RSM מכיר במימון מNSF בוגר מלגת המחקר. MBN מכיר במימון מלגת לואיס-סיגלר ומתנת ניחן של פיטר לואיס. DB מכיר במימון מ-NIH (GM046406) המכון הלאומי למדעי רפואה כללי מרכז לביולוגיה כמותית (GM071508). אנו מכירים כריסטינה DeCoste לקבלת סיוע בניסויי cytometry הזרימה.

איור 2 מספק סכמטי של חלקי פרוטוקול 1-3. 1. יצירת ATFs <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> יצירת פריימרים להגברת PCR תחום מחייב-DNA של עניין. הומולוגיה לקולטן אמרגן ACT1 והורמון (כפי שמתואר באיורים 3 ו -4) הוא הוסיף באמצעות PCR כדי להקל על רקומבינציה הנכונה למתח yMN15. </li><li style=";text-align:right;direction:rtl"> PCR להגביר DBD של ריבית באמצעות פולימראז באיכות גבוהה. </li><li style=";text-align:right;direction:rtl"> שינוי&gt; 1 מיקרוגרם של מוצר ה-PCR מטוהר לשמרים בשיטת ליתיום אצטט 13. </li><li style=";text-align:right;direction:rtl"> בעקבות שינוי, תאי ספין במהירות שיא ל15 שניות בmicrocentrifuge ולהסיר תמהיל טרנספורמציה. </li><li style=";text-align:right;direction:rtl"> Resuspend ב ~ 200 μl של מים סטריליים וצלחת על YPD. </li><li style=";text-align:right;direction:rtl"> למחרת, צלחת העתק מYPD על צלחות 5-פואה (צלחות 5-פואה נעשות כפי שמתוארת במדריך לשמרי Cold Spring Harbor) 13. </li><li style=";text-align:right;direction:rtl"> לאפשר צמיחה ל2-4 דays, וrestreak לפחות 5-10 מושבות על YPD. לבצע PCR מושבה באמצעות פריימרים בטבלה 1 ורצף כדי לוודא הכללה. </li></ol> 2. יצירת ATF פלסמיד Reporter <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> קבע את אתר הקישור של ATF (הסיכוי הטוב ביותר מגיע מהספרות). </li><li style=";text-align:right;direction:rtl"> סדר רצוי אזור מחייב כoligos (או Ultramers, במידת צורך). להזמין כעליון ותחתונים עם גדילי סככות נכונות לNotI &amp; XbaI כפי שמוצג בטבלה 2. </li><li style=";text-align:right;direction:rtl"> לדלל oligos לריכוזי equimolar (100 מיקרומטר). </li><li style=";text-align:right;direction:rtl"> Phosphorylate באמצעות T4 Polynucleotide קינאז ואז לחשל בthermocycler. תנאי התגובה הם בטבלה 3. </li><li style=";text-align:right;direction:rtl"> תקציר ~ 1-2 מיקרוגרם של pMN8 עם NotI-HF וXbaI עבור שעה 1 ב 37 מעלות צלזיוס (תנאי תגובה בלוח 4). </li><li style=";text-align:right;direction:rtl"> ג&#39;ל לטהר את להקת עמוד השדרה. </li><li style=";text-align:right;direction:rtl"> לדלל את עמוד השדרה מטוהרת ל10 ng / μl. </li><li style=";text-align:right;direction:rtl"> לדלל את גדילים הכפול, phosphorylated אתר קישור ל5x הריכוז טוחנת של עמוד השדרה לכל μl. </li><li style=";text-align:right;direction:rtl"> באמצעות אנזים T4 DNA, ולקשור את אתרי הקישור לשדרה מתעכל בטמפרטורת חדר במשך 30 דקות (לוח 5). </li><li style=";text-align:right;direction:rtl"> לשינוי, להוסיף חצי מתגובת קשירת 50 μl לסטנדרטים, Escherichia coli כימי המוסמך כגון XL1 כחול או DH5-אלפא. </li><li style=";text-align:right;direction:rtl"> תאי חום הלם ל45 שניות באמבט מים 42 מעלות צלזיוס ולאחר מכן מניחים על קרח במשך 2 דקות. </li><li style=";text-align:right;direction:rtl"> הוספת 900 μl של מדיום SOC לתגובת טרנספורמציה. </li><li style=";text-align:right;direction:rtl"> לגדול ב 37 מעלות צלזיוס במשך שעה 1 בתוף הרים. </li><li style=";text-align:right;direction:rtl"> מורחים 100-200 תאי μl לLB + AMP צלחת (100 מיקרוגרם / מיליליטר) ו דגירה הלילה. </li><li style=";text-align:right;direction:rtl"> תתבגר E. coli בLB + AMP-DNA פלסמיד הנוזלי והקציר. רצף לאמת פלסמיד כתב החדש ממושבות קשירה באמצעות פריימר 5&#39;-GTACCTTATATTGAATTTTC-3 &quot;. </li><li style=";text-align:right;direction:rtl"> להפוך פלסמיד כתב החדש לשמרים str המכיל ATFעין מסעיף 1 באמצעות שינוי ליתיום אצטט. </li></ol> 3. לכמת את ההשפעה של ATF אינדוקציה על ביטוי גנים בעזרת ה-GFP כתב הכנת הדגימות: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הפוך 25 מ&quot;מ מניית β-אסטרדיול (10 מיליליטר של אתנול + .0681 גרם של β-אסטרדיול). לשמור בקירור. </li><li style=";text-align:right;direction:rtl"> לגדול ATF + כתב המכיל זן הלילה בSC-URA 5 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> השג תשעה 250 מיליליטר לנער צלוחיות ולהוסיף 25 מיליליטר SC-URA לכל אחד. </li><li style=";text-align:right;direction:rtl"> הוסף 0 ננומטר, 0.1 ננומטר, 1 ננומטר, 10 ננומטר, 100 ננומטר, 1 מיקרומטר, או 10 β-אסטרדיול מיקרומטר. זה נעשה בקלות על ידי ביצוע דילולים סדרתי של פי 10 של מניית β-אסטרדיול 25 מ&quot;מ. לריכוז סופי של 10 β-אסטרדיול מיקרומטר, להוסיף 10 μl של מניית β-אסטרדיול 25 מ&quot;מ ל25 מיליליטר של SC-URA. </li><li style=";text-align:right;direction:rtl"> הוספת 125 μl של תרבויות לילה לצלוחיות (1:200 דילול). </li><li style=";text-align:right;direction:rtl"> ל2 צלוחיות הנותרות, לחסן עם strai GFP הפקה מכונןn ומתח חסר ה-GFP. אלו יש צורך בכיול cytometer את הזרימה. </li><li style=";text-align:right;direction:rtl"> לנער בסל&quot;ד 200 ב30 מעלות צלזיוס במשך שעה 12-18. הערה: זמן הדגירה האופטימלי נקבע על ידי זיהוי שינויים כאשר כבר לא האינדוקציה GFP הבאים תוספת של β-אסטרדיול. </li><li style=";text-align:right;direction:rtl"> קח 500 μl של כל תרבות וספין למטה בצינורות נפרדים microcentrifuge 1.7 מיליליטר. </li><li style=";text-align:right;direction:rtl"> לשאוב SC-URA. </li><li style=";text-align:right;direction:rtl"> לשטוף פעם ב 1 מיליליטר-20 Tween PBS +0.1% ולשאוב. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מיליליטר של-20 Tween PBS +0.1% ו resuspend. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מיליליטר של PBS Tween-20 +0.1% לצינורות פלקון. </li><li style=";text-align:right;direction:rtl"> מוסיף את תאי resuspended ל5 צינורות מיליליטר (נפח סופי = 2 מיליליטר) (יכול להיות מאוחסן על 4 מעלות צלזיוס במשך כמה ימים). </li><li style=";text-align:right;direction:rtl"> אופציונאלי: תאים בקלילות sonicate לפרידה כל תאים בכבדות. ניתוח תזרים cytometry: סקירה: הקרינה של 10,000-100,000 תאים מנותחות בדרך כלל לדגימה. ניתן לעבד נתונים או בFlowJo או באמצעות סקריפטים מותאמים אישית בMATLAB אור &#39;ודא לכייל מתח של ערוץ ה-GFP באמצעות בקרות חיוביות ושליליות ה-GFP. ברגע שקבצי FCS מיוצאים, תסריט כמו זה באיור 6 יחד עם fca_readfcs הפונקציה <a href="http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader">(http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader)</a> יכול לשמש כדי לעבד נתונים. </li><li style=";text-align:right;direction:rtl"> לבצע cytometry זרימה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> שימוש פיזור קדימה (FSC) ופיזור צד (SSC) לזהות תאי שמרים. </li><li style=";text-align:right;direction:rtl"> הגדר את קצב זרימה ל~ 3,000 תאים / sec. </li><li style=";text-align:right;direction:rtl"> מדוד GFP (ערוץ FITC). </li><li style=";text-align:right;direction:rtl"> ברגע שנתונים שנאספו, לייצא קבצים. FCS </li></ol></li><li style=";text-align:right;direction:rtl"> טען MATLAB. </li><li style=";text-align:right;direction:rtl"> להעביר את הקבצים. FCS, fcs_readfcs.m, ותסריט דומה לזה מהאיור 6 לאותה תיקייה. </li><li style=";text-align:right;direction:rtl"> לשנות את ספריית העבודה הנוכחית אל התיקייה המכילה את הנתונים ותסריטים. </li><li style=";text-align:right;direction:rtl"> להריץ את הסקריפט מהאיור 6 (שים לב:אגדה הוזנה באופן ידני כדי לייצר את מה שראה באיור 7). </li></ol> 4. לכמת את ההשפעה של ATF אינדוקציה על גדילה תא <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ממניות קפוא, פס את שני (1) מתח המכיל ATF ו (2) מתח חסר-ATF (כגון yMN15) על גבי צלחות YPD נפרדות. </li><li style=";text-align:right;direction:rtl"> אחרי 2 ימים של צמיחה, לחסן צינורות תרבות נפרדים המכילים 5 מיליליטר של נוזל YPD עם כל זן ולגדול בין לילה ב30 ° C. </li><li style=";text-align:right;direction:rtl"> בצע פי 10 דילולים סדרתי של פתרון 0.25 מ&quot;מ β-אסטרדיול המניה עד 10,000 פי (0.025 מיקרומטר β-אסטרדיול) ב100% אתנול. </li><li style=";text-align:right;direction:rtl"> הוסף 40 μl של תרבויות לילה ל10 מיליליטר של נוזל YPD (1-250 דילול). </li><li style=";text-align:right;direction:rtl"> עבור כל זן, להוסיף 96 μl של תאים בדילול מלא ל18 בארות של צלחת 96 היטב. </li><li style=";text-align:right;direction:rtl"> הוסף 4 μl של β-אסטרדיול לתאים. נקודה מהותית היא לוודא שיש לו כל טוב באותה הכמות של אתנול בסך הכל. (לחלופין, מו<html> מחדש המניה מרוכזת של β-אסטרדיול יכולה לשמש ולאחר מכן מדוללת לנקודת ההשפעה של אתנול על צמיחה היא לא ניתנת למדידה). </li><li style=";text-align:right;direction:rtl"> לבצע בשלושה עותקים. שלוש הבארות עבור כל זן צריכים להיות אתנול בלבד פקדים. </li><li style=";text-align:right;direction:rtl"> מכסה את צלחת 96 היטב בקרום חדיר גז. </li><li style=";text-align:right;direction:rtl"> לפקח על גדילה (OD 600) בצלחת קורא. </li><li style=";text-align:right;direction:rtl"> לכמת את שיעורי הצמיחה באמצעות מספר רב של שיטות סטנדרטיות כגון מציאת השיפוע המרבי. שים לב: יש לנו הצלחה טובה עם גרופית הקוד הפתוח חבילת תוכנת 14, אשר פועלת בסביבת תכנות R ראוי להזכיר שבזמן ששיעורי צמיחה מחושבים ממבחני צלחת 96 היטב בהשוואה לנער-צלוחיות (25 מיליליטר תרבויות). הם אינם בהכרח זהים (הן בשל ההבדלים בפיזיולוגיה ובמכשור), אנחנו כבר ציינו כי שיעורי הצמיחה היחסי דומים (אם כי זה לא תמיד המקרה). </li></ol>ייתכנו &quot;&gt; 5. יצירת אללים הגנום עין מתנהל <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השג pMN10, פלסמיד noncentromeric עם אמרגן ATF מגיב מpMN8 התמזגו KanMX (בכיוון ההפוך). </li><li style=";text-align:right;direction:rtl"> הגבלה לעכל את עמוד השדרה וקטורית ותמצית ג&#39;ל כמו בסעיף 2. </li><li style=";text-align:right;direction:rtl"> לחשל, phosphorylate, וoligos לקשור המכיל אתרי קישור מתאימים כפי שתואר בסעיף 2. </li><li style=";text-align:right;direction:rtl"> רצף לאמת. פלסמיד עכשיו זה יהיה לשמש כתבנית ליצירת ה-DNA אלל מושרה. </li><li style=";text-align:right;direction:rtl"> השג את זן שמרים המבטא את ATF המקביל של ריבית. </li><li style=";text-align:right;direction:rtl"> PCR להגביר את קלטת KanMX-יזם (~ 2 קילו) באמצעות פריימרים מטבלה 6. </li><li style=";text-align:right;direction:rtl"> להפוך את המוצר ה-PCR למתח-להביע ATF בשיטה אצטט ליתיום. </li><li style=";text-align:right;direction:rtl"> צלחת על YPD וצלחת העתק אל YPD + G418 ביום המחרת. </li><li style=";text-align:right;direction:rtl"> לאשר כניסה מתאימה של האמרגן באמצעות פריימר קדימה (5&#39;-CTGCAGCGAGGAGCCGTAAT-3 &quot;) והפוך פנימי פריימר הגן דואר האמרגן שהוחלף. פריימר ההפוכה מיועדת בדרך כלל להיות בין 200-300 נ&quot;ב במורד הזרם של 15 ATG הראשון. מוצר ה-PCR הסופי הוא ~ 1.2 kb. </li></ol>

<ol>
	<li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic acids res. 41, e57 (2013).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast-acting+and+nearly+gratuitous+induction+of+gene+expression+and+protein+depletion+in+Saccharomyces+cerevisiae.">Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae.</a> Mol. Biol. cell. 22, 4447-4459 (2011).</li><li>Louvion, J. F., Havaux-Copf, B., Picard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+of+GAL4-VP16+to+a+steroid-binding+domain+provides+a+tool+for+gratuitous+induction+of+galactose-responsive+genes+in+yeast.">Fusion of GAL4-VP16 to a steroid-binding domain provides a tool for gratuitous induction of galactose-responsive genes in yeast.</a> Gene. 131, 129-134 (1993).</li><li>Littlewood, T. D., Hancock, D. C., Danielian, P. S., Parker, M. G., Evan, G. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+oestrogen+receptor+ligand-binding+domain+as+an+improved+switch+for+the+regulation+of+heterologous+proteins.">A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins.</a> Nucleic acids res. 23, 1686-1690 (1995).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+Analysis+of+mRNA+Molecules+Using+Fluorescence+In+Situ+Hybridization+in+Saccharomyces+cerevisiae.">Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae.</a> J. Vis. Exp. (76), e50382 (2013).</li><li>McIsaac, R. S., Petti, A. A., Bussemaker, H. J., Botstein, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perturbation-based+analysis+and+modeling+of+combinatorial+regulation+in+the+yeast+sulfur+assimilation+pathway.">Perturbation-based analysis and modeling of combinatorial regulation in the yeast sulfur assimilation pathway.</a> Mol. Biol. cell. 23, 2993-3007 (2012).</li><li>Belli, G., Gari, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic acids res. 26, 942-947 (1998).</li><li>Baron, U., Bujard, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tet+repressor-based+system+for+regulated+gene+expression+in+eukaryotic+cells:+principles+and+advances.">Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances.</a> Meth. Enzymol. 327, 401-421 (2000).</li><li>Kodama, S., Okada, K., Akimoto, K., Inui, H., Ohkawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+aryl+hydrocarbon+receptors+for+bioassay+of+aryl+hydrocarbon+receptor+ligands+in+transgenic+tobacco+plants.">Recombinant aryl hydrocarbon receptors for bioassay of aryl hydrocarbon receptor ligands in transgenic tobacco plants.</a> Plant Biotechnol. J. 7, 119-128 (2009).</li><li>Hickman, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+regulation+of+sulfur+and+phospholipid+metabolism+reflects+the+importance+of+methylation+in+the+growth+of+yeast.">Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.</a> Mol. Biol. cell. 22, 4192-4204 (2011).</li><li>Taxis, C., Stier, G., Spadaccini, R., Knop, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+protein+depletion+by+genetically+controlled+deprotection+of+a+dormant+N-degron.">Efficient protein depletion by genetically controlled deprotection of a dormant N-degron.</a> Mol. Syst. Biol. 5, 267 (2009).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nat. methods. 6, 917-922 (2009).</li><li>Burke, D. J., Amberg, D. C., Strathern, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. , (2005).</li><li>Kahm, M., Hasenbrink, G., Lichtenberg-Frate, H., Ludwig, J., Kschischo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=grofit:+Fitting+Biological+Growth+Curves+with+R.">grofit: Fitting Biological Growth Curves with R.</a> J. Stat. Softw. 33, 1-21 (2010).</li><li>Rozen, S., Skaletsky, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer3+on+the+WWW+for+general+users+and+for+biologist+programmers.">Primer3 on the WWW for general users and for biologist programmers.</a> Methods Mol. Biol. 132, 365-386 (2000).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150, 647-658 (2012).</li><li>Chockalingam, K., Chen, Z., Katzenellenbogen, J. A., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+specific+receptor-ligand+pairs+for+use+in+the+creation+of+gene+switches.">Directed evolution of specific receptor-ligand pairs for use in the creation of gene switches.</a> Proceedings of the National Academy of Sciences of the United States of America. 102, 5691-5696 (2005).</li><li>McLachlan, M. J., Chockalingam, K., Lai, K. C., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+orthogonal+ligand+specificity+in+a+single+scaffold.">Directed evolution of orthogonal ligand specificity in a single scaffold.</a> Angewandte Chemie. 48, 7783-7786 (2009).</li><li>Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., Tyers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+pathways+that+couple+cell+growth+and+division+in+yeast.">Systematic identification of pathways that couple cell growth and division in yeast.</a> Science. 297, 395-400 (2002).</li><li>Sopko, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+pathways+and+phenotypes+by+systematic+gene+overexpression.">Mapping pathways and phenotypes by systematic gene overexpression.</a> Mol. cell. 21, 319-330 (2006).</li><li>Shimizu-Sato, S., Huq, E., Tepperman, J. M., Quail, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+light-switchable+gene+promoter+system.">A light-switchable gene promoter system.</a> Nat. biotechnol. 20, 1041-1044 (2002).</li><li>Polstein, L. R., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Light-inducible+spatiotemporal+control+of+gene+activation+by+customizable+zinc+finger+transcription+factors.">Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors.</a> J. Am. Chem. Soc. 134, 16480-16483 (2012).</li><li>Losi, A., Gartner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Old+chromophores,+new+photoactivation+paradigms,+trendy+applications:+flavins+in+blue+light-sensing+photoreceptors.">Old chromophores, new photoactivation paradigms, trendy applications: flavins in blue light-sensing photoreceptors.</a> Photochem. Photobiol. 87, 491-510 (2011).</li><li>Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond-timescale,+genetically+targeted+optical+control+of+neural+activity.">Millisecond-timescale, genetically targeted optical control of neural activity.</a> Nat. Neurosci. 8, 1263-1268 (2005).</li><li>Gradinaru, V., Mogri, M., Thompson, K. R., Henderson, J. M., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+deconstruction+of+parkinsonian+neural+circuitry.">Optical deconstruction of parkinsonian neural circuitry.</a> Science. 324, 354-359 (2009).</li><li>Milias-Argeitis, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+silico+feedback+for+in+vivo+regulation+of+a+gene+expression+circuit.">In silico feedback for in vivo regulation of a gene expression circuit.</a> Nat. biotechnol. 29, 1114-1116 (2011).</li></ol>

McIsaac, נויס, ווטשטיין (עם אחרים) הגישו חלק ממערכת זו כגילוי פטנטים.

יש המתגים המבוסס על ההורמון המתואר כאן יישומים רבים, מלימוד ביולוגיה של תא יליד בודק את יכולתו של תחום מחייב-DNA של עניין למקד רצף ה-DNA בגוף חי. המערכת כוללת תכונות רצויות רבות, כולל תגובה מדורגת למשדל, פעולה מהירה, ורגולציה הדוקה (כלומר. אין דליפות למדידה, ראה איור 7). עם זאת, יש עדיין מקום לשיפור והתרחבות. מחקר שנערך לאחרונה בביולוגיה סינתטית הדגיש מערכות סינתטיות ריבוב והרחבת הרפרטואר של מאופיין היטב חלקי DNA הניתנים לתכנות, 16. ביטוי עצמאי, מותנה של גנים המטרה שונים דורש גם מעוררים מרובים ותחומים מחייבים DNA כי חוסר הספציפיות חופפות. הזמינות של הקולטנים מהונדסים וטבעיים מספקת קבוצה גדולה של חלקים שבה לפתח את גורמי שעתוק מלאכותי חדשים. הרחבתרפרטואר של מתגי אורתוגונליים הדדית כבר סייע במידה רבה על ידי אבולוציה מכוונת גישות 17,18. מאמצים הנוכחיים כדי לתכנת מחדש את הספציפיות מחייב ליגנד של גורמי השעתוק המלאכותי שלנו יוצגו בעתיד. בעבר, את ההשלכות פנוטיפי של מחיקה / ביטוי יתר גן נחקרו רבות בשמרים 19,20. עם זאת, זה לא היה פשוט ללמוד את ההשפעה של ביטוי בפנוטיפים שונים על פני טווח של רמות ביטוי. תכונה העיקרית של מערכת המוצגת כאן היא הטבע מדורג שלה (איור 8). אמנם לעתים קרובות להניח, את הקשר בין ביטוי גנים ופנוטיפים של עניין לא בהכרח מונוטונית. גורמי שעתוק מלאכותיים כגון Z 3 EV ו-Z 4 EV יהפכו את המשימה שלו מנסה לאמוד את התגובות פנוטיפי לשינויים בביטוי גנים פשוטים. לבסוף, הפרוטוקולים לדוןדעה בכתב יד זה הוא להנדסה ואפיון גורמי שעתוק מלאכותיים המגיבים לβ-אסטרדיול, עם זאת, אלטרנטיבה חשובה לתחומים כימי תגובה הוא השימוש בתחומי אור תגובה (כגון PhyB/Pif3, LOV, וBLUF), שפעילותו הן הפיכה מבלי להפריע מדיום גידול תרבות 21-23. מערכות מבוססות אור להקל על שליטת spatiotemporal של ביטוי גנים, חלבונים אינטראקציות, הובלת יונים, ופעילות האנזימטית, שכבר הוכיחו את העוצמה 21-26. לסיכום, יש לנו הציגו שיטות לבנייה המהירה של גורמי שעתוק מושרה, מלאכותיים בשמרים. פרוטוקול זה מספק תבנית לבנייה שלהם בשיתוף עם כתבי ה-GFP מאותו מקור, כמו גם שיטות לניתוח נתוני הכתב באמצעות cytometry זרימה ומנסה לאמוד את ההשפעה של הפעלת ATF על צמיחה.

פיתוח מתגים גנטיים בשמרים הוא עניין רב במחקר אקדמי ותעשייתי. במקרה האידיאלי, ניתן להשתמש במתגים גנטיים כדי להפעיל את גן מסוים (או קבוצה של גנים) רק בעת צורך על ידי הנסיין. רצף הקידוד של גן ממוקם במורד הזרם של אמרגן סינטטי לא בא לידי ביטוי בהעדר מולקולת התרמה: על בנוסף inducer הגן צריך לבוא לידי ביטוי במהירות. רק לאחרונה זה כבר הוכיח כי מתג כזה יכול להיות מהונדס בשמרים, שבו בהיעדרו של משדל, את המתח מציג פנוטיפ מחיקה, אבל בנוכחות של משדל, ביטוי מופעל באופן יחסי לרמה של משדל בכל התאים 1,2. מבחינה היסטורית, מערכות ביטוי תנאי בשמרים יש לסמוך במידה רבה על רצפי DNA תזונתיים מגיב, כוללים MET, PHO, ויזמי גל (שפעילותם רגישות לרמות תאיים של מתיונין, פוספט, וגלקטוז, בהתאמה). בעוד ניתן להשיג ביטוי תנאי, זה מגיע במחיר של תופעות pleiotropic משמעותיות. קולטני הורמון כגון קולטני אסטרוגן האנושי הוכיחו להיות מתגים יעילים באאוקריוטים 3,4. בהעדר ההורמון, חלבון התמזגו לקולטן הורמון יכול להיות מוחרם בציטופלסמה שבה הוא מקיים אינטראקציה עם מורכב מלווה Hsp90. על כריכת ליגנד המתאים, קולט עובר שינוי קונפורמציה, גורם לו להשתחרר ממורכב מלווה Hsp90 וחושף אות לוקליזציה גרעינית. כדי לבחון את דינמיקת הלוקליזציה של חלבון המכיל קולטן הורמון מסוים, יצרנו היתוך בטרמינל C-של Gal4dbd.ER.VP16 (GeV, גורם שעתוק סינטטי המכילים תחום מחייב Gal4p DNA, תחום מחייב יגנד של קולטן אסטרוגן האנושי , וVP16) עם GFP 2. לוקליזציה גרעינית נצפתה בתוך 8 דקות הבאות תוספת שללהרוות כמויות של המשדל, SS-אסטרדיול, כדי ששמרים מסוג בר הוא אינרטי לחלוטין. בשלב זה, רוב התאים באתרים נראים בבירור פעילים שעתוק לגני מטרת GeV (assayed באמצעות הקרינה הכלאה באתר), כמו גם mRNAs בגרות מלא 2,5. גנים מטרת GeV מוגברים בביטוי&gt; פי 2 בתוך 2.5 דקות 2,6 (נמדד באמצעות microarrays), הוכחת כי זה לוקח &lt;2.5 דקות לactivator chimeric לtranslocate לגרעין, נקשרים ה-DNA, ולהפעיל שעתוק. בעוד כמה אחרים במתגים יושמו בשמרים לנצל מולקולות שונות קטנות או תרופות (כולל המתגים הקלאסיים מבוסס דוקסיציקלין מEscherichia coli 7,8 ומתג מבוסס אינדיגו 9 מthaliana ארבידופסיס), אף השיגו את המהירות, סגוליות, או אטימות של רגולציה הוצגו על ידי המתגים המבוסס על ההורמון. ראוי להזכיר tכובע מהיר מחוץ למתגים יש גם פותחו בשמרים, ובדרך כלל עובד על ידי פיוזינג גן לפרוטאז או האנזים היוביקוויטין מיקוד רצף 2,10,11,12. היכולת להסיר במהירות חלבון מטרה מהתא מאפשרת המחקר של גנים חיוניים, כמו גם גנים שנוטים לדיכוי גנטי כאשר נמחקו 10. השיטות שתוארו בפרוטוקול זה הן לבנייה ואפיון סינטטי על מתגים בשמרים. ראשית, אנו מראים כיצד ליצור במהירות חלבוני היתוך genomically משולב המורכב מתחום מחייב-DNA של עניין, ליגנד מחייב תחום של קולטן אסטרוגן האנושי, וVP16 (DBD-EV של). בעקבות הפרוטוקול שלנו, חלבון ההיתוך בא לידי ביטוי מאמרגן ACT1. לאחר מכן, אנו מראים כיצד ליצור פלסמיד כתב מאותו מקור לATF ולבדוק את הפונקציונליות שלו באמצעות cytometry זרימה. למרות שאנו מדמיינים פלסמידים כתב אלה בשימוש עם ATFs החדש (איור 1), הם יכולים bדואר המשמש ככתבים לactivator תעתיק מקורי גם כן. לבסוף, את הפרטים לבדיקת ההשפעה של הפעלת ATF על צמיחת תאים בצלחות 96 היטב והנדסת אללים הגנומי מושרה מסופקים.

<table border="0" cellpadding="0" cellspacing="0" width="352">
	<colgroup>
		<col span="4" />
	</colgroup>
	<tbody>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Name of the Reagent</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments&#160;</td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Expand High Fidelity PCR System</td>
			<td style="width:88px;">Roche</td>
			<td style="width:88px;">11 732 650 001</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">T4 DNA Ligase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0202S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Competent E. coli</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">18258-012</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Estradiol</td>
			<td style="width:88px;">Tocris Biosciences</td>
			<td style="width:88px;">2824</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Ampicillin</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">BP1760-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">T4 Polynucleotide Kinase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0201</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">PBS</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">10010-23</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">Tween-20</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">9005-64-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">clonNAT</td>
			<td style="width:88px;">Jena Bioscience</td>
			<td style="width:88px;">AB-102L</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">XbaI</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R0145S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">NotI-HF</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R3189S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">CutSmart Buffer</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">B7204S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Glucose</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">D15-500</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Bacto-Peptone</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">211677</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Yeast Extract</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">210929</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Agarose</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">214010</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">100% Ethanol</td>
			<td style="width:88px;">Decon Laboratories</td>
			<td style="width:88px;">04-355-222</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">G418</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">11811-031</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:88px;">QIAGEN</td>
			<td style="width:88px;">27104</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Lithium acetate dihydrate</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">L-6883</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Salmon sperm DNA</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">93283</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">PEG 3350</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">P-3640</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plasmids pMN8 and pMN10; yeast strain yMN15</td>
			<td style="width:88px;">Noyes or Botstein labs</td>
			<td style="width:88px;"></td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Luria Broth</td>
			<td>Sigma-Aldrich</td>
			<td>L3397</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EQUIPMENT:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Material Name</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments (optional)</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">LSRII Flow Cyometer&#160;</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">Various Models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="103">
			<td height="103" style="height:103px;width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">Software for analyzing .FCS files from flow cytometry experiments</td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">R</td>
			<td style="width:88px;">Open Source</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">For analyzing growth-rate data from plate reader.&#160;</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Falcon Tubes</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">352052</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="52">
			<td height="52" style="height:52px;width:88px;">1.7 ml Eppendorf&#160; Tubes</td>
			<td style="width:88px;">GeneMate</td>
			<td style="width:88px;">C3262-1</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">250 ml Shake Flasks</td>
			<td style="width:88px;">Corning</td>
			<td style="width:88px;">4446-250</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">96-well, flat-bottom plates</td>
			<td style="width:88px;">Costar</td>
			<td style="width:88px;">3635</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plate Reader (Synergy H1 Multi-Mode Plate Reader)</td>
			<td style="width:88px;">BioTek</td>
			<td style="width:88px;">H1MG</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Breathe-Easy Membranes</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">Z380059-1PAK</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Thermocycler</td>
			<td style="width:88px;">various companies</td>
			<td style="width:88px;">Various models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">SC-Ura powder</td>
			<td style="width:88px;">MP Biomedicals</td>
			<td style="width:88px;">114410622</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">5-FOA</td>
			<td style="width:88px;">Zymo Research</td>
			<td style="width:88px;">F9001-1</td>
			<td style="width:88px;"></td>
		</tr>
	</tbody>
</table>

rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters

ביולוגיה סינתטית שואפת לעצב באופן רציונלי ולבנות מעגלים סינטטיים עם מאפייני כמותיים רצויים, כמו גם לספק כלים לחקור את המבנה של מעגלי שליטת ילידים. בשני המקרים, את היכולת לתכנת את ביטוי הגנים באופנה מהירה ומתכוננת, ללא תופעות מחוץ יעד, יכולה להיות שימושית. יש לנו נבנו זני שמרים המכילים במעלה הזרם אמרגן ACT1 של קלטת URA3 אחריו תחום מחייב ליגנד של קולטן אסטרוגן האנושי וVP16. על ידי הפיכת זן זה עם מוצר ליניארי PCR המכיל תחום ה-DNA מחייב ובחירה נגד הנוכחות של URA3, גורם הביע constitutively מלאכותי שעתוק (ATF) יכול להיווצר על ידי רקומבינציה הומולוגית. ATFs המהונדס בצורה זו ניתן להפעיל גן יעד ייחודי בנוכחות המשדל, ובכך למנוע גם את ההפעלה מחוץ היעד ותנאי גידול nonphysiological נמצאים עם מיזוג נפוץמערכות ביטוי גני onal. שיטה פשוטה לבנייה המהירה של פלסמידים כתב ה-GFP שמגיבים באופן ספציפי לגורם שעתוק ילידים מלאכותי או של עניין היא גם סיפקה.

<html> איור 5 מראה אינדוקציה של ה-GFP על ידי Z 3 EV, Z 4 EV, או גב לאורך זמן. שים לב לעלייה בייצור ה-GFP בתגובה לATFs מכיל DNA nonyeast מחייב תחומים. אנחנו העריכו לאחרונה כי זה נובע מגורמים הללו השגת סגוליות של גן יחיד בשמרי הגנום 1. אינדוקציה גב לבד מובילה להפעלה / דיכוי של מאות גנים, ואילו Z EV 3 ו-Z EV 4 להפעיל רק ביטוי של גן המטרה להציב במורד הזרם של אמרגן סינטטי המכיל אתרי קישור מתאימים (5&#39;-GCGTGGGCG-3 &quot;ו5&#39;- GCGGCGGAGGAG-3 &quot;, בהתאמה) 1. איור 7 ממחיש את הרגולציה ההדוקה של המערכת (אין תוצאות inducer בשום GFP לזיהוי), וכי כל התאים מקבלים מושרה בתגובה למשדל היכולת של Z 3 EV כדי לגרום GFP על פני מגוון של ריכוזי β-אסטרדיול מוצגים באיור 8. <html> אף אוזן גרון &quot;עבור: לשמור-together.within-page =&quot; תמיד &quot;&gt; <img alt="איור 1" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig1highres.jpg" src="/files/ftp_upload/51153/51153fig1.jpg" /> איור 1. גורמי שעתוק מלאכותיים אינטראקציה עם Hsp90 בהעדר β-אסטרדיול. כאשר β-אסטרדיול נקשר ATF, Hsp90 dissociates, המאפשר ATF להיכנס לגרעין ולהפעיל את ביטוי מן כתב פלסמיד. <img alt="איור 2" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig2highres.jpg" src="/files/ftp_upload/51153/51153fig2.jpg" /> איור 2. סכמטי של פרוטוקול לזני הנדסה המכילים גורמי שעתוק מלאכותיים ובנייה / בדיקת כתבי ה-GFP מאותו מקור. &quot;Src =&quot; load/51153/51153fig3highres.jpg / files/ftp_upload/51153/51153fig3.jpg &quot;/&gt; איור 3. רצף ACT1pr-URA3-EV במתח yMN15 במוקד LEU2. <img alt="איור 4" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig4highres.jpg" src="/files/ftp_upload/51153/51153fig4.jpg" /> איור 4. עיצוב של primers PCR להגברת תחום מחייב-DNA של עניין עם הומולוגיה ברצף נוסף כדי לייצר חלבון היתוך חדש כאשר הפכו בהצלחה לyMN15. <img alt="איור 5" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig5highres.jpg" src="/files/ftp_upload/51153/51153fig5.jpg" /> איור 5. האינדוקציה ה-GFP על ידי שלושה זוגות ATF-אמרגן שונים בתגובה ל1 מיקרומטר β-אסטרדיול. &lt;/ P&gt; <img alt="איור 6" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig6highres.jpg" src="/files/ftp_upload/51153/51153fig6.jpg" /> איור 6. תסריט MATLAB לעיבוד זרימת cytometry נתונים. תסריט זה הותאם מ <a href="http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data">http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data.</a> <img alt="איור 7" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig7highres.jpg" src="/files/ftp_upload/51153/51153fig7.jpg" /> איור 7. אינדוקציה של ה-GFP על ידי Z EV 3 בתגובה ל0 μ M-β אסטרדיול ו1 מיקרומטר β-אסטרדיול הבא 18 שעות של אינדוקציה. הקרינה הייתה גם מאהנטול מתאים חסרי GFP כדי להמחיש את הרגולציה ההדוקה של מערכת EV Z 3. נתון זה נוצר באמצעות הקוד באיור 6. <img alt="איור 8" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig8highres.jpg" src="/files/ftp_upload/51153/51153fig8.jpg" /> איור 8. הקשר בין ריכוז משדל ופלט ביטוי הוא מדורג עם מקדם היל ~ 1. () הפצות של ביטוי ה-GFP כפונקציה של ריכוז β-אסטרדיול. (ב) הקרינה הממוצעת של ההפצות מ( א &#39;). הנתונים היו לנכון G הפונקציה (D) = D דקות G + (דקות המקסימום G-G) n / (K n + n D) כאשר D היא מינון β-אסטרדיול, דקות G ו-G מקסימום הם המינימום ו ערכי ה-GFP, מיל מקסימוםpectively, n הוא מקדם היל, ו-K הוא מינון β-אסטרדיול כי תשואות ½ (G המקסימום + G דקות). <table border="0" cellpadding="0" cellspacing="0" fo:keep-together.within-page="always" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> רצף oligonucleotide </td><td> שם </td></tr><tr><td> 5&#39;-TTGAAACCA AACTCGCCTCT-3 &quot; </td><td> DBD בדוק קדימה </td></tr><tr><td> 5&#39;-tccagagac ttcagggtgct-3 &quot; </td><td> בדוק היפוך DBD </td></tr></tbody></table> טבלת 1. צבעי יסוד למאשר היתוך נכון של DBD המעניין את הקולטן לאסטרוגן. פריימר קדימה הוא הומולוגי אמרגן ACT1 ופריימר ההפוכה היא הומולוגית לרצפטור אסטרוגן. לDBDs אופייני (~ 300 נ&quot;ב), המוצר ה-PCR הוא &lt;1.5 kb. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> רצף oligonucleotide </td><td> שם </td></tr><tr><td> 5&#39;-ggccgc ... אתר binging DBD ... t-3 &quot; </td><td> אוליגו למעלה </td></tr><tr><td> 5&#39;-ctaga ... אתר קישור ה-DNA הפוך ... GC-3 &quot; </td><td> אוליגו התחתון </td></tr><tr><td> 5&#39;-gcc gcGTGGGCG T GCGTGGGCG G G CGTGGGCG T GCGTGGGCG G GCGTG GGCG T GCGTGGGCG &#39;t-3 </td><td> אתרי קישור אוליגו למעלה + 6x Zif268 </td></tr><tr><td> 5&#39;-ctagaCGCCCACGCACGCCCACGCC CGCCCACGCACGCCCACGCCCGCC CACGCACGCCCACgc-3 &quot; </td><td> אתרי קישור אוליגו התחתון + 6x Zif268 </td></tr></tbody></table> טבלה 2. Tructure S של פריימרים ליצירת dsDNA המכיל אתרי קישור של עניין. כדי ליצור Z 3 אמרגן EV-תגובה, oligonucleotides אוליגו למעלה + 6x אתרי קישור Zif268 ואוליגו התחתון + 6x Zif268 עקידה הייתה בשימוש.רצפים ליצירת סככות DNA הנכונים הם באותיות קטנות. אתר Zif268 ההסכמה מחייב, GCGTGGGCG, הוא הדגיש באוליגו העליון. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> מגיב </td><td> הסכום </td></tr><tr><td> T4 Polynucleotide קינאז הצפת </td><td> 5 μl </td></tr><tr><td> T4 Polynucleotide קינאז (@ 10,000 יחידות / מיליליטר) </td><td> 1 μl </td></tr><tr><td> אוליגו למעלה (100 מיקרומטר) </td><td> 1.5 μl </td></tr><tr><td> אוליגו התחתון (100 מיקרומטר) </td><td> 1.5 μl </td></tr><tr><td> מים </td><td> 41 μl </td></tr></tbody></table> לוח 3. Phosphorylate ופריימרים לחשל בthermocycler באמצעות 50 μl של תגובה שתוארה לעיל. ישנם שני שלבי thermocycler. שלב 1: 37 מעלות צלזיוס 30 דקות (phosphorylate), ושלב 2: 95 ° שניות 30 C (להתפטר C ° 1 כל 30 שניות עד 4 ° C; לחשל). <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> מגיב </td><td> הסכום </td></tr><tr><td> XbaI </td><td> 1 μl </td></tr><tr><td> NotI-HF </td><td> 1 μl </td></tr><tr><td> פלסמיד דנ&quot;א </td><td> 5 μl (1-2 מיקרוגרם) </td></tr><tr><td> 10x Cut חכם הצפת </td><td> 5 μl </td></tr><tr><td> מים </td><td> 38 μl </td></tr></tbody></table> לוח 4. הגבלה לעכל של פלסמיד pMN8 עם XbaI וNotI. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr height="22" style="height:16.5pt"><td class="xl65" height="22" style="height:16.5pt;width:66pt" width="88"> מגיב </td><td class="xl66" style="width:66pt" width="88"> הסכום </td></tr><tr height="43" style="height:32.25pt"><td> T4 האנזים buffer </td><td> 2 μl </td></tr><tr height="22" style="height:16.5pt"><td> T4 אנזים </td><td> 0.2 μl </td></tr><tr height="43" style="height:32.25pt"><td> עמוד השדרה @ 10 ng / μl </td><td> 1 μl </td></tr><tr height="106" style="height:79.5pt"><td> רצפי העקידה @ ריכוז / μl טוחנת 5x </td><td> 1 μl </td></tr><tr height="22" style="height:16.5pt"><td> מים </td><td> 15.8 μl </td></tr></tbody></table> לוח 5. ולקשור אתרי קישור לפלסמיד דנ&quot;א. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> תחל </td><td> תיאור </td></tr><tr><td> ~ 40 נ&quot;ב במעלה הזרם של ATG + &#39;CGCACTTAACTTCGCATCTG-3 </td><td> פריימר קדימה להגברת KanMX-יזם </td></tr><tr><td> 5&#39;-הפוך משלימים (ATG + ~ 37bp) + TATAGTTTTTTCTCCTTGACG-3 &quot; </td><td> הפוך פריmer להגברת KanMX-יזם </td></tr><tr><td> 5&#39;-caatttgtctgctcaagaaaataaa ttaaatacaaataaaCGCAC TTAACTTCGCATCTG-3 &quot; </td><td> פריימר קדימה לביצוע החלפת אמרגן GCN4. </td></tr><tr><td> 5&#39;-tggatttaaagcaaataaacttgg ctgatattcggacatTATAGTT TTTTCTCCTTGACG-3 &quot; </td><td> הפוך פריימר לביצוע החלפת אמרגן GCN4. </td></tr></tbody></table> לוח 6. PCR להגביר KanMX-יזם לביצוע אלל titratible.

Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

פרוטוקול זה מתאר הליך ניסיוני לבנייה המהירה של גורמי שעתוק מלאכותיים (ATFs) עם כתבי ה-GFP מאותו מקור וכימות של יכולת ATFs כדי לעורר ביטוי של GFP באמצעות cytometry זרימה.

סינתזה והקרנה של גורמי שעתוק הופעל כימי עם כתבים המבוסס על ה-GFP מהיר

Synthetic biology aims to rationally design and build synthetic circuits with desired quantitative properties, as well as provide tools to interrogate the ...

rapid-synthesis-screening-chemically-activated-transcription-factors

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 1

Transcription: DNA to RNA

SCIENTISTS IN ACTION

14.4K Views.  Princeton University.  פרוטוקול זה מתאר הליך ניסיוני לבנייה המהירה של גורמי שעתוק מלאכותיים (ATFs) עם כתבי ה-GFP מאותו מקור וכימות של יכולת ATFs כדי לעורר ביטוי של GFP באמצעות cytometry זרימה. 

Video: Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Generation of Human CD40-activated B cells

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer immunotherapy 1-3. Compared to Dendritic cells (DCs), the best characterized APC, CD40-B cells have several distinct biological and technical properties. Similar to DCs, B cells show an increased expression of MHC and co-stimulatory molecules (Fig.1b), exhibit a strong migratory capacity and present antigen presentation efficiently to T cells, after stimulation with interleukin-4 and CD40 ligand (CD40L). However, in contrast to immature or mature DCs, CD40-B cells express the full lymph node homing triad consisting of CD62L, CCR7/CXCR4, and leukocyte function antigen-1 (LFA1, CD11a/CD18), necessary for homing to secondary lymphoid organs (Fig.1a) 3. CD40-B cells can be generated without difficulties from very small amounts of peripheral blood which can be further expanded in vitro to very large amounts of highly-pure CD40-B cells (&gt;109 cells per patient) from healthy donors as well as cancer patients (Fig.1c,d) 1,4. 
In this protocol we demonstrate how to obtain fully activated CD40-B cells from human PBMC. Key molecules for the cell culture are CD40 ligand, interleukin-4 (IL-4) and cyclosporin A (CsA), which are replenished in a 3-4 day culture cycle. For laboratory purposes CD40-stimulation is provided by NIH/3T3 cells expressing recombinant human CD40 ligand (tCD40L NIH/3T3) 5. To avoid contamination with non-transfected cells, expression of the human CD40 ligand on the transfectants has to be checked regularly (Fig.2). 
After 14 days CD40-B cell cultures consist of more than 95% pure B cells and an expansion of CD40-B cells over 65 days is frequently possible without any loss of function 1, 4. CD40-B cells efficiently take up, process and present antigens to T cells 6. They do not only prime na&#970;ve, but also expand memory T cells 7,8. CD40-activated B cells can be used to study B-cell activation, differentiation and function. Moreover, they represent a promising tool for therapeutic or preventive vaccination against tumors 9.

In this video we present the ex vivo generation and expansion of human CD40-activated B cells (CD40-B) from peripheral blood mononuclear cells (PBMC) by stimulation with CD40 ligand and interleukin-4.

הדור של האדם CD40 בתאי B המופעל

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer ...

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

מיון פלואורסצנטי תא פעיל של Protoplasts הצמח

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes. However, many compounds identified in screens using cell culture models are often found to be toxic or pharmacologically inactive in vivo1-2. Screening in whole animal models can help avoid these pitfalls and streamline the path to drug development.
C. elegans is a multicellular model organism well suited for HTS. It is small (&lt;1 mm) and can be economically cultured and dispensed in liquids. C. elegans is also one of the most experimentally tractable animal models permitting rapid and detailed identification of drug mode-of-action3.
We describe a protocol for culturing and dispensing fluorescent strains of C. elegans for high-throughput screening of chemical libraries or detection of environmental contaminants that alter the expression of a specific gene. Large numbers of developmentally synchronized worms are grown in liquid culture, harvested, washed, and suspended at a defined density. Worms are then added to black, flat-bottomed 384-well plates using a peristaltic liquid dispenser. Small molecules from a chemical library or test samples (e.g., water, food, or soil) can be added to wells with worms. In vivo, real-time fluorescence intensity is measured with a fluorescence microplate reader. This method can be adapted to any inducible gene in C. elegans for which a suitable reporter is available. Many inducible stress and developmental transcriptional pathways are well defined in C. elegans and GFP transgenic reporter strains already exist for many of them4. When combined with the appropriate transgenic reporters, our method can be used to screen for pathway modulators or to develop robust biosensor assays for environmental contaminants. 
We demonstrate our C. elegans culture and dispensing protocol with an HTS assay we developed to monitor the C. elegans cap &#x2018;n&#x2019; collar transcription factor SKN-1. SKN-1 and its mammalian homologue Nrf2 activate cytoprotective genes during oxidative and xenobiotic stress5-10. Nrf2 protects mammals from numerous age-related disorders such as cancer, neurodegeneration, and chronic inflammation and has become a major chemotherapeutic target11-13.Our assay is based on a GFP transgenic reporter for the SKN-1 target gene gst-414, which encodes a glutathione-s transferase6. The gst-4 reporter is also a biosensor for xenobiotic and oxidative chemicals that activate SKN-1 and can be used to detect low levels of contaminants such as acrylamide and methyl-mercury15-16.

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

A procedure for liquid-based culturing and dispensing of C. elegans strains expressing fluorescent reporter proteins is described that does not require expensive sorting equipment. This approach can be applied to numerous inducible C. elegans genes for drug discovery or biosensing of contaminants.

תפוקה גבוהה הקרנת ו biosensing עם פלורסנט ג elegans מתחים

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron (dgn)-destabilized Green Fluorescent Protein (GFP)-based Reporter Protein

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. Maintenance of proteasome activity was implicated in many key cellular processes, like cell's stress response 3, cell cycle regulation and cellular differentiation 4 or in immune system response 5. The dysfunction of the ubiquitin-proteasome system has been related to the development of tumors and neurodegenerative diseases 4, 6. Additionally, a decrease in proteasome activity was found as a feature of cellular senescence and organismal aging 7, 8, 9, 10. Here, we present a method to measure ubiquitin-proteasome activity in living cells using a GFP-dgn fusion protein. To be able to monitor ubiquitin-proteasome activity in living primary cells, complementary DNA constructs coding for a green fluorescent protein (GFP)&#x2013;dgn fusion protein (GFP&#x2013;dgn, unstable) and a variant carrying a frameshift mutation (GFP&#x2013;dgnFS, stable 11) are inserted in lentiviral expression vectors. We prefer this technique over traditional transfection techniques because it guarantees a very high transfection efficiency independent of the cell type or the age of the donor. The difference between fluorescence displayed by the GFP&#x2013;dgnFS (stable) protein and the destabilized protein (GFP-dgn) in the absence or presence of proteasome inhibitor can be used to estimate ubiquitin-proteasome activity in each particular cell strain. These differences can be monitored by epifluorescence microscopy or can be measured by flow cytometry.

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron dgn-destabilized Green Fluorescent Protein GFP-based Reporter Protein

A method to monitor ubiquitin-proteasome activity in living cells is described. A degron-destabilized GFP- (GFP-dgn) and a stable GFP-dgnFS fusion protein are generated and transduced into the cell using a lentiviral expression vector. This technique allows to generate a stable GFP-dgn/GFP-dgnFS expressing cell line in which ubiquitin-proteasome activity can be easily assessed using epifluorescence or flow cytometry.

ניטור של פעילות יוביקוויטין-הפרוטאזום בתאי חיים באמצעות ערער-חלבון Degron (DGN) ירוק פלורסנט חלבון (GFP)-מבוסס כתב

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. ...

Synthesis of Nine-atom Deltahedral Zintl Ions of Germanium and their Functionalization with Organic Groups

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 Their redox chemistry is even younger, just about ten years old, but despite this short history these deltahedral clusters ions E9n- (E = Si, Ge, Sn, Pb; n = 2, 3, 4) have already shown interesting and diverse reactivity and have been at the forefront of rapidly developing and exciting new chemistry.3-6 Notable milestones are the oxidative coupling of Ge94- clusters to oligomers and infinite chains,7-19 their metallation,14-16,20-25 capping by transition-metal organometallic fragments,26-34 insertion of a transition-metal atom at the center of the cluster which is sometimes combined with capping and oligomerization,35-47 addition of main-group organometallic fragments as exo-bonded substituents,48-50 and functionalization with various organic residues by reactions with organic halides and alkynes.51-58 
This latter development of attaching organic fragments directly to the clusters has opened up a new field, namely organo-Zintl chemistry, that is potentially fertile for further synthetic explorations, and it is the step-by-step procedure for the synthesis of germanium-divinyl clusters described herein. The initial steps outline the synthesis of an intermetallic precursor of K4Ge9 from which the Ge94- clusters are extracted later in solution. This involves fused-silica glass blowing, arc-welding of niobium containers, and handling of highly air-sensitive materials in a glove box. The air-sensitive K4Ge9 is then dissolved in ethylenediamine in the box and then alkenylated by a reaction with Me3SiC&equiv;CSiMe3. The reaction is followed by electrospray mass spectrometry while the resulting solution is used for obtaining single crystals containing the functionalized clusters [H2C=CH-Ge9-CH=CH2]2-. For this purpose the solution is centrifuged, filtered, and carefully layered with a toluene solution of 18-crown-6. Left undisturbed for a few days, the so-layered solutions produced orange crystalline blocks of [K(18-crown-6)]2[Ge9(HCCH2)2]&bull;en which were characterized by single-crystal X-ray diffraction. 
The process highlights standard reaction techniques, work-up, and analysis towards functionalized deltahedral Zintl clusters. It is hoped that it will help towards further development and understanding of these compounds in the community at large.

We present the high-temperature synthesis of intermetallic precursors K4Ge9, their dissolution in ethylenediamine to form Ge94- deltahedral Zintl ions, and the reaction of the clusters with alkynes to form organo-Zintl ions. The latter are characterized by electrospray mass spectrometry in solutions and by single-crystal X-ray diffraction in the solid state.

סינתזה של לתשעה אטום יונים Zintl Deltahedral של גרמניום functionalization שלהם עם קבוצות אורגניים

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. 
Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. 
We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video.

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) is a method for de novo detection of chromatin interactions, for better understanding of transcriptional control.

הכרומטין ניתוח אינטראקציה עם מנבא סוף תג הרצף (Chia-PET) עבור מיפוי אינטראקציות הכרומטין הבנת תקנה תמלול

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by secreting metabolites. These metabolites have the potential to modulate the physiology and differentiation of their microbial neighbors and are likely important factors in the establishment and maintenance of complex microbial communities. We have developed a fluorescence-based coculture screen to identify such chemically mediated microbial interactions. The screen involves combining a fluorescent transcriptional reporter strain with environmental microbes on solid media and allowing the colonies to grow in coculture. The fluorescent transcriptional reporter is designed so that the chosen bacterial strain fluoresces when it is expressing a particular phenotype of interest (i.e. biofilm formation, sporulation, virulence factor production, etc.) Screening is performed under growth conditions where this phenotype is not expressed (and therefore the reporter strain is typically nonfluorescent). When an environmental microbe secretes a metabolite that activates this phenotype, it diffuses through the agar and activates the fluorescent reporter construct. This allows the inducing-metabolite-producing microbe to be detected: they are the nonfluorescent colonies most proximal to the fluorescent colonies. Thus, this screen allows the identification of environmental microbes that produce diffusible metabolites that activate a particular physiological response in a reporter strain. This publication discusses how to: a) select appropriate coculture screening conditions, b) prepare the reporter and environmental microbes for screening, c) perform the coculture screen, d) isolate putative inducing organisms, and e) confirm their activity in a secondary screen. We developed this method to screen for soil organisms that activate biofilm matrix-production in Bacillus subtilis; however, we also discuss considerations for applying this approach to other genetically tractable bacteria.

Bacteria produce secreted compounds that have the potential to affect the physiology of their microbial neighbors. Here we describe a coculture screen that allows detection of such chemically mediated interspecies interactions by mixing soil microbes with fluorescent transcriptional reporter strains of Bacillus subtilis on solid media.

שימוש Coculture לזהות אינטראקציות interspecies המתווכת כימית

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

מהירה ויעילה דג הזברה Genotyping באמצעות PCR עם רזולוציה גבוהה ממיסים ניתוח

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

הקרנת תפוקה גבוהה עבור כימית מאפננים של גני Post-תעתיק מוסדר

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder (ALLIGATOR)

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In circadian rhythms research, for example, clock gene fusions with firefly luciferase give rise to robust rhythms in cellular bioluminescence that persist over many days. Technical limitations associated with photomultiplier tubes (PMT) or conventional microscopy-based methods for bioluminescence quantification have typically demanded that cells and tissues be maintained under quite non-physiological conditions during recording, with a trade-off between sensitivity and throughput. Here, we report a refinement of prior methods that allows long-term bioluminescence imaging with high sensitivity and throughput which supports a broad range of culture conditions, including variable gas and humidity control, and that accepts many different tissue culture plates and dishes. This automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) also allows the observation of spatial variations in luciferase expression across a cell monolayer or tissue, which cannot readily be observed by traditional methods. We highlight how the ALLIGATOR provides vastly increased flexibility for the detection of luciferase activity when compared with existing methods.

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder ALLIGATOR

Genetically encoded luciferase is a popular non-invasive reporter of gene expression. Use of an automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) enables longitudinal recording from bioluminescent cells under a wide range of conditions. Here we show how ALLIGATOR may be used in the context of circadian rhythms research.