The authors have no acknowledgements.

1. תערובת Assay כן <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הפוך 100 μmol / L ריכוזי מניות לכל פריימרים במי כיתה מולקולריים בדיקות במאגר TE pH 8 [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. הערה: בדיקות עבור שתי המטרות מסומנות fluorescently עם 7 fluorophores השונים כמצוין רשימה של חומרים / ציוד. </li><li style=";text-align:right;direction:rtl"> הכינו תערובת אמן על ידי ערבוב, לכל תגובה מתוכננת, 12 μl דיגיטלי תמהיל PCR (2x המניות, ראה רשימה של חומרים / ציוד), 0.216 μl כל קדימה לאחור תחל, 0.06 μl כל בדיקה ניאון, ו 5.016 μl מים nuclease חינם (הריכוז הסופי : פריימר 900 ננומטר כל, 250 ננומטר כל בדיקה). פיפטה מעלה ומטה לפחות 10 פעמים כדי לערבב תוך זהירות שלא להכניס בועות אוויר בתמיסה. </li><li style=";text-align:right;direction:rtl"> פיפטה 18 μl תערובת אמן (משלב 1.2) לתוך צינור או צלחת PCR רגיל, ערבוב תבנית ה- DNA 6 μl (חילוץ כמתואר לשנים קודמותערמומי 13) לעשות תערובת assay עבור דור אגל. אם פועל דגימות בשני עותקים, pipet 36 μl של תמהיל מאסטר ו -12 תבנית ה- DNA μl לבאר כל אחד. השאר את הבארות לשכפל המקביל ריק על הצלחת. כלול בקרות חיוביות (ראה רשימה של חומרים / ציוד) ולא שולט תבנית (NTC) (כלומר עם מי כיתה מולקולריים משמשים תבנית). הערה: בקרה חיובית יש צורך להבטיח את assay פועל כראוי ואת NTC יש צורך להבטיח שאין זיהום בתוך הצלחת ולהגדרת בסיס הניאון בהמשך לניתוח נתונים. משתמשים פעם ראשונה מומלץ להשתמש בשתי דגימות DNA חי ומדולל. </li></ol> 2. דור אגל והגדרת פלייט PCR <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מערבבים את תערובת assay ידי pipetting למעלה למטה כ 15 פעמים באמצעות pipet הרב ערוצית. ודא קצה pipet נשאר בתוך נוזל, כדי למנוע עושה בועות עודפות בתוך התערובת. </li><li style=";text-align:right;direction:rtl"> insמחסנית ERT 1 (המכיל 8 בארות) לתוך בעל מחסנית לבן ולחץ על עצומות בעל מחסנית. מחסנית 1 כיום במקומו ולא ניתן וחילצה מבעל תוך יצירת טיפות. שימוש pipet הרב ערוצית, להעביר בעדינות 20 μl של תערובת assay לתוך האמצע של &quot;מדגם&quot; מסומן מחסנית ללא החדרת בועות אוויר. </li><li style=";text-align:right;direction:rtl"> Pipet ב 70 μl של שמן אגל דור אל הצד השמאלי של מחסנית (מסומן &#39;שמן&#39;). </li><li style=";text-align:right;direction:rtl"> מחסנית כיסוי עם אטם מוודא האטם הוא שטוח וקבע באופן שווה על ידי 4 קרציות לעבר קצה המחסנית. לחצו על הכפתור הירוק מואר על הגנרטור אגל לפתוח ולמקם את המחסנית. לחץ ירוק מואר הלחצן שוב כדי לסגור את הגנרטור. הערה: לאחר שהדלת נסגרת, הלחצן מעומעם, הדלת לא ניתן לפתוח מחדש ודור אגל מתחיל ממשיך מיד כ 1 דקות. </li><li style=";text-align:right;direction:rtl"> אם עושים יותר מ -8 תגובות, מחסנית מקום 2 תוך שנייהבעל מחסנית לבן ולהכין באותו אופן כמו מחסנית 1 ואילו דור האגל מתבצע כדי לחסוך זמן התקנה כולל. </li><li style=";text-align:right;direction:rtl"> פתח את דלת גנרטור אגל כאשר הכפתור מואר העמום הופך ירוק המציין השלים דור אגל. הסר את בעל מחסנית לבן המכיל מחסנית 1, להפריש, ומקום מחסנית 2 על גנרטור רביב. </li><li style=";text-align:right;direction:rtl"> הסר את האטם ממחסנית 1 וזורקים. בעדינות להעביר את הנפח הכולל (כ 40 μl) של טיפות שנוצרו מן בטור השלישי של המחסנית (מסומן &#39;טיפות&#39;) לצלחת PCR סופית (נשמרה בטמפרטורת חדר) עבור רכיבה תרמית. הערה: אל ובטל את בעל מחסנית הלבן כמו הפעולה עשוי לשבור את הטיפין החדשות שנוצרו באופן מלאכותי; רק לפתוח את בעל המחסנית אחרי הטיפין הועברו הצלחת הסופית. </li><li style=";text-align:right;direction:rtl"> חזור על שלבים 2.1-2.7 עבור דגימות נוספות. </li><li style=";text-align:right;direction:rtl"> כשכל הטיפין נמצאות צלחת PCR הסופית, להציב לנקבהכיסוי רדיד על גבי צלחת ומניחים אותו על אוטם צלחת. הגדר את האוטם ל -180 ° C, לחץ על &#39;Play&#39; על האוטם ולתת חותמים במשך 10 שניות. </li></ol> 3. רכיבה על אופניים תרמיים וקריאת האגל <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מניח את הצלחת האטומה על Cycler התרמית, אחד בקנה אחד עם צלחת PCR הסופית המשמשת בשלב 2.7, ומהירות ramping טמפרטורה של 2.0 מעלות צלזיוס / sec. </li><li style=";text-align:right;direction:rtl"> הפעל תכנית תרמית כדלקמן: 10 דקות ב 95 מעלות צלזיוס, ואחריו 40 מחזורים של 30 שניות על 94 מעלות צלזיוס ו -60 שניות על 60 מעלות צלזיוס, ואחריו להחזיק 10 דקות ב 98 ° C (אופציונאלי: עצירה סופית ב 4 או 15 ° C). </li><li style=";text-align:right;direction:rtl"> עם השלמת אופניים, להעביר את הצלחת לקורא אגל למדידה אוטומטית של קרינה בכל אגל בכל טוב. לחלופין, אחסן את הצלחת ב 4 מעלות צלזיוס למשך עד 3 ימים לפני קריאת רביב. ודא הטיפות הן בטמפרטורת החדר לפני שתמשיך עם הקריאה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פתח בתוכנה הנלווית התקנת קריאת רביב. בתפריט ברירת המחדל &#39;הגדרת&#39; המכיל סכמטי של צלחת ריקה 96 באר, לחץ לחיצה כפולה על כן A1 כדי לפתוח את התפריט המכיל שלושה חלקים: &quot;לדוגמא, &#39;&#39; Assay 1 &#39;ו&#39; Assay 2.&quot; </li><li style=";text-align:right;direction:rtl"> בקטע &#39;לדוגמא&#39; הקלד את מזהה המדגם לתוך התיבה שכותרתה &#39;שם&#39; ולחצו אנטר או לסמן את התיבה בצד ימין מסומן &#39;החל&#39;. לאחר מכן, לחץ הנפתח &#39;ניסוי&#39; שכותרתו תפריט ולבחור &quot;RED&quot; (זיהוי אירוע נדיר) ולחץ על Enter. </li><li style=";text-align:right;direction:rtl"> לעבור לקטע כונה &#39;Assay 1.&#39; בקטע &#39;שם&#39; למלא את assay (למשל אנטרוקוקוס) ולחץ על Enter. בתיבת הדו למטה תחת הכותרת &quot;סוג&quot; לחץ על התפריט הנפתח ובחר &#39;ערוץ 1 לא ידוע&#39; ולחץ על Enter. </li><li style=";text-align:right;direction:rtl"> לעבור לקטע כונה &#39;Assay 2. &quot; בקטע &#39;שם&#39; למלא את assay (למשל HF183) ולחץ על Enter. בתיבת הדו למטה תחת הכותרת &quot;סוג&quot; לחץ הנפתחת תפריטd לבחור &quot;ערוץ 2 לא ידוע &#39;ולחץ על Enter. כל המידע מן השלבים 3.3.2 עד 3.3.4 עכשיו להציג היטב A1. </li><li style=";text-align:right;direction:rtl"> שם כל הבארות הבאות המכילות טיפות. כדי לחסוך זמן התקנה כולל, לחץ על &#39;Shift&#39; או &#39;Ctrl&#39; לבחור בארות בו זמנית. </li><li style=";text-align:right;direction:rtl"> כאשר התיאור הדיגיטלי של צלחת מראות הצלחת הגופנית, לחץ על &#39;האישור&#39; בפינה הימנית התחתונה של התפריט. בתפריט החדש שמופיע בחלק העליון של סכמטית הצלחת, תחת הסעיף &#39;Template&#39; לבחור &#39;שמירה בשם&#39; ושם ולשמור הצלחת. </li><li style=";text-align:right;direction:rtl"> כדי השמאלי של המסך ולחץ על &#39;הפעל&#39; ובחר מתאים דיי סט ב-אאוט פופ &quot;הפעלת האפשרויות&quot; החלון. איסוף נתונים יוזם מוצג בזמן אמת בתוכנה. </li></ol></li></ol> 4. ניתוח נתונים ודיווח <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כאשר הקורא הוא סיים תופיע תיבה והצהירה &quot;מפעיל שלמים &#39;, לחץ על&#39; אישור &#39;. הערה: רכהכלי מציג את קובץ הנתונים הסופיים, בסעיף &#39;לנתח&#39; של התוכנה. לפי השקפה זו, התוכנה יש את כל הבארות בצלחת שנבחרו מחדל לעלילת הנתונים ד&#39;2 Amplitude &#39;. </li><li style=";text-align:right;direction:rtl"> בדוק את ההפרדה בין הטיפות חיוביות ושליליות. ודא כי הקרינה בכל טיפות בבארות NTC נמצאים בקרבת הבסיס. </li><li style=";text-align:right;direction:rtl"> הקישו על כפתור הנקרא &#39;אירועים&#39;. מהימין של ההיסטוגרמה הציג לחץ על התיבה בשם &#39;סה&quot;כ&#39; והתיבה בשם &quot;יחיד&quot; בתחתית כדי להציג את המספר הכולל של טיפות קבלו בכל טוב. אל תכלול כל בארות המכילות &lt;10,000 טיפות 7-ידי החזקת מקש Ctrl ולחיצה על הבאר (ים) כדי להיות שליליות. </li><li style=";text-align:right;direction:rtl"> לחץ על הכפתור המסומן כמו &#39;1D Amplitude&#39; כדי לקבוע את סף פלורסנט בכ סטיית תקן אחת (500-700 יחידות קרינה) מעל הטיפין השליליות בבארות NTC עבור מטרות שניהם. במקרה הטוב ביותר השמאלי של האו&quot;ם המסךדער את &#39;אוטומטי לנתח ו&quot;הראתה שני כפתורי סף, לבחור את הסמל בצד ימין כי יש קו אופקי ורוד מוצק רץ דרך אותה. </li><li style=";text-align:right;direction:rtl"> לחץ בתיבה מהשמאל &#39;קבע סף&#39; תחת כל הגרפים משרעת והזן את ערכי סף הקרינה המתאימים. ריכוזי היעד להעתיק לכל תגובת μl אז מחושבים באופן אוטומטי. הערה: ספי לא צריך להיות זהה עבור מטרות שונות. </li><li style=";text-align:right;direction:rtl"> לייצא את התוצאות לקובץ csv על ידי לחיצה על כפתור &quot;ייצוא&quot; בפינה השמאלית העליונה במסך 1D משרעת. בקובץ CSV, להכפיל את הריכוז היעד שמייצאת 4 להמיר אותו מעותק של היעד (23S הגן של spp אנטרוקוקוס. או על סמן HF183) לכל תגובה μl להעתיק של היעד לכל μl תבנית ה- DNA. </li></ol>

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

The authors declare that they have no competing financial interests.

ישנם כמה צעדים קריטיים בפרוטוקול. ראשית, ערבוב של תערובות assay יכול להיות קשה, כי את תערובת מאסטר היא צמיגה יותר מאשר תערובות מאסטר qPCR קונבנציונליות. vortexing פשוט עלול להוביל ערבוב מספיק, אשר בתורו מוביל הפצה לא אחידה של תבניות DNA של תערובות assay וכפועל יוצא מזה הטיפות. טכני...

PCR כמוני (qPCR) שיטות כבר בשימוש נרחב לניטור איכות מי פנאים ויישומי מעקב מקור חיידקים כי הם מהירים יותר, גמישים יותר ספציפיים בהשוואה לשיטות תרבות המבוססת מסורתיות. כתוצאה מכך, qPCR מומלץ להשגת תוצאות ניטור מים מהירות עבור אינדיקטורים צואתי כלליים כגון spp אנטרוקוקוס. בקריטריוני איכות מי פנאי מתוקן USEPA 1. מבחני qPCR רבים גם פותחו ומאומתים לזיהוי מקורות זיהום צואתי במי סביבת 2. בין אלה, מבחני סמן HF183 הם בין הנפוצות ביותר בשימוש לזיהוי זיהום צואתי הקשורים האדם 3. עם זאת, תוצאות qPCR יכול לעיתים קרובות להיות מוטים כי הם מסתמכים על עקומות סטנדרטיות עבור כימות. qPCR מכמת ריכוזים ידועים של יעד בדגימות על ידי ביון מחזור הכימות שלהם (CQ) מתוך סטןעקומת dard המתארת ​​מערכת יחסים ליניארי בין Cq וכמות לוגריתמים של סט של סטנדרטים בדילול סדרתי. חוסר חומר עזר תקן אמין ועקבי ולכן יכול להטות תוצאות qPCR מאוד. מחקרים הראו כי תוצאות qPCR שונות על ידי כחצי סטנדרטי יומן באמצעות מיצרנים שונים 4 ועל ידי 2-לקפל באמצעות קבוצות שונות של סטנדרטים מאותו הספק 5. PCR דיגיטלי (dPCR) טכנולוגיה מכמתת מדגם לא ידוע על ידי ספירת התדירות חיובית במספרים גדולים של PCRs מיניאטורי המופקים על ידי מחיצות qPCR בתפזורת לתוך אלף או מ&#39;nanoliter האחיד או תגובות picoliter 6. זה נקרא כמו אגל PCR דיגיטלי (כלומר, במאמר זה) או תא דיגיטלי PCR, בהתאמה, אם המחיצות הן טיפות מים ב-שמן (כלומר, במאמר זה) או תא קטן על שבב. ריכוז מדגם גבוה יגרום נוכחות של DNA היעד(ומכאן חיובי PCR), בשיעור גבוה יותר של מחיצות, מערכת יחסים המקורבים על ידי התפלגות פואסון. ככזה, התוצאות בינארי (חיובי או שלילי PCR) נרשמות ואת התדירות של טיפות חיוביות משמשת לחישוב ריכוזים מדגמים לא ידועים ישירות דרך קירוב פואסון, ביטול הצורך עקום סטנדרט כמו qPCR. הטבע בינארי זה של כימות דיגיטלי PCR מספק יתרונות נוספים על פני qPCR 7. בגלל הגברה מתעכבת עדיין יכולה להניב PCR חיובי, כימות dPCR הן חזקות יותר נגד עיכוב המפחיתה יעילה הגברה. באופן דומה, כימות dPCR אינו מושפע השתנות בערכים Cq כמו qPCR, שמוביל דיוק גבוה של dPCR לעומת qPCR 8-10. בנוסף, תהליך יצירת המחיצות מבטיח כמות קטנה מאוד של הנוכחי DNA יעד בכל אגל, מזעור תחרות מצע ביעילות (במהלך amplification של מטרות DNA שונות) כי הם מכשולים נפוצים להשגת דופלקס (כלומר assay מודד בעת ובעונה אחת שתי מטרות DNA) qPCR. ככזה, אם בטווח בדופלקס או סימפלקס (כלומר יעד אחד נמדד ב assay אחת) dPCR מייצרת כימות כמעט נבדלות של שני היעדים 7,11. המטרה של assay PCR הדיגיטלי (EntHF183 dPCR) המתוארת במאמר זה היא להשיג כימות ישירה סימולטני של spp אנטרוקוקוס מחוון צואתי הכללי. ואת סמן HF183 הקשורים אדם-צואה עם דיוק, שחזור וחוסנם משופרים מפני עיכוב לעומת qPCR שלה עמיתים. Assay זה נוצל בהצלחה לכימות זיהום צואתי במים מתוקים סביבה, מים ימיים, חומר צואתי שונה 7, אבל יכול גם להיות מיושם על כל סוגים אחרים של מים ואת wastewaters. assay זה טומן בחובו הבטחה גדולה לניתוח משקע או קרקעות בגלל זהזה סובלנות גבוהה עיכוב, אך בדיקות נוספות נדרשות בשל מורכבות של המעכב מתערבב סוגים אלה של דגימות.

<table><tbody><tr><td>Low Bind Microtubes</td><td>Costar</td><td>3207</td><td>For storage of reagents, samples/production of master mixes</td></tr><tr><td>Nuclease Free Water</td><td>FisherSci</td><td>BP2484-50</td><td></td></tr><tr><td>TE pH 8 buffer</td><td>FisherSci</td><td>BP2473-100</td><td></td></tr><tr><td>Hardshell 96 Well Plate</td><td>BioRad</td><td>HSP-9601</td><td>For initial master mix and sample inoculation</td></tr><tr><td>Aluminum Sealing Film</td><td>BioRad</td><td>359-0133</td><td>To seal sample plate</td></tr><tr><td>Droplet Generator</td><td>BioRad</td><td>186-3002</td><td></td></tr><tr><td>Droplet Generation Oil</td><td>BioRad</td><td>186-3005</td><td></td></tr><tr><td>Cartridge</td><td>BioRad</td><td>186-4008</td><td></td></tr><tr><td>DG8 Cartridge Holder</td><td>BioRad</td><td>186-3051</td><td></td></tr><tr><td>Gasket</td><td>BioRad</td><td>186-3009</td><td></td></tr><tr><td>20 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L10F</td><td>For tansferring sample/master mix to cartidge</td></tr><tr><td>200 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L200F</td><td>For transferring droplets to final Twin.Tec Plate</td></tr><tr><td>Twin.Tec 96 Well Plate</td><td>Eppendorf</td><td>951020320</td><td>For final droplets thermal cycling and reading</td></tr><tr><td>Pierceable Heat Seal Foil</td><td>BioRad</td><td>181-4040</td><td>To seal Twin.Tec plate before thermalcycling</td></tr><tr><td>PX1 PCR Plate Sealer</td><td>BioRad</td><td>181-4000</td><td></td></tr><tr><td>CFX96 Thermalcycler</td><td>BioRad</td><td>CFX96 and C1000</td><td>Only the thermal cycler is needed, no optics</td></tr><tr><td>QX100 Droplet Reader</td><td>BioRad</td><td>186-3001</td><td></td></tr><tr><td>Droplet Reader Oil</td><td>BioRad</td><td>186-3004</td><td></td></tr><tr><td>Droplet PCR Supermix&amp;nbsp;</td><td>BioRad</td><td>186-3024</td><td>&lt;em&gt;i.e.&lt;/em&gt; the digital PCR mix in manuscript</td></tr><tr><td>QuantaSoft software (v1.3.2)</td><td>Quantasoft&amp;nbsp;</td><td>QX100&amp;nbsp;</td><td>For viewing, analyzing, and exporting ddPCR data</td></tr><tr><td>Entero Forward Primer (Ent F1A)</td><td>Operon</td><td>GAGAAATTCCAAACGAACTTG</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Reverse Primer (Ent R1)</td><td>Operon</td><td>CAGTGCTCTACCTCCATCATT</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Probe (GPL813TQ)</td><td>Operon</td><td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be FAM</td></tr><tr><td>HF183 Forward Primer (HF183-1)</td><td>Operon</td><td>ATCATGAGTTCACATGTCCG</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Reverse Primer (BthetR1)</td><td>Operon</td><td>CGTAGGAGTTTGGACCGTGT</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Probe (BthetP1)</td><td>Operon</td><td>[6-HEX]-CTGAGAGGAAGGTCCCCC&lt;br/&gt; ACATTGGA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&amp;nbsp;</td></tr><tr><td>Positive control</td><td></td><td></td><td>Mixture of &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing &lt;em&gt;E. faecalis&lt;/em&gt; and sequences of the ordered HF183 plasmid, please see Cao &lt;em&gt;et al.&lt;/em&gt; 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available &lt;em&gt;Enterococcus&lt;/em&gt; DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA.</td></tr></tbody></table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

כתב יד זה מתאר assay PCR דיגיטלית דופלקס (EntHF183 dPCR) כימות סימולטני של spp אנטרוקוקוס. ואת סמן HF183 צואה הקשורים האדם. EntHF183 דופלקס dPCR (המכונה בשם EntHF183 dPCR hereon) assay משתמשת באותו רצפים פריימר בדיקה כמו PCR כמותי הפרט שפורסם שלה (qPCR) עמיתיהם. כמו כן, אותם הליכי סינון מי מיצוי DNA כפי שבוצע לפני qPCR הם אחריו לפני הפעלת dPCR. עם זאת, assay דופלקס dPCR יש מספר יתרונות על פני מבחני qPCR. החשוב ביותר, assay dPCR מבטל את הצורך לרוץ עקומת סטנדרט ומכאן, ההטיה הקשורה ולהבדלים, על ידי כימות ישיר של מטרותיה. בנוסף, בעוד להדפסה דו-צדדי (כלומר כימות סימולטני) אנטרוקוקוס ו HF183 ב qPCR מוביל לעתים קרובות הערכה נמוכה מדי חמורה של היעד השופע פחות במדגם, dPCR מספק כימות עקבית של המטרות הן, לגרותלה לכמת בנפרד או בו-זמנית באותו התגובה. את assay dPCR הוא גם מסוגל לסבול ריכוזי מעכב PCR כי הם אחד שני סדרי גודל גבוה יותר מאלו נסבלים על ידי qPCR. יתרונות אלו הופכים את assay EntHF183 dPCR אטרקטיבי במיוחד משום שהיא בעת ובעונה אחת מספקת מידע מדויק דיר משני הזיהום הכללי ואנושיים הקשורים צואתי במי סביבה, ללא הצורך להפעיל שני מבחני qPCR נפרדים. למרות יתרונותיה מעל qPCR, מגבלת הכימות העליונה של assay dPCR עם מכשור הקיימות כיום כ ארבעה סדרי גודל נמוך מזה השגה על ידי qPCR. כתוצאה מכך, הדילול נדרש למדידת ריכוזים גבוהים של אורגניזמים היעד כגון אלו שנצפו בדרך כלל בעקבות נשפך ביוב.

ריצת דופלקס EntHF183 טובה dPCR צריכה לגרום למספר גבוה היחסי של טיפות קבלו (בערך 10,000-17,000) והבדל גדול יחסית (בערך 5,000) בין ערכי קרינה עבור טיפות שליליות וחיוביות 7. באופן חריג מספר נמוך של טיפות מציין בעיות קרוב בתהליך אגל הדור, וניתוק 10,000 טיפות...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

כתב יד זה מתאר assay PCR דיגיטלית דופלקס, שניתן להשתמש בהם כדי לכמת spp אנטרוקוקוס זמנית. ואת סמנים גנטיים HF183 כאינדיקטורים לזיהום צואתי כללית אדם הקשורים במים פנאי.

Assay PCR דיגיטלי דופלקס כימות סימולטני של<em&gt; Spp אנטרוקוקוס.</em&gt; ואת מרקר HF183 הקשורים צואת האדם ווטרס

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

a-duplex-digital-pcr-assay-for-simultaneous-quantification

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

9.7K Views.  Southern California Costal Water Research Project Authority.  כתב יד זה מתאר assay PCR דיגיטלית דופלקס, שניתן להשתמש בהם כדי לכמת spp אנטרוקוקוס זמנית. ואת סמנים גנטיים HF183 כאינדיקטורים לזיהום צואתי כללית אדם הקשורים במים פנאי. 

Video: A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a standardized method for use in multiple analytical laboratories during monitoring period 3 of the Unregulated Contaminant Monitoring Rule. Herein we present the protocol for extraction of viral ribonucleic acid (RNA) from water sample concentrates and for quantitatively measuring enterovirus and norovirus concentrations using reverse transcription-quantitative PCR (RT-qPCR). Virus concentrations for the molecular assay are calculated in terms of genomic copies of viral RNA per liter based upon a standard curve. The method uses a number of quality controls to increase data quality and to reduce interlaboratory and intralaboratory variation. The method has been evaluated by examining virus recovery from ground and reagent grade waters seeded with poliovirus type 3 and murine norovirus as a surrogate for human noroviruses. Mean poliovirus recoveries were 20% in groundwaters and 44% in reagent grade water. Mean murine norovirus recoveries with the RT-qPCR assay were 30% in groundwaters and 4% in reagent grade water.

Here we present a procedure to quantify enterovirus and norovirus in environmental and drinking waters using reverse transcription-quantitative PCR. Mean virus recovery from groundwater with this standardized procedure from EPA Method 1615 was 20% for poliovirus and 30% for murine norovirus.

EPA שיטת המדידה של 1615. Enterovirus ומופע norovirus במים על ידי תרבות וRT-qPCR. חלק שלישי. איתור וירוסים על ידי RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a ...

Cost-effective Method for Microbial Source Tracking Using Specific Human and Animal Viruses

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant limitations, viruses are more resistant to many inactivation processes and standard fecal indicators do not inform on the source of contamination. The development of cost-effective methods for the concentration of viruses from water and molecular assays facilitates the applicability of viruses as indicators of fecal contamination and as microbial source tracking (MST) tools. Adenoviruses and polyomaviruses are DNA viruses infecting specific vertebrate species including humans and are persistently excreted in feces and/or urine in all geographical areas studied. In previous studies, we suggested the quantification of human adenoviruses (HAdV) and JC polyomaviruses (JCPyV) by quantitative PCR (qPCR) as an index of human fecal contamination. Recently, we have developed qPCR assays for the specific quantification of porcine adenoviruses (PAdV) and bovine polyomaviruses (BPyV) as animal fecal markers of contamination with sensitivities of 1-10 genome copies per test tube. In this study, we present the procedure to be followed to identify the source of contamination in water samples using these tools. As example of representative results, analysis of viruses in ground water presenting high levels of nitrates is shown.
Detection of viruses in low or moderately polluted waters requires the concentration of the viruses from at least several liters of water into a much smaller volume, a procedure that usually includes two concentration steps in series. This somewhat cumbersome procedure and the variability observed in viral recoveries significantly hamper the simultaneous processing of a large number of water samples.
In order to eliminate the bottleneck caused by the two-step procedures we have applied a one-step protocol developed in previous studies and applicable to a diversity of water matrices. The procedure includes: acidification of ten-liter water samples, flocculation by skimmed milk, gravity sedimentation of the flocculated materials, collection of the precipitate and centrifugation, resuspension of the precipitate in 10 ml phosphate buffer. The viral concentrate is used for the extraction of viral nucleic acids and the specific adenoviruses and polyomaviruses of interest are quantified by qPCR. High number of samples may be simultaneously analyzed using this low-cost concentration method.
The procedure has been applied to the analysis of bathing waters, seawater and river water and in this study, we present results analyzing groundwater samples. This high-throughput quantitative method is reliable, straightforward, and cost-effective.

The study describes a cost-effective method for the identification of the source of fecal/urine contamination or contamination by nitrates in water using qPCR for the specific quantification of human/porcine/bovine DNA viruses, adenoviruses and polyomaviruses, proposed as MST tools.

חסכונית שיטת מעקב אחר מקור מיקרוביאלית באמצעות וירוסים אדם ובעלי חיים ספציפיים

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant ...

Immunology and Infection

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Multiplex זיהוי של חיידקים דוגמאות מורכבות קלינית הסביבה באמצעות oligonucleotide מצמידים פלורסנט microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

Droplet יחיד שרשרת התגובה פולימראז דיגיטלי עבור זיהוי מקיף, בו זמנית של מוטציות באזורים חמה

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Genetics

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better characterize the prevalence of these pathogens, EPA Method 1623 was developed and used to monitor levels of these organisms in US drinking water supplies 12. The method has three main parts; the first is the sample concentration in which at least 10 L of raw surface water is filtered. The organisms and trapped debris are then eluted from the filter and centrifuged to further concentrate the sample. The second part of the method uses an immunomagnetic separation procedure where the concentrated water sample is applied to immunomagnetic beads that specifically bind to the Cryptosporidium oocysts and Giardia cysts allowing for specific removal of the parasites from the concentrated debris. These (oo)cysts are then detached from the magnetic beads by an acid dissociation procedure. The final part of the method is the immunofluorescence staining and enumeration where (oo)cysts are applied to a slide, stained, and enumerated by microscopy.
Method 1623 has four listed sample concentration systems to capture Cryptosporidium oocysts and Giardia cysts in water: Envirochek filters (Pall Corporation, Ann Arbor, MI), Envirochek HV filters (Pall Corporation), Filta-Max filters (IDEXX, Westbrook, MA), or Continuous Flow Centrifugation (Haemonetics, Braintree, MA). However, Cryptosporidium and Giardia (oo)cyst recoveries have varied greatly depending on the source water matrix and filters used1,14. A new tangential flow hollow-fiber ultrafiltration (HFUF) system has recently been shown to be more efficient and more robust at recovering Cryptosporidium oocysts and Giardia cysts from various water matrices; moreover, it is less expensive than other capsule filter options and can concentrate multiple pathogens simultaneously1-3,5-8,10,11. In addition, previous studies by Hill and colleagues demonstrated that the HFUF significantly improved Cryptosporidium oocysts recoveries when directly compared with the Envirochek HV filters4. Additional modifications to the current methods have also been reported to improve method performance. Replacing the acid dissociation procedure with heat dissociation was shown to be more effective at separating Cryptosporidium from the magnetic beads in some matrices9,13 .
This protocol describes a modified Method 1623 that uses the new HFUF filtration system with the heat dissociation step. The use of HFUF with this modified Method is a less expensive alternative to current EPA Method 1623 filtration options and provides more flexibility by allowing the concentration of multiple organisms.

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

This protocol describes the use of a tangential flow hollow-fiber ultrafiltration sample concentration system and a heat dissociation as alternative steps for the detection of waterborne Cryptosporidium and Giardia species using EPA Method 1623.

שינוי שיטת EPA 1623 שמשתמש תזרים משיק הולו סיבים Ultrafiltration ומחממים צעדים ניתוק לזהות waterborne<em&gt; Cryptosporidium</em&gt; ו<em&gt; Giardia spp.</em

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better ...

Capture of Environmental DNA (eDNA) from Water Samples by Flocculation

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species including invasive and (or) species at risk is the goal, typically accomplished by testing water and sediment for the presence of characteristic DNA signatures. Reliable and efficient procedures for the capture of eDNA are required, especially those that can be performed easily in the field by personnel with limited training and citizen scientists. The capture of eDNA using membrane filtration is widely used currently. This approach has inherent issues that include the choice of filter material and porosity, filter fouling, and time required on site for the process to be performed. Flocculation offers an alternative that can be easily implemented and applied to sampling regimes that strive to cover broad territories in limited time.

Capture of Environmental DNA eDNA from Water Samples by Flocculation

Environmental DNA (eDNA) is typically captured from water samples using alcohol precipitation, filtration, or flocculation. Presented here is an alternative protocol that uses lanthanum chloride to enable collection of dissolved and particulate-bound nucleic acids from water samples containing eukaryotic cells, prokaryotic cells, and virus.

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species ...

Development and Testing of Species-specific Quantitative PCR Assays for Environmental DNA Applications

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The use of environmental DNA (eDNA) samples for detecting macrobiota is one such group of methods that is rapidly becoming popular and being implemented in national management programs. Here we focus on the development of species-specific targeted assays for probe-based quantitative PCR (qPCR) applications. Using probe-based qPCR offers greater specificity than is possible with primers alone. Furthermore, the ability to quantify the amount of DNA in a sample can be useful in our understanding of the ecology of eDNA and the interpretation of eDNA detection patterns in the field. Careful consideration is needed in the development and testing of these assays to ensure the sensitivity and specificity of detecting the target species from an environmental sample. In this protocol we will delineate the steps needed to design and test probe-based assays for the detection of a target species; including creation of sequence databases, assay design, assay selection and optimization, testing assay performance, and field validation. Following these steps will help achieve an efficient, sensitive, and specific assay that can be used with confidence. We demonstrate this process with our assay designed for populations of the mucket (Actinonaias ligamentina), a freshwater mussel species found in the Clinch River, USA.

Environmental DNA assays require rigorous design, testing, optimization and validation before the collection of field data can begin. Here, we present a protocol to take users through each step of designing a species-specific, probe-based qPCR assay for the detection and quantification of a target species DNA from environmental samples.

פיתוח ובדיקה של מבחני PCR כמותיים ספציפיים למינים עבור יישומי DNA סביבתיים

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The ...

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular diagnostics. However, traditional PCR is very time-consuming because of the low-temperature variation efficiency. This work proposes a continuous-flow-PCR (CF-PCR) system based on a microfluidic chip. The amplification time can be greatly reduced by running the PCR solution into a microchannel placed on heaters set at different temperatures. Moreover, as capillary electrophoresis (CE) is an ideal way to differentiate positive and false-positive PCR products, a CE system was built to achieve efficient separation of the DNA fragments. This paper describes the process of amplification of Escherichia coli (E. coli) by the CF-PCR system built in-house and the detection of the PCR products by CE. The results demonstrate that the target gene of E. coli was successfully amplified within 10 min, indicating that these two systems can be used for the rapid amplification and detection of nucleic acids.

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

This protocol describes how to build a continuous-flow-polymerase chain system based on a microfluidic chip and how to build a capillary electrophoresis system in the lab. It presents a simple method for the analysis of nucleic acids in the lab.

הגברה של Escherichia coli בשבב מיקרופלואידי PCR בזרימה רציפה וגילויו באמצעות מערכת אלקטרופורזה נימית

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular ...

Bioengineering

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

איתור של שידור חי<em&gt; חיידקי Escherichia</em&gt; O157: H7 תאים על ידי PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Biology

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. Deviations from what is considered a healthy microbiota composition (dysbiosis) may impair vital functions leading to pathologic conditions. Recent and ongoing research efforts have been directed toward the characterization of associations between microbial composition and human health and disease.
Advances in high-throughput sequencing technologies enable characterization of the gut microbial composition. These methods include 16S rRNA-amplicon sequencing and shotgun sequencing. 16S rRNA-amplicon sequencing is used to profile taxonomical composition, while shotgun sequencing provides additional information about gene predictions and functional annotation. An advantage in using a targeted sequencing method of the 16S rRNA gene variable region is its substantially lower cost compared to shotgun sequencing. Sequence differences in the 16S rRNA gene are used as a microbial fingerprint to identify and quantify different taxa within an individual sample.
Major international efforts have enlisted standards for 16S rRNA-amplicon sequencing. However, several studies report a common source of variation caused by batch effect. To minimize this effect, uniformed protocols for sample collection, processing, and sequencing must be implemented. This protocol proposes the integration of broadly used protocols starting from fecal sample collection to data analyses. This protocol includes a column-free, direct-PCR approach that enables simultaneous handling and DNA extraction of large numbers of fecal samples, along with PCR amplification of the V4 region. In addition, the protocol describes the analysis pipeline and provides a script using the latest version of QIIME (QIIME 2 version 2017.7.0 and DADA2). This step-by-step protocol is aimed to guide those interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, detailed way.

This manuscript describes a detailed standardized protocol of high-throughput 16S rRNA-amplicon sequencing. The protocol introduces an integrated, uniformed, feasible, and inexpensive protocol starting from fecal sample collection through data analyses. This protocol enables analysis of large numbers of samples with rigorous standards and several controls.

פרוטוקול מודרך לקבלת צואה אפיון חיידקים על ידי מטוסי אף-16 rRNA-אמפליקון רצף

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

Assay PCR דיגיטלי דופלקס כימות סימולטני של

Summary

Explore More Videos

Chapters in this video