:+glycan+presentation+and+protein-fold+stability.">Glycoproteins: glycan presentation and protein-fold stability.</a> Structure. 7, R155-R160 (1999).</li><li>Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+and+History+of+Glyco-Engineering+in+Insect+Expression+Systems.">An Overview and History of Glyco-Engineering in Insect Expression Systems.</a> Methods in Molecular Biology. 1321, 131-152 (2015).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-ray+crystallographic+studies+of+the+extracellular+domain+of+the+first+plant+ATP+receptor,+DORN1,+and+the+orthologous+protein+from+Camelina+sativa.">X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa.</a> Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).</li><li>Aricescu, A. R., Owens, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+recombinant+glycoproteins+in+mammalian+cells:+towards+an+integrative+approach+to+structural+biology.">Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology.</a> Current Opinion in Structural Biology. 23, 345-356 (2013).</li><li>Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scale-up+of+hydrophobin-assisted+recombinant+protein+production+in+tobacco+BY-2+suspension+cells.">Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells.</a> Plant Biotechnology Journal. 12, 402-410 (2014).</li><li>Dohi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+virus-mediated+expression+of+a+foreign+protein+in+suspension-cultured+plant+cells.">Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells.</a> Archives of Virology. 151, 1075-1084 (2006).</li></ol>

Les auteurs n’ont rien à divulguer.

Compte tenu de la diversité dans la taille et de la stabilité des milliers de protéines présentes dans les systèmes biologiques, il est souvent empirique pour une recherche laboratoire de décider quel système d’expression hétérologue doit être choisi pour l’expression d’une protéine spécifique. Le système d’expression e. coli est souvent le premier choix pour l’expression de la protéine en raison du cycle de vie court de la bactérie, le faible coût des milieux de culture et assez facile...

Il est impératif pour un laboratoire de recherche être capable de produire de grandes quantités de protéines recombinantes homogènes pour les caractérisations biochimiques et biophysiques, surtout pour les études de diffraction des rayons x. Il existe plusieurs systèmes d’expression hétérologue bien établies telles que Escherichia coli, levure, cellules d’insectes, des cellules de mammifères, les cellules végétales, etc. , parmi eux, le système d’expression baculovirus insectes cellulaire est un des plus couramment utilisé des techniques pour produire de grandes quantités de structurellement pliés grosses eucaryotes protéines recombinantes pour la cristallisation de protéines1.
Les vecteurs d’expression du système baculovirus expression sont conçus pour contenir un polyédrine fort ou un promoteur de P10 pour produire un rendement élevé de protéines intracellulaires recombinantes2,3. Pour faire un baculovirus recombinant, le gène d’intérêt est cloné dans un insecte vecteur contenant le locus polyédrine (Paolo) du génome Autographa californica multi-nucleopolyhedroviral. La construction qui en résulte est ensuite séquencée et son cadre de lecture ouvert correcte (ORF) est vérifié. La construction correcte est ensuite introduite dans la cellule d’insecte hôte à travers le processus de la transfection. Le gène d’intérêt est inséré dans le génome viral par recombinaison homologue. Cet événement donne lieu à la production du génome viral recombinant, qui réplique puis sur produire recombinant ont bourgeonné de particules de virus1.
Les cellules d’insectes qui sont plus couramment utilisés dans le système d’expression sont des cellules (Hi5) cinq Sf9 et haute. Les cellules SF9 sont un isolat clonal de Sf21, dérivé des pupes cellules ovariennes de Spodoptera frugiperda, et Hi5 cellules sont un isolat clonal dérivé le parental Trichoplusia ni cellules ovariennes ligne TN-3684,5. Transfections Co, amplification des virus et des essais de plaque sont menées sur les cellules Sf9, tandis que les cellules de Hi5 sont typiquement pour produire des quantités plus élevées de protéines recombinantes6. Il est à noter que les cellules de Hi5 ne conviennent pas pour la génération et l’amplification des descendances de virus à cause de leur tendance à produire des virus mutants. Traditionnellement, une plage de température de 25-30 ° C est considérée comme bonne pour la culture de cellules d’insectes. Toutefois, il a été signalé que les 27-28 ° C est la température optimale pour la cellule insectes croissance et infection7,8.
L’introduction d’une séquence signal fort qui précède le gène est nécessaire pour la forte expression des protéines sécrétées. La séquence signal guideraient efficacement la protéine recombinante traduite dans le réticulum endoplasmique pour la sécrétion de protéines et de modifications post-traductionnelles nécessaires à repliement adéquat et de stabilisation3. Séquences de peptide signal, tels que le baculovirus enveloppe protéique GP64/67, abeille mélittine et autres, ont été choisis pour faciliter l’expression de protéines recombinantes sécrétrices dans le systèmes de médiation baculovirus expression3. L’introduction du peptide signal de GP67 s’est avérée d’améliorer le rendement de l’expression d’une protéine recombinante sécrétée, en comparaison à l’aide du peptide signal intrinsèque du gène cible9. Hemolin est une protéine de l’hémolymphe de la teigne de soie géante Hyalophora cecropia, induite à bactéries infection10. En raison du niveau relativement élevé d’expression induite, la séquence de peptide signal du gène peut être utilisée à la médiation de l’expression de la sécrétion des protéines recombinantes dans le système baculovirus-insecte cellule.
L’Arabidopsis trachée élément différenciation inhibitrice facteur du récepteur (TDR) et Pollen Receptor Kinase 3 (PRK3) tous deux appartiennent à la famille de répétition comme récepteur Kinase (LRR-RLK) plante riche en Leucine de protéines11,12 . Afin d’étudier la structure et la fonction de cette famille de récepteurs des protéines végétales, aussi bien pour en faciliter la caractérisation structurale et biochimique des autres protéines végétales sécrétée, le système d’expression baculovirus-insecte cellule a été modifié à améliorer le rendement de qualité et de la production de protéines. Les domaines extracellulaires de TDR et PRK3 ont été exprimés avec succès dans le système d’expression baculovirus-insect cell à l’aide de deux vecteurs d’expression mis à jour le. Les deux domaines extracellulaires de TDR et PRK3 protéines ont été cristallisés. Cet article rend compte de l’expression et purification de grandes quantités de protéines recombinantes végétale sécrétée avec vecteurs d’expression baculovirus modifié deux en incorporant un GP67 ou une séquence de signaux de hemolin entre le promoteur et le clonage à des fins multiples sites.

<table>
	<tbody>
		<tr>
			<td>Incubator shaker</td>
			<td>VWR</td>
			<td>Model Excella E25</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>VWR</td>
			<td>Model 2005</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>BECKMAN</td>
			<td>Model J-6</td>
			<td>with a swing bucket rotor</td>
		</tr>
		<tr>
			<td>Herculase II Fusion DNA Polymerase</td>
			<td>Agilent</td>
			<td>600677-51</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Thermal Cycler</td>
			<td>BIO-RAD</td>
			<td>Model C1000 Touch</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Incubator shaker</td>
			<td>New Brunswick Scientific</td>
			<td>Model I 24</td>
			<td>For growing baceria culture</td>
		</tr>
		<tr>
			<td>Customer DNA synthesis</td>
			<td>GENSCRIPT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3136S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>BglII</td>
			<td>New England Biolabs</td>
			<td>R0144S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>NotI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3189S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>XhoI</td>
			<td>New England Biolabs</td>
			<td>R0146S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td>M0202T</td>
			<td>DNA ligation</td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td>DNA purification from Agorase gel</td>
		</tr>
		<tr>
			<td>QIAprep Spin Miniprep Kit</td>
			<td>Qiagen</td>
			<td>27104</td>
			<td>Plasmid DNA purification from bacteria culture</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Thermo Fisher Scientific</td>
			<td>15510-019</td>
			<td>For DNA gel electropherosis</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH5&#945; competen cell</td>
			<td>Invitrogen</td>
			<td>18-258-012</td>
			<td>For transformation of DNA ligation mixture</td>
		</tr>
		<tr>
			<td>Lennox L LB Broth</td>
			<td>Research Product International Corp.</td>
			<td>L24066-5000.0</td>
			<td>For making bacteria culture</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Thermo Fisher Scientific</td>
			<td>11593-019</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Kanamycin Sulfate</td>
			<td>Thermo Fisher Scientific</td>
			<td>15160-054</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Thermo Fisher Scientific</td>
			<td>64-75-5</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Gentamicin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15710-064</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH10Bac competent cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>10361-012</td>
			<td>For making bacmid DNA</td>
		</tr>
		<tr>
			<td>S.O.C. Medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>15544-034</td>
			<td>For DNA transformation</td>
		</tr>
		<tr>
			<td>CellFECTIN II Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>10362-101</td>
			<td>Insect cell transfection reagent</td>
		</tr>
		<tr>
			<td>Bac-to-Bac Expression System</td>
			<td>Thermo Fisher Scientific</td>
			<td>10359-016</td>
			<td>Baculovirus-insect cells expression kit</td>
		</tr>
		<tr>
			<td>Bluo-gal</td>
			<td>Thermo Fisher Scientific</td>
			<td>15519-028</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Thermo Fisher Scientific</td>
			<td>15529-019</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>pFastBac1</td>
			<td>Thermo Fisher Scientific</td>
			<td>10360014</td>
			<td>Baculorirus expression vector</td>
		</tr>
		<tr>
			<td>Sf9 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>11496015</td>
			<td>Sf9 monolayer cells</td>
		</tr>
		<tr>
			<td>Hi5 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>B85502</td>
			<td>High Five insect cells</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, unsupplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11595030</td>
			<td>Sf9 cell transfection minimum medium</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, supplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11605102</td>
			<td>Sf9 monolayer cell culture complete medium</td>
		</tr>
		<tr>
			<td>Sf-900 II SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10902104</td>
			<td>Sf9 suspension cell culture medium without FBS</td>
		</tr>
		<tr>
			<td>Express Five SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10486025</td>
			<td>Hi5 cell culture medium</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140122</td>
			<td>100 ml (10,000 I.U./ml)</td>
		</tr>
		<tr>
			<td>L-Glutamine (200 mM)&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>25030081</td>
			<td>100 ml</td>
		</tr>
		<tr>
			<td>FBS Certified</td>
			<td>Thermo Fisher Scientific</td>
			<td>16000-044</td>
			<td>500 ml</td>
		</tr>
		<tr>
			<td>6-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>08-772-1B</td>
			<td>Flat-bottom</td>
		</tr>
		<tr>
			<td>150 mm plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>353025</td>
			<td>100/case</td>
		</tr>
		<tr>
			<td>1.5 ml Microcentrifuge Tubes</td>
			<td>USA Scientific</td>
			<td>1415-2500</td>
			<td>500 tubes/bag</td>
		</tr>
		<tr>
			<td>15 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1475-0511</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>50 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1500-1211</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>Ni-NTA Superflow</td>
			<td>Qiagen</td>
			<td>30430</td>
			<td>NiNTA resin</td>
		</tr>
		<tr>
			<td>pH-indicator strips</td>
			<td>EMD Millipore Corporation</td>
			<td>1.09535.0001</td>
			<td>pH 0 - 14</td>
		</tr>
	</tbody>
</table>

modifying baculovirus expression vectors to produce secreted plant proteins in insect cells

Il a été un défi pour les scientifiques exprimer les protéines eucaryotes sécrétoires recombinantes pour les études structurales et biochimiques. Le système d’expression baculovirus insectes cellulaire est l’un des systèmes utilisés pour exprimer les protéines sécrétoires eucaryotes recombinantes avec quelques modifications post-traductionnelles. Les protéines sécrétoires doivent être acheminés à travers les voies sécrétrices de la glycosylation des protéines, la formation de liaisons disulfure et autres modifications post-traductionnelles. Pour améliorer l’expression cellulaire insectes existants des protéines végétales sécrétoire, un vecteur d’expression baculovirus est modifié par l’ajout de soit un GP67 ou une séquence de peptide signal de hemolin entre le promoteur et le clonage de plusieurs sites. Ce système nouvellement conçu vecteur mis à jour le produit avec succès un rendement élevé de protéines réceptrices plante sécrétées recombinantes solubles d’Arabidopsis thaliana. Deux des protéines végétales exprimées, les domaines extracellulaires de récepteurs de la membrane plasmique d’Arabidopsis TDR et PRK3, ont été cristallisés pour les études de diffraction des rayons x. Le système mis à jour le vecteur est un outil amélioré qui est potentiellement utilisable pour l’expression de protéines recombinantes de sécrétion dans le règne animal ainsi.

Comme illustré à la Figure 1, deux vecteurs d’expression baculovirus mis à jour le pFastBac1 ont été utilisés pour exprimer les protéines sécrétées avec le GP67 ou la séquence signal hemolin pour remplacer la séquence signal intrinsèque du gène cible. Le GP67 virale et les gènes hemolin insectes ont été démontrés d’avoir des niveaux d’expression de sécrétion élevée dans les cellules. Protéines de fusion avec ou l’autre de ces d...

Watch this Scientific Journal Video about Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells at JoVE.com

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Modification des vecteurs d’Expression Baculovirus pour produire sécrétée des protéines végétales dans des cellules d’insecte

Nous présentons ici les protocoles utilisant les insectes cellulaire et baculovirus protein expression pour produire de grandes quantités de protéines végétales sécrétée de cristallisation de protéines. Un vecteur d’expression baculovirus a été modifié par GP67 ou peptide signal hemolin insectes pour expression plante de sécrétion des protéines dans des cellules d’insecte.

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The ...

modifying-baculovirus-expression-vectors-to-produce-secreted-plant

Research

JoVE Journal

Biochemistry

11.4K vues.  North Carolina State University. Nous présentons ici les protocoles utilisant les insectes cellulaire et baculovirus protein expression pour produire de grandes quantités de protéines végétales sécrétée de cristallisation de protéines. Un vecteur d’expression baculovirus a été modifié par GP67 ou peptide signal hemolin insectes pour expression plante de sécrétion des protéines dans des cellules d’insecte.

Vidéo: Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug used to treat depression and anxiety by binding to the serotonin transporter with high-affinity, blocking serotonin reuptake. Here we report an efficient procedure and a set of tools to stabilize, express, purify, and crystallize serotonin transporter-antibody complexes bound to S-citalopram and other antidepressants. Mutations which stabilize the serotonin transporter were identified using an S-citalopram binding assay. Serotonin transporter expressed in baculovirus-transduced HEK293S GnTI- cells, was reconstituted into proteoliposomes and used to raise high-affinity antibodies. We have developed a strategy to discover antibodies that are useful for structural studies. A straightforward approach for the expression of antibody fragments in Sf9 cells has also been established. Transporter-antibody complexes purified using this procedure are well-behaved and readily crystallize, producing complexes with S-citalopram that diffract X-rays to 3-4 &#197; resolution. The strategies developed here can be utilized to determine the structure of other challenging membrane proteins.

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

This manuscript describes how to screen for thermostabilizing mutations, purify the human serotonin transporter, generate high affinity antibodies, and crystallize the serotonin transporter-antibody complex bound to the antidepressant drug S-citalopram. This protocol can be adapted to the study of other challenging membrane transporters, receptors, and channels.

Thermostabilisation, Expression, purification et cristallisation du Serotonin Human Transporter Bound to<em&gt; S</em&gt; -citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Recherche

Biochimie

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from the oxidation of reduced compounds such as nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2). The complete annotation of the Arabidopsis thaliana genome has established it as the most widely used plant model system, and thus the need to purify mitochondria from a variety of organs (leaf, root, or flower) is necessary to fully utilize the tools that are now available for Arabidopsis to study mitochondrial biology. Mitochondria are isolated by homogenization of the tissue using a variety of approaches, followed by a series of differential centrifugation steps producing a crude mitochondrial pellet that is further purified using continuous colloidal density gradient centrifugation. The colloidal density material is subsequently removed by multiple centrifugation steps. Starting from 100 g of fresh leaf tissue, 2 - 3 mg of mitochondria can be routinely obtained. Respiratory experiments on these mitochondria display typical rates of 100 - 250 nmol O2 min-1 mg total mitochondrial protein-1 (NADH-dependent rate) with the ability to use various substrates and inhibitors to determine which substrates are being oxidized and the capacity of the alternative and cytochrome terminal oxidases. This protocol describes an isolation method of mitochondria from Arabidopsis thaliana leaves using continuous colloidal density gradients and an efficient respiratory measurements of purified plant mitochondria.

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

As mitochondria are only a small percentage of the plant cell, they need to be purified for a range of studies. Mitochondria can be isolated from a variety of plant organs by homogenization, followed by differential and density gradient centrifugation to obtain a highly purified mitochondrial fraction.

Isolement et mesures respiratoire des mitochondries d’Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a chemical defense because it has antimicrobial activity and is considered a natural insecticide. Caffeine can also produce negative allelopathic effects that prevent the growth of surrounding plants. In addition, people around the world consume caffeine for its analgesic and stimulatory effects. Due to interest in the technological applications of caffeine, research on the biosynthetic pathway of this compound has grown. These studies have primarily focused on understanding the biochemical and molecular mechanisms that regulate the biosynthesis of caffeine. In vitro tissue culture has become a useful system for studying this biosynthetic pathway. This article will describe a step-by-step protocol for the quantification of caffeine and for measuring the transcript levels of the gene (CCS1) encoding caffeine synthase (CS) in cell suspensions of C. arabica L. as well as its activity.

This protocol describes an efficient methodology for the extraction and quantification of caffeine in cell suspensions of C. arabica L. and an experimental process for evaluating the enzymatic activity of caffeine synthase with the expression level of the gene that encodes this enzyme.

Extraction de la caféine, l’activité enzymatique et l’Expression génique de caféine Synthase de Suspensions de cellules végétales

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Dissipative Microgravimetry to Study the Binding Dynamics of the Phospholipid Binding Protein Annexin A2 to Solid-supported Lipid Bilayers Using a Quartz Resonator

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic properties of the absorbed/immobilized mass on sensor surfaces, allowing the measurements of the interaction of proteins with solid-supported surfaces, such as lipid bilayers, in real-time and with a high sensitivity. Annexins are a highly conserved group of phospholipid-binding proteins that interact reversibly with the negatively charged headgroups via the coordination of calcium ions. Here, we describe a protocol that was employed to quantitatively analyze the binding of annexin A2 (AnxA2) to planar lipid bilayers prepared on the surface of a quartz sensor. This protocol is optimized to obtain robust and reproducible data and includes a detailed step-by-step description. The method can be applied to other membrane-binding proteins and bilayer compositions.

Here, we present an experimental protocol that can be employed to determine the binding affinities and mode of interaction of label-free phospholipid-binding protein annexin A2 with immobilized solid-supported bilayers (SLB) by simultaneously measuring the mass uptake and the viscoelastic properties of the protein annexin A2.

Microgravimétrie dissipatif pour étudier la dynamique de la liaison des phospholipides Binding Protein annexine A2 de bicouches lipidiques solide soutenu par utilisant un résonateur à Quartz

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic ...

How to Quantify the Fraction of Photoactivated Fluorescent Proteins in Bulk and in Live Cells

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells and protein ensembles. Thus far, no method has been available to quantify in bulk and in live cells how many of the PA-FPs expressed are photoactivated to fluoresce.
Here, we present a protocol involving internal rulers, i.e., genetically coupled spectrally distinct (photoactivatable) fluorescent proteins, to ratiometrically quantify the fraction of all PA-FPs expressed in a cell that are switched on to be fluorescent. Using this protocol, we show that different modes of photoactivation yielded different photoactivation efficiencies. Short high-power photoactivation with a confocal laser scanning microscope (CLSM) resulted in up to four times lower photoactivation efficiency than hundreds of low-level exposures applied by CLSM or a short pulse applied by widefield illumination. While the protocol has been exemplified here for (PA-)GFP and (PA-)Cherry, it can in principle be applied to any spectrally distinct photoactivatable or photoconvertible fluorescent protein pair and any experimental set-up.

Here, we present a protocol that involves genetically coupled spectrally distinct photoactivatable and fluorescent proteins. These fluorescent protein chimeras permit quantification of the PA-FP fraction that is photoactivated to be fluorescent, i.e., the photoactivation efficiency. The protocol reveals that different modes of photoactivation yield different photoactivation efficiencies.

Comment quantifier la Fraction des protéines fluorescentes photoactivation en vrac et dans des cellules vivantes

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological functions. Such interactions can be highly dynamic, meaning the interacting subunits are constantly associated and dissociated at certain rates. While measuring the binding affinity using techniques such as quantitative pull-down reveals the strength of the interaction, studying the binding kinetics provides insights on how fast the interaction occurs and how long each complex can exist. Furthermore, measuring the kinetics of an interaction in the presence of an additional factor, such as a protein exchange factor or a drug, helps reveal the mechanism by which the interaction is regulated by the other factor, providing important knowledge for the advancement of biological and medical research. Here, we describe a protocol for measuring the binding kinetics of a protein complex that has a high intrinsic association rate and can be dissociated quickly by another protein. The method uses fluorescence resonance energy transfer to report the formation of the protein complex in vitro, and it enables monitoring the fast association and dissociation of the complex in real time on a stopped-flow fluorimeter. Using this assay, the association and dissociation rate constants of the protein complex are quantified.

Protein-protein interactions are critical for biological systems, and studies of the binding kinetics provide insights into the dynamics and function of protein complexes. We describe a method that quantifies the kinetic parameters of a protein complex using fluorescence resonance energy transfer and the stopped-flow technique. &#160;

À l’aide au transfert d’énergie Fluorescence in Vitro pour étudier la dynamique des protéines Complexes à une échelle de temps de milliseconde

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this superfamily generally display multi-functionality, involving mainly hydrolase and decarboxylase mechanisms. This article presents a series of consecutive methods for the expression and purification of FAHD proteins, mainly FAHD protein 1 (FAHD1) orthologues among species (human, mouse, nematodes, plants, etc.). Covered methods are protein expression in E. coli, affinity chromatography, ion exchange chromatography, preparative and analytical gel filtration, crystallization, X-ray diffraction, and photometric assays. Concentrated protein of high levels of purity (&#62;98%) may be employed for crystallization or antibody production. Proteins of similar or lower quality may be employed in enzyme assays or used as antigens in detection systems (Western-Blot, ELISA). In the discussion of this work, the identified enzymatic mechanisms of FAHD1 are outlined to describe its hydrolase and decarboxylase bi-functionality in more detail.

Expression and purification of fumarylacetoacetate hydrolase domain-containing proteins is described with examples (expression in E. coli, FPLC). Purified proteins are used for crystallization and antibody production and employed for enzyme assays. Selected photometric assays are presented to display the multi-functionality of FAHD1 as oxaloacetate decarboxylase and acylpyruvate hydrolase.

Expression, Purification, Cristallisation et Essais enzymatiques des protéines contenant du domaine de l'hydrolase fumarylacetoacetate

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Obtaining High-Quality Transcriptome Data from Cereal Seeds by a Modified Method for Gene Expression Profiling

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality RNA is often hindered by high starch and sugar content. These compounds can reduce both the yield and the quality of the extracted total RNA. The deterioration in quantity and quality of total RNA can subsequently have a significant impact on the downstream transcriptomic analyses, which may not accurately reflect the spatial and/or temporal variation in the gene expression profile of the samples being tested. In this protocol, we describe an optimized method for extraction of total RNA with sufficient quantity and quality to be used for whole transcriptome analysis of cereal grains. The described method is suitable for several downstream applications used for transcriptomic profiling of developing, germinating, and mature cereal seeds. The method of transcriptome profiling using a microarray platform is shown. This method is specifically designed for gene expression profiling of cereals with described genome sequences. The detailed procedure from microarray handling to final quality control is described. This includes cDNA synthesis, cRNA labelling, microarray hybridization, slide scanning, feature extraction, and data quality validation. The data generated by this method can be used to characterize the transcriptome of cereals during germination, in various stages of grain development, or at different biotic or abiotic stress conditions. The results presented here exemplify high-quality transcriptome data amenable for downstream bioinformatics analyses, such as the determination of differentially expressed genes (DEGs), characterisation of gene regulatory networks, and conducting transcriptome-wide association study (TWAS).

A method for transcriptome profiling of cereals is presented. The microarray-based gene expression profiling starts with the isolation of high-quality total RNA from cereal grains and continues with the generation of cDNA. After cRNA labelling and microarray hybridization, recommendations are given for signal detection and quality control.

Obtenir des données transcriptome de haute qualité à partir de graines de céréales par une méthode modifiée pour le profilage de l’expression génique

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality ...

Transverse Sectioning of Mature Rice (Oryza sativa L.) Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm phenotyping can be used to classify genotypes based on SG morphotype using scanning electron microscopic (SEM) analysis. SGs can be visualized using SEM by slicing through the kernel (pericarp, aleurone layers, and endosperm) and exposing the organellar contents. Current methods require the rice kernel to be embedded in plastic resin and sectioned using a microtome or embedded in a truncated pipette tip and sectioned by hand using a razor blade. The former method requires specialized equipment and is time-consuming, while the latter introduces a new host of problems depending on rice genotype. Chalky rice varieties, particularly, pose a problem for this type of sectioning due to the friable nature of their endosperm tissue. Presented here is a technique for preparing translucent and chalky rice kernel sections for microscopy, requiring only pipette tips and a scalpel blade. Preparing the sections within the confines of a pipette tip prevents rice kernel endosperm from shattering (for translucent or &#8216;vitreous&#8217; phenotypes) and crumbling (for chalky phenotypes). Using this technique, endosperm cell patterning and the structure of intact SGs can be observed.

Transverse Sectioning of Mature Rice Oryza sativa L. Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

This protocol allows for the preparation of transverse sections of cereal seeds (e.g., rice) for the analysis of endosperm and starch granule morphology using scanning electron microscopy.

Sectionnement transversal du riz mature (Oryza sativa L.) Noyaux pour l’imagerie par microscopie électronique à balayage à l’aide d’embouts de pipette comme support d’immobilisation

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm ...

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based phosphoproteomics has transformed the way of studying plant signal transduction. However, requirement of lots of starting materials and prolonged MS measurement time to achieve the depth of coverage has been the limiting factor for the high throughput study of global phosphoproteomic changes in plants. To improve the sensitivity and throughput of plant phosphoproteomics, we have developed a stop and go extraction (stage) tip based phosphoproteomics approach coupled with Tandem Mass Tag (TMT) labeling for the rapid and comprehensive analysis of plant phosphorylation perturbation in response to osmotic stress. Leveraging the simplicity and high throughput of stage tip technique, the whole procedure takes approximately one hour using two tips to finish phosphopeptide enrichment, fractionation, and sample cleaning steps, suggesting an easy-to-use and high efficiency of the approach. This approach not only provides an in-depth plant phosphoproteomics analysis (&#62; 11,000 phosphopeptide identification) but also demonstrates the superior separation efficiency (&#60; 5% overlap) between adjacent fractions. Further, multiplexing has been achieved using TMT labeling to quantify the phosphoproteomic changes of wild-type and snrk2 decuple mutant plants. This approach has successfully been used to reveal the phosphorylation events of Raf-like kinases in response to osmotic stress, which sheds light on the understanding of early osmotic signaling in land plants.

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Presented here is a phosphoproteomic approach, namely stop and go extraction tip based phosphoproteomic, which provides high-throughput and deep coverage of Arabidopsis phosphoproteome. This approach delineates the overview of osmotic stress signaling in Arabidopsis.

Modification des vecteurs d’Expression Baculovirus pour produire sécrétée des protéines végétales dans des cellules d’insecte

PLAYLIST