מימון עבור עבודה זו סופק על ידי Fondation בטנקור שולר בתמיכה של צוות פריז בטנקור iGEM. אנו מודים ביחידת המחקר U1001 INSERM ושנטל Lotton לקבלת סיוע טכני וייעוץ. Phagemid Litmus28i_J23115-B0032-GFP סופק על ידי מוניקה אורטיז דרו Endy של סטנפורד.

עיצוב 1. בניית וקטורי phagemid Bearing Srna השתקת קלטות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> דה נובו עיצוב Srna השתקת קלטות 8 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> זהה את הרצף השלם של mRNA להיות מושתק באמצעות מסד נתוני רצף DNA. כדי ליצור רצף היעד, לציין את 24 נ&quot;ב הראשונים של רצף קידוד, מעמדת 1-24 החל קודון ההתחלה (למשל, ATG). הערה: ההשתקה היא פחות יעילה כאשר אתרים או מקטעים נוספים של mRNA ממוקדות 8. </li><li style=";text-align:right;direction:rtl"> קח את המשלים השני של רצף היעד לייצר רצף מורה קלטת Srna. ראה טבלה מס &#39;1 עבור דוגמאות של רצפי היעד ומדריך עבור acetyltransferase chloramphenicol (CAT). </li><li style=";text-align:right;direction:rtl"> כדי לעצב את הביטוי Srna קלטת להשלים 292 נ&quot;ב, לארגן האמרגן PR, רצף GUIDE, Hfq חלבון מושלם מחייב T1 / TE רצפים terminator תעתיק בסדרה (טבלה 2). </li><li style=";text-align:right;direction:rtl"> הוסף אתרי שיבוט נוספים של בחירה כדי להקל שיבוט של קלטת Srna לתוך וקטור היעד. </li><li style=";text-align:right;direction:rtl"> השג את קלטת Srna להשלים באמצעות סינתזת גן מסחרית או שיטה דומה ולשכפל אותו לתוך כל וקטור phagemid עם ממוצא שכפול F1 התפקודי 11. ראה מידע תומך עבור הרצף השלם של וקטור phagemid הסופי. </li></ol></li><li style=";text-align:right;direction:rtl"> לשנות את הרצף הממוקד על ידי קלטת ביטוי Srna קיים באמצעות PCR מבוסס אתר הבימוי mutagenesis 12 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> זהה את רצף GUIDE 24 נ&quot;ב קלטת ביטוי Srna קיימת. הערה: הפלסמיד pAB.001 המבואר, המשמש בעבודה זו, זמין כקובץ רצף משלים. </li><li style=";text-align:right;direction:rtl"> עיצוב קדימה ולהפוך פריימרים עם אזורים קצרים הומולוגיה לקסטת Srna קיימת איגוף רצף GUIDE 24 נ&quot;ב החדש. השג את פריימרים באמצעות סינתזת oligonucleotide מסחרית. הערה: עיצוב פריימר עבור mutagenesis אתר מכוון הוא depicטד באיור 2. רצפי תבנית המדויק פריימר ניתנים בטבלה 3. </li><li style=";text-align:right;direction:rtl"> הכן תרבות 5 מ&quot;ל של E. coli נושאת את phagemid ביטוי Srna תבנית. לגדל את התאים לילה בשעה 37 ° C עם רעד, בתקשורת LB עם אנטיביוטיקה מתאימה. </li><li style=";text-align:right;direction:rtl"> חלץ ולטהר את phagemid ביטוי תבנית Srna מן התרבות חיידקים 5 מ&quot;ל באמצעות ערכת DNA miniprep או שיטה דומה 12. </li><li style=";text-align:right;direction:rtl"> הכן שתי תגובות PCR באמצעות phagemid ביטוי Srna תבנית פולימראז באיכות גבוהה, אחד עם קדימה ואחד עם פריימר ההפוך (לוח 4). השתמש תנאי PCR כפי שהומלץ על ידי ספק פולימראז (לוח 5). להגדיל את ריכוז תבנית 10-50x גבוה יותר מאשר תגובה סטנדרטית להסביר את העובדה שהתגובה פריימר היחידה אינה מייצרת הגברת מעריכים. </li><li style=";text-align:right;direction:rtl"> מערבב את תגובות PCR מעל השנייה בתוך שפופרת microcentrifuge. Anneal המוצרים על ידי חימום עד 98 מעלות צלזיוס באמבט מים רותחים. מיד לאחר הנחת הצינור microcentrifuge באמבט מים, להסיר את מקור החום ולאפשר באמבטיה לחזור לאט לטמפרטורת החדר במשך 1-2 שעות. </li><li style=";text-align:right;direction:rtl"> על מנת לפסול את phagemid ביטוי תבנית Srna unmutated, להוסיף 1 μl. אנזים הגבלה DpnI לתערובת לדגור על 37 מעלות צלזיוס במשך שעה 1, או הזמן המומלץ על ידי היצרן לעיכול שלם. הערה: DpnI מעכל רק לנקודות היעד מפוגל, אשר נמצאים על phagemids מאכסן משוכפל אבל לא מוצרי ה- PCR. </li><li style=";text-align:right;direction:rtl"> להפוך לרכוש או מוכן 13 כימית המוסמכות E. coli עם 1-5 μl של מוצר ה- PCR המרותק. לבודד מושבות אחת של המתח הפך על ידי ציפוי סלקטיבי על צלחות אגר LB המכיל אנטיביוטיקה מתאימה. </li><li style=";text-align:right;direction:rtl"> כדי לאמת את ההתאגדות של רצף GUIDE הנכון, מסך המושבות שהתקבלו על ידי מושבת PCR. בעזרת קצה פיפטה 200 μl, שיתוףllect כמות קטנה של תאים ממושבת טרנספורמציה יחידה. מארק ולשמר את המושבה המקורית לשימוש במורד הזרם לאחר אימות. </li><li style=";text-align:right;direction:rtl"> מוסיפים את התאים שנאספו עד 50 μl של מים nuclease ללא בצינור microcentrifuge. מערבבים על ידי pipetting למעלה ולמטה. </li><li style=";text-align:right;direction:rtl"> באמצעות thermocycler הספסל העליון או באמבט מים רותחים, lyse התאים על ידי חימום עד 95 מעלות צלזיוס למשך 2 דקות. </li><li style=";text-align:right;direction:rtl"> PCR-להגביר את האזור phagemid באמצעות 1 μl של תאים lysed חום כתבנית DNA. תנאי PCR ופרוטוקולי thermocycler ניתנים בלוחות 6 ו -7. ראה את קובץ הרצף pAB.001 משלים עבור רצפים פריימר אימות. </li><li style=";text-align:right;direction:rtl"> רצף מוצר PCR לאמת התאגדות של רצף GUIDE הנכון. </li><li style=";text-align:right;direction:rtl"> לחסן תרבות 5 מ&quot;ל של E. שיבוט coli נושא את phagemid Srna הביטוי מאומת הרצף. לגדל את התאים לילה בשעה 37 ° C עם רעד, בתקשורת LB סלקטיבית. </li><li style=";text-align:right;direction:rtl"> הכנתי מלאה גליצרולשל שיבוט רצף-מאומת. הוסף 750 μl של תרבות לילה 250 μl של גליצרול 60% בתוך שפופרת קריו בורג מכסה. </li><li style=";text-align:right;direction:rtl"> אחסן את המניה גליצרול ב -80 ° C ללא הגבלת זמן. שאר תרבות הלילה ניתן להשתמש כמקור עבור phagemid ביטוי Srna בשלב 2. </li></ol></li></ol> 2. ייצור קציר של מניות phagemid ארוזים M13 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן תרבות 5 מ&quot;ל של E. coli נושאת את phagemid ביטוי Srna. לגדל את התאים לילה בשעה 37 ° C עם רעד, בתקשורת LB עם אנטיביוטיקה מתאימה. הערה: phagemid הביטוי Srna ניתן לקבל באמצעות שיבוט דה נובו כמתואר בשלב 1.1.5, או שונה מן phagemid קיים וקצר בשלב 1.2.16. </li><li style=";text-align:right;direction:rtl"> באופן דומה להכין תרבות 5 מ&quot;ל של E. coli נושאת פלסמיד עוזר M13KO7. לגדל את התאים לילה בשעה 37 ° C עם רעד, בתקשורת LB סלקטיבית. </li><li style=";text-align:right;direction:rtl"> חלץ ולטהר את expressio Srnan phagemid ו פלסמיד עוזר באמצעות ערכת חילוץ DNA או שיטה דומה 12. </li><li style=";text-align:right;direction:rtl"> Cotransform שנרכש או מוכן 13 חיידק מוסמך כימי עם 1 μl כל אחד phagemid ביטוי Srna ו פלסמיד עוזר. בחר עבור cotransformants ידי ציפוי על אגר LB עם אנטיביוטיקה סלקטיבית עבור שני המבנים. </li><li style=";text-align:right;direction:rtl"> הכן תרבות 10 מיליליטר ממושבה אחת של זן cotransformed ב LB עם אנטיביוטיקה סלקטיבית. לדגור על 37 מעלות צלזיוס עם רעד במשך 8-12 שעות או לילה. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה התרבות ב 3,300 XG במשך 10 דקות. אסוף את supernatant ולסנן דרך פילטר 0.2 מיקרומטר. זהירות: במקרה של דליפת תקשורת, לנקות את האזור עם אקונומיקה מדוללת (0.5%) להרוס חלקיקים הפאג זיהומיות. </li><li style=";text-align:right;direction:rtl"> אחסן את התסנין הארוז phagemid על 4 מעלות צלזיוס. הערה: דוגמאות יכולות להישמר במשך ימים עד שבועות ללא הפסד של פעילות. </li></ol> 3. הכנת תאי F + יעד השתקה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לקבוע אם התאים להיות ממוקד עבור השתקה לבטא את pilus F 14. אם pilus F קיים כבר, המשך לשלב 4. הערה: זני מעבדה משותפים של E. coli הוא מבואר כמו F + או F &#39;כדי לציין את נוכחותו של pilus F בגנום שלהם או על פלסמיד. </li><li style=";text-align:right;direction:rtl"> השג זן F + של E. coli כגון TOP10F &#39;. הערה: ודא כי מתח יעד נושא סמן התנגדות ייחודי כדי להפריד בין תורם F-פלסמיד לאחר הצמיד. </li><li style=";text-align:right;direction:rtl"> כדי להציג pilus F על ידי נטיה עם זן F +, להכין 5 מ&quot;ל תרבויות הן של זן היעד התורם F-פלסמיד 14. לגדל את התאים לילה בשעה 37 ° C עם רעד, בתקשורת LB עם אנטיביוטיקה מתאימה. </li><li style=";text-align:right;direction:rtl"> למחרת, לדלל שני זני 1: 100 ב 5 מ&quot;ל של LB סלקטיבית ולהמשיך culturing על 37 מעלות צלזיוס עם רעד. </li><li style=";text-align:right;direction:rtl"> לקבוע את שלב הצמיחה של תאים על ידי מדידת optצפיפות iCal של התרבות ב 600 ננומטר (OD 600) באמצעות ספקטרופוטומטר המעבדתיים. תרבות התאים למשך כ -2 שעות עד OD 600 של 0.3 מושגת, על צמיחת יומן פאזיים 15. </li><li style=";text-align:right;direction:rtl"> כן 3 תגובות נטיית צינורות microcentrifuge: 0.5 מיליליטר F-פלסמיד תורם + 0.5 מיליליטר זן יעד, 0.5 מיליליטר תורם F-פלסמיד + 0.5 מיליליטר תקשורת LB (שליטה שלילית) ו -0.5 מיליליטר זן יעד + 0.5 מיליליטר תקשורת LB (שליטה שלילית). אפשר הנטייה להמשיך במשך שעה 2 ב 37 מעלות צלזיוס עם רעד. </li><li style=";text-align:right;direction:rtl"> פלייט 100 μl של כל תגובה נטיה על אגר LB סלקטיבית עם אנטיביוטיקה ספציפית-פלסמיד F (בדרך כלל טטרציקלין) ומתח היעד. פלייט תגובות הבקרה השליליות על מנת לאשר כי לא תורמים או זן נמען מבטא הוא התנגדויות אנטיביוטיות. </li></ol> 4. זיהום עם Phagemids הארוז עבור השתקה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחסן מושבה אחת של תאים היעד F + לתוך תרבות 5 מ&quot;ל של Medi LBA עם אנטיביוטיקה מתאימה. דגירה לילה בשעה 37 ° C עם רעד. </li><li style=";text-align:right;direction:rtl"> למחרת, לדלל את תאי יעד F + 1: 100 ב 5 מיליליטר של תקשורת LB סלקטיבית ולהמשיך תרבות על 37 מעלות צלזיוס עם רעד. </li><li style=";text-align:right;direction:rtl"> לקבוע את שלב הצמיחה של התאים על ידי מדידת הצפיפות האופטית של התרבות ב 600 ננומטר (OD 600) באמצעות ספקטרופוטומטר המעבדתיים. תרבות התאים למשך כ -2 שעות עד OD 600 של 0.3 מושגת, על צמיחת יומן פאזיים 15. הערה: הביטוי של יעילות pilus וזיהום F הוא הגבוה ביותר בשלב יומן. </li><li style=";text-align:right;direction:rtl"> מוסיף את phagemids ארוז M13 (משלב 2.6) על תאי היעד ביחס נפח של 1: 100 להשיג כמעט זיהום 99% של אוכלוסיית היעד. אפשר הזיהום להמשיך ב 37 מעלות צלזיוס עם רעד במשך 30-60 דקות. </li><li style=";text-align:right;direction:rtl"> Assay הפנוטיפ Srna-השתקה לפי שיטת הבחירה. הערה: יעד חלבון פלואורסצנטי, השפעת ההשתקה ניתן לכמתישירות על ידי fluorometry 10. לחלופין, מבחני פנוטיפי ניתן להשתמש כדי לבחון את ההשלכות פנוטיפי של גן מציאת 8. </li><li style=";text-align:right;direction:rtl"> הכינו מלאי גליצרול עבור המארח phagemid Srna להביע ביצוע השלבים 1.2.14-1.2.16. הערה: phagemid יהיה להפיץ זן המארח ללא הגבלת זמן יכול להישמר עם אנטיביוטיקה דומה פלסמיד קונבנציונאלי. </li></ol>

<ol>
	<li>Ohkumo, T., Masutani, C., Eki, T., Hanaoka, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+RNAi+in+C.+elegans.">Use of RNAi in C. elegans.</a> RNAi. , 129-137 (2008).</li><li>Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Iordanou, E., Chandran, R. R., Blackstone, N., Jiang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+interference+by+dsRNA+injection+into+Drosophila+embryos.">RNAi interference by dsRNA injection into Drosophila embryos.</a> J Vis Exp. (50), e2477 (2011).</li><li>Ramadan, N., Flockhart, I., Booker, M., Perrimon, N., Mathey-Prevot, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+implementation+of+high-throughput+RNAi+screens+in+cultured+Drosophila+cells.">Design and implementation of high-throughput RNAi screens in cultured Drosophila cells.</a> Nat Protoc. 2 (9), 2245-2264 (2007).</li><li>Tsong, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+cell+membranes.">Electroporation of cell membranes.</a> Biophys J. 60 (2), 297-306 (1991).</li><li>Kim, W. J., Chang, C. -. W., Lee, M., Kim, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+siRNA+delivery+using+water+soluble+lipopolymer+for+anti-angiogenic+gene+therapy.">Efficient siRNA delivery using water soluble lipopolymer for anti-angiogenic gene therapy.</a> J Control Release. 118 (3), 357-363 (2007).</li><li>Shi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+RNAi+for+the+masses.">Mammalian RNAi for the masses.</a> Trends Genet. 19 (1), 9-12 (2003).</li><li>Na, D., Yoo, S. M., Chung, H., Park, H., Park, J. H., Lee, S. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+engineering+of+Escherichia+coli+using+synthetic+small+regulatory+RNAs.">Metabolic engineering of Escherichia coli using synthetic small regulatory RNAs.</a> Nat Biotechnol. 31 (2), 170-174 (2013).</li><li>Ceroni, F., Algar, R., Stan, G. -. B., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantifying+cellular+capacity+identifies+gene+expression+designs+with+reduced+burden.">Quantifying cellular capacity identifies gene expression designs with reduced burden.</a> Nat Methods. 12 (5), 415-418 (2015).</li><li>Libis, V. K., Bernheim, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+Antibiotic+Resistance+in+E.+coli+with+Engineered+Phage+Bearing+Small+Regulatory+RNAs.">Silencing of Antibiotic Resistance in E. coli with Engineered Phage Bearing Small Regulatory RNAs.</a> ACS Synth Biol. 3 (12), 1003-1006 (2014).</li><li>Ortiz, M. E., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+cell-cell+communication+via+DNA+messaging.">Engineered cell-cell communication via DNA messaging.</a> J Biol Eng. 6 (1), 16 (2012).</li><li>Edelheit, O., Hanukoglu, A., Hanukoglu, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+and+efficient+site-directed+mutagenesis+using+two+single-primer+reactions+in+parallel+to+generate+mutants+for+protein+structure-function+studies.">Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies.</a> BMC Biotechnol. 9 (1), 61 (2009).</li><li>Chung, C. T., Miller, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+storage+of+competent+Escherichia+coli+cells.">Preparation and storage of competent Escherichia coli cells.</a> Recombinant DNA Part I. , 621-627 (1993).</li><li>Phornphisutthimas, S., Thamchaipenet, A., Panijpan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conjugation+in+Escherichia+coli.">Conjugation in Escherichia coli.</a> Biochem Mol Biol Educ. 35 (6), 440-445 (2007).</li><li>Sezonov, G., Joseleau-Petit, D., D'Ari, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+Physiology+in+Luria-Bertani+Broth.">Escherichia coli Physiology in Luria-Bertani Broth.</a> J Bacteriol. 189 (23), 8746-8749 (2007).</li><li>Mittal, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+the+efficiency+of+RNA+interference+in+mammals.">Improving the efficiency of RNA interference in mammals.</a> Nat Rev Genet. 5 (5), 355-365 (2004).</li><li>Qi, L. S., Larson, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repurposing+CRISPR+as+an+RNA-guided+platform+for+sequence-specific+control+of+gene+expression.">Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression.</a> Cell. 152 (5), 1173-1183 (2013).</li><li>Lu, T. K., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dispersing+biofilms+with+engineered+enzymatic+bacteriophage.">Dispersing biofilms with engineered enzymatic bacteriophage.</a> Proc Natl Acad Sci USA. 104 (27), 11197-11202 (2007).</li><li>Yosef, I., Manor, M., Kiro, R., Qimron, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperate+and+lytic+bacteriophages+programmed+to+sensitize+and+kill+antibiotic-resistant+bacteria.">Temperate and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria.</a> Proc Natl Acad Sci USA. 112 (23), 7267-7272 (2015).</li><li>Karlsson, F., Malmborg-Hager, A. -. C., Albrekt, A. -. S., Borrebaeck, C. A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+comparison+of+phage+M13-infected+vs.+uninfected+Escherichia+coli.">Genome-wide comparison of phage M13-infected vs. uninfected Escherichia coli.</a> Can J Microbiol. 51 (1), 29-35 (2005).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caveat+of+RNAi+in+plants:+the+off-target+effect.">Caveat of RNAi in plants: the off-target effect.</a> Methods in molecular biology. 744, 13-25 (2011).</li><li>Jackson, A. L., Linsley, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognizing+and+avoiding+siRNA+off-target+effects+for+target+identification+and+therapeutic+application.">Recognizing and avoiding siRNA off-target effects for target identification and therapeutic application.</a> Nat Rev Drug Discov. 9 (1), 57-67 (2010).</li><li>Cho, S. W., Kim, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+off-target+effects+of+CRISPR/Cas-derived+RNA-guided+endonucleases+and+nickases.">Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases.</a> Genome Res. 24 (1), 132-141 (2014).</li><li>Hagens, S., Blasi, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+filamentous+phage+as+bactericidal+agents:+a+pilot+study.">Genetically modified filamentous phage as bactericidal agents: a pilot study.</a> Lett Appl Microbiol. 37 (4), 318-323 (2003).</li><li>Kasman, L. M., Kasman, A., Westwater, C., Dolan, J., Schmidt, M. G., Norris, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+the+phage+replication+threshold:+a+mathematical+model+with+implications+for+phage+therapy.">Overcoming the phage replication threshold: a mathematical model with implications for phage therapy.</a> J Virol. 76 (11), 5557-5564 (2002).</li><li>Chasteen, L., Ayriss, J., Pavlik, P., Bradbury, A. R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eliminating+helper+phage+from+phage+display.">Eliminating helper phage from phage display.</a> Nucleic Acids Res. 34 (21), e145 (2006).</li><li>Lu, T. K., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+bacteriophage+targeting+gene+networks+as+adjuvants+for+antibiotic+therapy.">Engineered bacteriophage targeting gene networks as adjuvants for antibiotic therapy.</a> Proc Natl Acad Sci USA. 106 (12), 4629-4634 (2009).</li><li>Bikard, D., Jiang, W., Samai, P., Hochschild, A., Zhang, F., Marraffini, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmable+repression+and+activation+of+bacterial+gene+expression+using+an+engineered+CRISPR-Cas+system.">Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system.</a> Nucleic Acids Res. 41 (15), 7429-7437 (2013).</li></ol>

The authors have nothing to disclose.

השיטה הנוכחית השיגה 80 הפחתת% ברמות קרינת mKate בהשוואה לקבוצת ביקורת לא ממוקדת. זו עולה בקנה אחד עם שיטות מציאה RNA אחרים, שבהם השתקה מוחלטת לא נצפו ויעילות 50-90% אופייני 16,17. ברמת פנוטיפי, knockdowns במיקוד CAT הצליח להחליש התנגדות chloramphenicol משמעותית, ולחסל אותו בתנאים מסוימים. פנוטיפ המציאה לא הורגש ברמת האוכלוסייה רק לאחר כמה שעות לאחר הדבקה (איור 3 ב). זה ממחיש תכונה חשובה של משלוח מבוסס הפאג: תדר מציאה גבוה ניתן להשיג ישירות בתרבות תצווה ללא הנדסה גנטית מוקדמת. בניגוד שינויים גנטיים קונבנציונליים באמצעות טרנספורמציה פלסמיד או אינטגרציה הגנומי, זיהום הפאג אינו מחייב כי אוכלוסייה מחדש גדלה ממושבה אחת מבודדת. זה מאפשר את ההשפעות של זיהום הפאג להיות Explored באוכלוסיות עם דינמיקה מרחבית מורכבת 11, עם מבנים מרחביים קיימים כמו biofilms 18, או באוכלוסיות טבעיות מעורבות גנטי 19. שלב קריטי שיטה זו הוא ייצור של phagemid ארוז ב כייל גבוה. נטל מטבוליות הקשורות ייצור החלקיקים הפאג עלול להוביל שיעור גבוה של מוטציה או הפסד פלסמיד ב זן הייצור phagemid. מומלץ כי זן ייצור phagemid להיות מתורבת ישירות ממושבת cotransformed יחידה ולא בקירור, קפוא או תת תרבות לפני הקציר הפאג. יעילות נמוכה של שינוי שיתוף יכול להיות גם ציין בעת השקת הפלסמיד phagemid ועוזרו כדי E. coli זמנית. במקרה זה, יעילות גבוהה יותר ניתן לקבל על ידי הפיכת פלסמיד עזר הראשונה, ולאחר מכן הכנת תאים מוסמכים הנושאת את הפלסמיד עוזר לטרנספורמציה הבא עם phagemid. Phaזיהום gemid או ביטוי Srna גם מטיל עומס מטבולים לזיהוי על תאי המטרה, ועלול לגרום לכך שחלק הפרעות פנוטיפי. לדוגמא, צמצום קרינת mKate2 נצפה גם כאשר תאים נדבקו עם CAT מיקוד phagemid (איור 3). זיהום עם M13 ככל הנראה אינו לעורר תגובות לחץ מערכתיות ב E. 20 coli, אך הוא עשוי לשנות את דפוסי תעתיק בעקיפין. לחילופין, סמנים GFP או התנגדות אמפיצילין כלל על phagemid עשויים להתחרות על משאבים הסלולר, הפחתת mKate2 ביטוי וצמיחה 9. לבסוף, קלטת Srna עצמו עשויה גלובלי לשנות פרופילי ביטוי גנים על ידי titrating חלבון Hfq, או באמצעות השתקת mRNA מחוץ יעד. תופעות יעד כבויות נפוצות in vivo RNAi מיקוד 21-23, אבל הם עדיין צריכים להיחקר באופן שיטתי עבור מערכת זו. מגבלה אחת של שיטה זו היא כי אפי זיהוםciency הוא פחות מ -100%, המאפשר כמה חיידקים שאינם נגועים להתמיד האוכלוסייה. את התוצאות של העבודה הזאת קודם לכן העבודה 10 מראים כי תאי noninfected לייצג 1-10% מהאוכלוסייה הסופי, וכן הם אחראים ביותר של פנוטיפים nonsilenced ציין. מגוון מסלולים-התנגדות M13 ידוע, עם אובדן מוטציוני להיות הנפוץ ביותר של ביטוי pilus 24. לאור המגבלות הללו, שולטים יש להשתמש כדי לאמת את שערי זיהום גבוהים ויעילות מציאה. הגבלת פוטנציאל נוספת עבור יישומים מסוימים היא העברת המזדמנים של זיהום הפאג עוזר. למרות M13K07 מכיל אות אריזת מוטציה, זה יכול להיות ארוז לתוך קפסיד הפאג בתדירות נמוכה והועבר אוכלוסיות נגועות, וכתוצאה מכך תאים מוסמכים לייצור הפאג והתפשטות משך הפאג מעבר לאירוע הזיהום הראשוני 25. עשיית שינויים הפאג עוזר הוכיחו יעילותלצמצם אריזה ספציפית, אם כי לפעמים על חשבון ייצור הפאג מופחת 26. בקטריופאג מהונדסים הפכו לכלי הכרחי עבור E. ביולוגיה סינתטית coli, המאפשר אספקה ​​מהירה של גנים חדשים הגידול באוכלוסייה. מחקר שנערך לאחרונה הפיק מעגלים תקשורת בין תאית 11 או הביעו גורמי שעתוק לדכא עמידות לאנטיביוטיקה מסלולים 27. הפרוטוקול המובא כאן מוסיף אוסף גדל והולך של כלים המאפשרים שליטת פיזיולוגית חיידקים באמצעות RNAs המתוכנת. Nucleases CRISPR-קאש, כאשר מוטציה לחסל פעילות nuclease, הוכחו להדחיק שעתוק לעבר מטרות הגן מונחה RNA 17,28. לעומת זאת, השתקת Srna עובדת ברמת translational ואינה דורשת ביטוי חלבון אקסוגני. ביוטכנולוגיות הדור הבא עשויה להתאחד מלאת translational ו תעתיק עם משלוח בתיווך הפאג לתכנת pheno מורכבסוגים בזמן אמת.

knockdowns הגן בתיווך RNA להמשיך בשני שלבים. ראשית, מולקולת רנ&quot;א הוא הציג קו תא או אורגניזם של המחקר. שנית, חלבונים קושרי RNA אנדוגני להקל הכרה RNA-היעד ולייצר אפקט השתקה. כל טכנולוגיות מציאת RNA ליהנות מן הטבע להתאמה האישי של sRNAs הסינטטי, אשר ניתן להפיק בקלות כדי להתאים למטרה ספציפית של עניין. עם זאת, את הפרטים המולקולריים של ספיגת RNA והשתקה להשתנות משמעותי על פני מערכת מודל, מגבילים איפה ואיך knockdowns RNA יכול להיות מיושם. נמטודות, RNA פעמיים תקועים (dsRNA) מולקולות יכול להיות מוצג באופן ישיר בתקשורת או על ידי האכלה תולעים עם אוכלוסייה של dsRNA להביע E. 1,2 קולי תאים. תסיסנית, RNAi יכול להיות מושגת על ידי microinjecting עוברים עם dsRNA 3, או מיושם שורות תאים פשוט על ידי הוספת dsRNA עד בינוני התרבות 4. בשורות תאי יונקים,RNAs התערבות קטנה סינתטי (siRNAs) עשויה להיות מועברת לתאים חיים על ידי electroporation 1,2,5, ארוזים ליפוזומים 3,6, או לידי ביטוי מתוך וקטורים פלסמיד דנ&quot;א 4,7. לאחר מינים RNA מגיע cytosol, מסלול RNAi מסתמך על מורכבות RISC לעבד dsRNA, להקל הכרה antisense של היעד, ולזרז את דיכוי translational, השפלה mRNA, או היווצרות heterochromatin, תלוי המארח. בגלל דרישות אלה, קלסי RNAi יכול להתבצע רק באורגניזמים כי תופסי RNA אקסוגניים ביעילות ולהביע RISC או פעילות RISC דמוית. יש לציין, זו אינה כוללת את חיידק מודל E. coli, אשר חסרה את מסלול RNAi. עם זאת, התקדמות ביולוגיה סינטתית לספק את הכלים לפתור גם את בעית המשלוח ובעית ההשתקה. בפרוטוקול זה, בונה Srna באים לידי ביטוי E. coli מן וקטור DNA נמסר liוינג התאים באמצעות מערכת phagemid / עוזר M13. Phagemid הוא כל פלסמיד עם ממוצא F1 הנגזרות הפאג של שכפול. פלסמיד עוזר, במקרה זה M13KO, נושאת את כל המנגנון הנדרש כדי לייצר חלקיקים נגיפיים, אך היא עצמה אינה מוסמכת לשכפול ואריזה. כאשר phagemid ו פלסמיד עוזר משתפים טרנספורמציה, phagemid לבד משוכפל בראשית הצירים F1, ארוז ומופרשת. Phagemid vectorized אז המוסמכות להדביק חי E. coli באמצעות pilus F. במערכת זו, ההשפעה השתקה מופק על ידי קלטות מנהג Srna שילוב רצף פיגום עם רצף מחייב היעד. רצף מחייב היעד הוא 24 זוגות בסיסים antisense כדי יעד mRNA, בדרך כלל באתר מחייב הריבוזום (RBS). רצף הפיגום, שפותח על ידי Na ועמיתיו 8, מכיל מוטיב מחייב Hfq מופק MICC, RNA רגולטוריים קטן אנדוגני E. coli. החלבון Hfq מגרה RNA-RNA bindin<html> g והשפלה mRNA, ממלאת את תפקידי במערכת זו דומה RISC ב RNAi. איור 1 מתאר תוכנית מלאה הנוקאוט Srna בתיווך הפאג, לרבות המבנה קלטת Srna, vectorization phagemid, ומנגנון השתקה. כשיטה לווסת ביטוי גנים א השתקת coli, Srna היא פשוטה, מהירה צדדית. וממוקדי E. coli הוא לא עמוס מעבר להפצת phagemid ומבטא את Srna. זה עשוי להיות רלוונטי בהקשר של ביולוגיה סינתטית או מחקר בסיסי מה מקור הביטוי של מבנים Heterologous גדול יכול להתאמץ משאבים הסלולר 9. Phagemids עם מטרות חדשות יכול להיות מיוצר עם יחיד PCR וקצר יום אחד לאחר שינוי phagemid. לבסוף, כמעט כל mRNA יכול להיות ממוקד. הקלטת תקנת Srna (על פלסמיד סטנדרטי) הוכחה לעבוד על מגוון רחב של מטרות במטבוליזם עם רמות דיכוי טיפוסיות&gt; 90% 8. ss = &quot;jove_content&quot;&gt; פרוטוקול זה מתרבה ומרחיב על העבודה קודמת באמצעות phagemid יליד Srna קלטות 10. ראשית, phagemid ארוז הוא הציג את התרבות אצווה של E. קולי תאים והשתמשו להשתיק ביטוי של חלבון פלואורסצנטי mKate2. שינויי קרינה לאחר מנוטר בזמן אמת. שנית, דריסת גן CAT מוצג להפחית התנגדות chloramphenicol פנוטיפי על צלחות אגרו. בשני המקרים, phagemid עצמה נושאת סמן GFP, המאפשר שיעור זיהום להימדד באופן בלתי תלוי את יעילות מציאה.

<table border="0" cellpadding="0" cellspacing="0" width="637">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Plasmid Miniprep Kit</td>
			<td style="width:135px;">Qiagen</td>
			<td style="width:119px;">27104</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DpnI Enzyme</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">R0176S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phusion High Fidelity Polymerase</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">M0530S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Taq 2x Master Mix</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">M0270L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">M13KO7 Helper Phage</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">N0315S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DH5&#945; Competent Cells</td>
			<td style="width:135px;">Life Technologies</td>
			<td style="width:119px;">18265-017</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TOP10F&#39; Cells</td>
			<td style="width:135px;">Life Technologies</td>
			<td style="width:119px;">C3030-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">LB Broth</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">L3022-250G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ampicillin</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">A9393-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kanamycin</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">60615-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chloramphenicol</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">C0378-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tetracycline</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">87128-25G</td>
			<td></td>
		</tr>
	</tbody>
</table>

phage-mediated delivery of targeted srna constructs to knock down gene expression in e. coli

knockdowns בתיווך RNA נמצא בשימוש נרחב לשלוט ביטוי גנים. המשפחה צדדי זה של טכניקות עושה שימוש RNA קצר (Srna) כי יכול להיות מסונתז עם כל רצף שנועדו להשלים כל הגן ממוקד עבור השתקה. בגלל Srna בונה יכולה להיות מוצגת בפני סוגי תאים רבים ישירות או באמצעות מגוון של וקטורים, ביטוי גנים יכול להיות מודחק בתאים חיים ללא הנדסה גנטית מייגעת. הטכנולוגיה הנפוצה ביותר RNA מציאה, התערבות RNA (RNAi), עושה שימוש מושרה RNA אנדוגני השתקה מורכב (RISC) לתווך רצף הכרת המחשוף של mRNA היעד. יישומים של הטכניקה הזו ולכן מוגבלים RISC להביע אורגניזמים, אאוקריוטים בעיקר. לאחרונה, דור חדש של biotechnologists RNA פתח מנגנונים חלופיים לשליטת ביטוי גנים באמצעות RNA, וכך מתאפשר knockdowns גן בתיווך RNA בחיידקים. כאן אנו מתארים שיטה להשתקת הבעת גןשיאון ב E. coli מבחינה תיפקודית דומה RNAi. במערכת זו יש phagemid סינתטי נועד להביע Srna, אשר עשוי שנועד למקד כל רצף. בונת הביטוי מועברת לאוכלוסייה של E. קולי תאים עם הפאג M13 לא אלים, שלאחריו הוא מסוגל לשכפל כמו פלסמיד ביציבות. הכרה והשתקה אנטיסנס של mRNA היעד מתווכת על ידי חלבון Hfq, אנדוגני E. coli. פרוטוקול זה כולל שיטות לעיצוב antisense Srna, בניית וקטור phagemid, אריזת phagemid לתוך bacteriophage M13, הכנת האוכלוסייה תא חי עבור זיהום, וביצוע הזיהום עצמו. חלבון פלואורסצנטי mKate2 ואת acetyltransferase chloramphenicol גן עמידות לאנטיביוטיקה (CAT) ממוקדות להפיק נתונים נציג לכמת האפקטיביות מציאה.

השתקת mKate2 קרינת מדיה נוזלית איור 1 מתאר את ערכת הנוקאוט בתיווך Srna המתואר בעבודה זו, לרבות עיצוב קלטת Srna, vectorization phagemid, ומנגנון השתקה. בעקבות פרוטוקול 1.2, את הקלטת השתקה Srna של פלסמיד pAB.001 שונתה למקד mKate. הקלטת Srna היה synthetized ו משובטים לתוך phagemid Litmus28i_J23115-B0032-GFP, מתנת מוניקה אורטיז דרו אנדי 11. phagemid זו נושאת סמנים לביטוי GFP והתנגדות kanamycin, המאפשרת זיהומים מוצלחים להיות במעקב. מניות phagemid ארוזים הוכנו לאחר פרוטוקול 2. הוא נגזר של E. coli K12 MG1655 נושאת הביע constitutively, סמן mKate2 משולב כרומוזומלית הוכנה עבור זיהום הפאג ידי נטייה<html> עם זן תורם פלסמיד F בעקבות פרוטוקול 3. התאים גדלו לשלב יומן אמצע ואת phagemid הציג בעקבות פרוטוקול 4. לאחר ההדבקה phagemid, 200 תרבויות μl הועברו קורא צלחת פלואורסצנטי הקרינה היה פיקוח רציף במשך 24 שעות. איור 3 מראה את ההשפעה של השתקה בתיווך Srna על הביטוי mKate2. הזן נגוע עם phagemid אנטי mKate2 לא הראה קרינת mKate2 לגילוי מעל ברקע. בניגוד לכך, זן זה עשה להביע את הסמן GFP, המציין ספיגת המוצלח של phagemid. לתאי קבוצה נגועים מיוצרים קרינת mKate2 אבל לא GFP. פקד נוסף, שבו תחום מיקוד אנטי mKate2 הוחלף CAT מיקוד רצף, לא הייתה השפעה על הקרינה mKate2. השתקה של Chloramphenicol התנגדות על צלחות אגרו התוכן &quot;FO: keep-together.within-page =&quot; 1 &quot;&gt; בעקבות פרוטוקול 1.1, קלטת השתקה Srna הופק למקד CAT הוא נגזרת של E. coli K12 MG1655 נושאת הביע constitutively, סמן CAT משולבת כרומוזומלית הוכן עבור. זיהום הפאג ידי נטיה עם זן תורם F-פלסמיד בעקבות פרוטוקול 3. התאים גדלו לשלב יומן אמצע ואת phagemid הציג בעקבות פרוטוקול 4. לאחר שעה 1 של דגירה על 37 מעלות צלזיוס, תאים נגועים דוללו באופן סדרתי מצופה טווח הריכוזים chloramphenicol. צלחות הודגרו לילה, ואת חלקם של תאים עמידים בכל ריכוז chloramphenicol נקבע על ידי ספירת יחידות המושבה להרכיב (CFUs) למחרת. איור 4 מראה את ההשפעה של השתקה בתיווך Srna על הפנוטיפ התנגדות chloramphenicol. תאים נגועים, או תאים נגועים עם phagemid מיקוד mKate2, היו עמידיםchloramphenicol בכלל ריכוזי נבדק. לעומת זאת, תאים נגועים מיקוד phagemid CAT הראו מופחת הישרדות בריכוזים chloramphenicol נמוך, וכמעט 99% להרוג בריכוזים גבוהים. התוספת של אמפיצילין, כדי לבחור עבור חיידקים רק נושאים את phagemid, מופחת הישרדות chloramphenicol לרמות בלתי מורגשות. זה עולה בקנה אחד עם עבודה קודמת מראה שבריחה מזיהום הפאג הוא מסלול משותף לברוח השתקת 10. <img alt="איור 1" src="/files/ftp_upload/53618/53618fig1.jpg" /> איור 1: ג&#39;ין השתקה ב E. coli עם Srna ביטוי קלטות נמסר על ידי M13 הפאג קלטת Srna מורכבת 4 מודולים:. אמרגן PR (אמרגן מכונן נגזר למבדה bacteriophage), תחום מיקוד 24 נ&quot;ב, תחום מחייב Hfq מופק MICC ו שליחות קטלנית 8 תעתיק </sup&gt;. הקלטת משולב לתוך phagemid הנושאת את המקור שכפול F1 M13 וארוז לתוך קפסיד M13 באמצעות M13KO7 הפאג עוזר. Phagemids ארוז מסוגל להדביק E. coli המבטא את pilus F, שבו ביטוי Srna מתחיל. Srna ואז מגייס חלבון Hfq (המתואר באדום) ונקשר מטרת mRNA antisense סמוך לאתר מחייב הריבוזום, וכתוצאה מכך הדחקת translational ושפלת mRNA. <a href="https://www.jove.com/files/ftp_upload/53618/53618fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/53618/53618fig2.jpg" /> איור 2:. עיצוב פריימר ואת לאתר בימוי mutagenesis באתר Srna יעד שני פריימרים נועדו עם הומולוגיה חלקית קלטת Srna הקיים. פריימר קדימה מכיל 20 נ&quot;ב הומולוגי אמרגן PR בסוף &#39;5, ואחריו24 נ&quot;ב המייצג את רצף המדריך החדש, אז 18 נ&quot;ב הומולוגי לתחום מחייב Hfq בסוף &#39;3. פריימר ההפוכה הוא משלים הפוך המדויק של פריימר קדימה, עם אזורים של הומולוגיה לקסטת Srna קיימת איגוף המשלים השני של רצף המדריך החדש. רצפים פריימר מדויקים מובאים בטבלה 3. PCR תגובות יחידה פריימר נפרדות עם קדימה פריימרים הפוכים לייצר ליניארי, דנ&quot;א חד-גדילים עם הרצף השונה הרצוי. חישול קדימה ואחורה תוצרי תגובה, לאחר לנקות כמתואר בפרוטוקול, תוצאות ב- DNA פלסמיד פעמים תקועות הנושאים את קלטת Srna השונה הרצויה. <a href="https://www.jove.com/files/ftp_upload/53618/53618fig2large.jpg" target="_blank">אנא לחצו כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/53618/53618fig3.jpg" /> איור 3: Knockdown של כתב ניאון כרומוזומלית משולב mKate2. E. coli MG1655 K12 להביע mKate2 היו או לא מטפלים בהם (הקווים האדומים וברים), נגוע עם phagemid אנטי mKate2 (קווים ירוקים וברים), או נגוע CAT מיקוד שליטה phagemid (קווים כחולים וברים). (א) מטופל E. coli גדל לצפיפויות רוויות גבוהות יותר, מה שמעיד על עלות מטבולית לזיהום הפאג. קווים מקווקווים מצביעים סטיית התקן של 3 חזרות. (ב) אות mKate2 הופחתה לרמות רקע הקרובות-mKate2 אנטי מטופלים ניטלים, אך לא זנים שליטים. (C) GFP הקרינה, גם נישאה על ידי phagemid, לא הורגשה רק שולט phagemid שטופל. (D, E) קריאות קרינה סופיות לאחר 24 שעות של צמיחה היו מנורמלות OD. אות ה- GFP, המציין זיהום phagemid, נעדר שולטת ללא טיפול, אלא גם הקטינה באופן משמעותי בעקבות p אנטי-CATטיפול hagemid. הדבר עשוי להעיד על השפעות חוץ-היעד של phagemid. אות mKate2 הופחתה טיפול phagemid אנטי mKate2 בהשוואה לקבוצת ביקורת שלא טופלה. Phagemid השליטה במיקוד CAT לא הראתה כל השפעה על קרינת mKate2. ברי שגיאה מייצגים סטיית התקן של 3 חזרות. <a href="https://www.jove.com/files/ftp_upload/53618/53618fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/53618/53618fig4.jpg" /> איור 4: מציאה של CAT משחזר רגישות Chloramphenicol לאוכלוסייה גנטית עמידה א. coli MG1655 K12 להביע גן CAT משולב כרומוזומלית נותר ללא טיפול (מוטות אדומות), שטופל phagemid מלא מיקוד mKate2 (פסים ירוקים), או שטופל phagemid בעת-CAT אנטי Srna (סורגים כחולים). אחרי שעת 1 של זיהום, כדאיות על הנמלה הצביעהibiotics הוערכה על ידי דילולים ציפוי סדרתי. זנים שטופלו phagemid אנטי-CAT נהרגו משמעותי (&gt; 90%) על ידי chloramphenicol בריכוזים גבוהים, בעוד טיפולים מלאים לא הושפעו. הוספת אמפיצילין אל צלחות התרבות בוחר באופן חיובי עבור זיהום phagemid ומונע תאים נגועים. בתנאים אלה, אין מושבות עמידות chloramphenicol נצפו לאחר טיפול אנטי-CAT. זה מצביע על כך שרוב ניצולי מייצגי כישלון של זיהום, ולא כשל של השתקה. ברים שגיאה מייצגים את סטיית התקן של 3 חזרות. <a href="https://www.jove.com/files/ftp_upload/53618/53618fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> רצף יעד CAT </td><td> 5 &#39;- ATGGAGAAAAAAATCACTGGATAT - 3&#39; </td></tr><tr><td> רצף GUIDE CAT </td><html><td> 5 &#39;- ATATCCAGTGATTTTTTTCTCCAT - 3&#39; </td></tr></tbody></table> טבלת 1:. דוגמא TARGET ומדריך רצף עבור CAT ג&#39;ין הערת היחסים השלמים ההפוכים. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> אמרגן PR </td><td colspan="5"> TAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC </td></tr><tr><td> רצף GUIDE </td><td colspan="5"> ATATCCAGTGATTTTTTTCTCCAT </td></tr><tr><td> תחום מחייב Hfq </td><td colspan="5"> TTTCTGTTGGGCCATTGCATTGCCACTGATTTTCCAACATATAAAAAGACAAGCCCGAACAGTCGTCCGGGCTTTTTT TCTCGAG </td></tr><tr><td> T1 / Terminator TE </td><td colspan="5"> CTCGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTTTTGTCGGTGAA CGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA </td></tr></tbody></table>ether.within-page = &quot;1&quot;&gt; טבלה 2:. רכיבי רצף של קלטת Srna כל רצף כתוב 5&#39;-3 &#39;. הקלטת המלאה היא השרשור של 4 אלמנטים אלה כדי וכוללת 292 נ&quot;ב. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> פריימר קדימה </td><td> 5 &#39;- CTGGCGGTGATAATGGTTGC [מדריך] TTTCTGTTGGGCCATTGC - 3&#39; </td></tr><tr><td> פריימר הפוך </td><td> 5 &#39;- GCAATGGCCCAACAGAAA [TARGET] GCAACCATTATCACCGCCAG - 3&#39; </td></tr></tbody></table> טבלה 3: פריימר עיצוב לאלטר אלמנטי GUIDE קיימים פריימר קדימה כולל את 20 נ&quot;ב האחרונים של אמרגן PR, רצף המדריך החדש, ואת נ&quot;ב 18 הראשונים של התחום מחייב Hfq.. רצף היעד הוא משלים ההפוך המדויק של רצף GUIDE. פריימר ההפוכה הוא משלים הפוך המדויק של פריימר קדימה. </p&gt; <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> רְכִיב </td><td> כֶּרֶך </td></tr><tr><td> פלסמיד תבנית </td><td> 500 ננוגרם </td></tr><tr><td> 10 מיקרומטר פריימר </td><td> 2.5 μl </td></tr><tr><td> 10 מ&quot;מ dNTPs </td><td> 0.4 μl </td></tr><tr><td> פולימראז באיכות גבוהה (2 U / μl) </td><td> 0.5 μl </td></tr><tr><td> 5x PCR הצפה </td><td> 10 μl </td></tr><tr><td> נפח כולל </td><td> 50 μl </td></tr></tbody></table> לוח 4: מוצע תנאים לסינגל-פריימר מוטגנים PCR. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שָׁלָב </td><td> Temp </td><td> זְמַן </td></tr><tr><td> denaturation הראשונית </td><td> 98 ° C </td><td> 30 שניות </td></tr><tr><td rowspan="3"> 30 מחזורים </td><td> 98 ° C </td><td> 10 שניות </td></tr><tr><td> 55 ° C </td><td> 30 שניות </td></tr><tr><td> 72 ° C </td><td> 120 שניות </td></tr><tr><td> רחבה סופית </td><td> 72 ° C </td><td> 300 שניות </td></tr><tr><td> אִחסוּן </td><td> 10 ° C </td><td></td></tr></tbody></table> לוח 5: מוצע thermocycler פרוטוקול עבור יחיד פריימר מוטגנים PCR. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> רְכִיב </td><td> כֶּרֶך </td></tr><tr><td> DNA תבנית </td><td> 1 μl </td></tr><tr><td> פריימר 10 מיקרומטר קדימה </td><td> 0.5 μl </td></tr><tr><td> פריימר 10 מיקרומטר הפוך </td><td> 0.5 μl </td></tr><tr><td> מערבבים תקי 2X מאסטר </td><td> 25 μl </td></tr><tr><td> wate nuclease ללאr </td><td> 23 μl </td></tr><tr><td> נפח כולל </td><td> 50 μl </td></tr></tbody></table> לוח 6: מוצע תנאים עבור PCR אימות הרצף. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שָׁלָב </td><td> Temp </td><td> זְמַן </td></tr><tr><td> denaturation הראשונית </td><td> 95 ° C </td><td> 30 שניות </td></tr><tr><td rowspan="3"> 30 מחזורים </td><td> 95 ° C </td><td> 30 שניות </td></tr><tr><td> 55 ° C </td><td> 30 שניות </td></tr><tr><td> 68 ° C </td><td> 30 שניות </td></tr><tr><td> רחבה סופית </td><td> 68 ° C </td><td> 300 שניות </td></tr><tr><td> אִחסוּן </td><td> 10 ° C </td><td></td></tr></tbody></table> לוח 7: מוצע thermocycler Protocol עבור PCR אימות הרצף.

Watch this Scientific Journal Video about Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli at JoVE.com

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

We describe a method to knock down gene expression in a growing population of E. coli cells using sequence-targeted sRNA expression cassettes delivered by an M13 phagemid vector.

משלוח בתיווך הפאג של ממוקדת Srna בונה להפיל Gene Expression ב<em&gt; E. coli</em

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be ...

phage-mediated-delivery-targeted-srna-constructs-to-knock-down-gene

Research

JoVE Journal

Biology

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

12.5K Views.  Institut National de la Santé et de la Recherche Médicale (INSERM), Université Paris Descartes. We describe a method to knock down gene expression in a growing population of E. coli cells using sequence-targeted sRNA expression cassettes delivered by an M13 phagemid vector.

Video: Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

הכנת ראשי בתרביות תאים hematopoietic ממח העצם Murine עבור electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Using the Gene Pulser MXcell Electroporation System to Transfect Primary Cells with High Efficiency

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell electroporation system and Gene Pulser electroporation buffer (Bio-Rad) were specifically developed to easily transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells. We will demonstrate how to perform a simple experiment to quickly identify the best electroporation conditions. We will demonstrate how to run several samples through a range of electroporation conditions so that an experiment can be conducted at the same time as optimization is performed. We will also show how optimal conditions identified using 96-well electroporation plates can be used with standard electroporation cuvettes, facilitating the switch from electroporation plates to electroporation cuvettes while maintaining the same electroporation efficiency. In the video, we will also discuss some of the key factors that can lead to the success or failure of electroporation experiments.

This procedure shows how to use the Gene Pulser MXcell electroporation system to rapidly and easily identify the best electroporation conditions for mouse embryonic fibroblasts (MEFs) or other primary cells. Considerations for troubleshooting are also discussed in the associated video.

שימוש ג&#39;ין Pulser מערכת MXcell electroporation כדי Transfect תאים ראשוניים עם יעילות גבוהה

Laser Microdissection Applied to Gene Expression Profiling of Subset of Cells from the Drosophila Wing Disc

Heterogeneous nature of tissues has proven to be a limiting factor in the amount of information that can be generated from biological samples, compromising downstream analyses. Considering the complex and dynamic cellular associations existing within many tissues, in order to recapitulate the in vivo interactions thorough molecular analysis one must be able to analyze specific cell populations within their native context. Laser-mediated microdissection can achieve this goal, allowing unambiguous identification and successful harvest of cells of interest under direct microscopic visualization while maintaining molecular integrity. We have applied this technology to analyse gene expression within defined areas of the developing Drosophila wing disc, which represents an advantageous model system to study growth control, cell differentiation and organogenesis. Larval imaginal discs are precociously subdivided into anterior and posterior, dorsal and ventral compartments by lineage restriction boundaries. Making use of the inducible GAL4-UAS binary expression system, each of these compartments can be specifically labelled in transgenic flies expressing an UAS-GFP transgene under the control of the appropriate GAL4-driver construct. In the transgenic discs, gene expression profiling of discrete subsets of cells can precisely be determined after laser-mediated microdissection, using the fluorescent GFP signal to guide laser cut. 
Among the variety of downstream applications, we focused on RNA transcript profiling after localised RNA interference (RNAi). With the advent of RNAi technology, GFP labelling can be coupled with localised knockdown of a given gene, allowing to determinate the transcriptional response of a discrete cell population to the specific gene silencing. To validate this approach, we dissected equivalent areas of the disc from the posterior (labelled by GFP expression), and the anterior (unlabelled) compartment upon regional silencing in the P compartment of an otherwise ubiquitously expressed gene. RNA was extracted from microdissected silenced and unsilenced areas and comparative gene expression profiling determined by quantitative real-time RT-PCR. We show that this method can effectively be applied for accurate transcriptomics of subsets of cells within the Drosophila imaginal discs. Indeed, while massive disc preparation as source of RNA generally assumes cell homogeneity, it is well known that transcriptional expression can vary greatly within these structures in consequence of positional information. Using localized fluorescent GFP signal to guide laser cut, more accurate transcriptional analyses can be performed and profitably applied to disparate applications, including transcript profiling of distinct cell lineages within their native context.

Laser Microdissection Applied to Gene Expression Profiling of Subset of Cells from the Drosophila Wing Disc

Laser microdissection was applied to analyse gene expression profiling in specific compartments of Drosophila wing disc subjected to localised RNAi in vivo. RNA extracted from equivalent areas of silenced and unsilenced compartments was analysed by quantitative RT-PCR to determine comparative gene expression profiling within the context of native tissue microecology.

Microdissection לייזר יישומית כדי Gene Expression Profiling של תת קבוצה של תאים מן תסיסנית אגף דיסק

Heterogeneous nature of tissues has proven to be a limiting factor in the amount of information that can be generated from biological samples, ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

שימוש מונה תא אוטומטי כדי לפשט את הביטוי מחקרים ג&#39;ין: siRNA מציאה הביטוי IL 4-Gene תלויים תאים Namalwa

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular signatures, or to evolve proteins in the laboratory. Here, we present a protocol that allows the generation of large (>1011) mutant libraries for a given target sequence. This method is based on replication of a ColE1 plasmid encoding the desired sequence by a low-fidelity variant of DNA polymerase I (LF-Pol I). The target plasmid is transformed into a mutator strain of E. coli and plated on solid media, yielding between 0.2 and 1 mutations/kb, depending on the location of the target gene. Higher mutation frequencies are achieved by iterating this process of mutagenesis. Compared to alternative methods of mutagenesis, our protocol stands out for its simplicity, as no cloning or PCR are involved. Thus, our method is ideal for mutational labeling of plasmids or other Pol I templates or to explore large sections of sequence space for the evolution of activities not present in the original target. The tight spatial control that PCR or randomized oligonucleotide-based methods offer can also be achieved through subsequent cloning of specific sections of the library. Here we provide protocols showing how to create a random mutant library and how to establish drug-based selections in E. coli to identify mutants exhibiting new biochemical activities.

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Here we demonstrate a simple protocol to create a random mutant library for a given target sequence. We show how this method, which is performed in vivo in Escherichia coli, can be coupled with functional selections to evolve new enzymatic activities.

בחירת הפרוטוקולים mutagenesis ו פונקציונאלי אבולוציה מכוונת של חלבונים א coli</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

ב הכינון במבחנה של ט פעילים castaneum שהטלומרז

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Analysis of Global RNA Synthesis at the Single Cell Level following Hypoxia

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a particular transcriptional program in order to mount an appropriate and coordinated cellular response. The cell possesses several oxygen sensor enzymes that require molecular oxygen as cofactor for their activity. These range from prolyl-hydroxylases to histone demethylases. The majority of studies analyzing cellular responses to hypoxia are based on cellular populations and average studies, and as such single cell analysis of hypoxic cells are seldom performed. Here we describe a method of analysis of global RNA synthesis at the single cell level in hypoxia by using Click-iT RNA imaging kits in an oxygen controlled workstation, followed by microscopy analysis and quantification.&nbsp; Using cancer cells exposed to hypoxia for different lengths of time, RNA is labeled and measured in each cell. This analysis allows the visualization of temporal and cell-to-cell changes in global RNA synthesis following hypoxic stress.

We describe a technique for analysis of global RNA synthesis in hypoxia using imaging. Click-chemistry labeling of RNA has not previously been performed under hypoxia and allows visualization of global RNA changes at the single cell level. This approach complements the existing averaged RNA techniques, allowing direct visualization of cell-to-cell changes in global RNA synthesis.

ניתוח של גלובל RNA סינתזה ברמת התא בודד הבאות היפוקסיה

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a ...

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. However, purifying proteins is sometimes challenging since many proteins are expressed in an insoluble form. When working with difficult or multiple targets it is therefore recommended to use high throughput (HTP) protein expression screening on a small scale (1-4&#160;ml cultures) to quickly identify conditions for soluble expression. To cope with the various structural genomics programs of the lab, a quantitative (within a range of 0.1-100 mg/L culture of recombinant protein) and HTP protein expression screening protocol was implemented and validated on thousands of proteins. The protocols were automated with the use of a liquid handling robot but can also be performed manually without specialized equipment.
Disulfide-rich venom proteins are gaining increasing recognition for their potential as therapeutic drug leads. They can be highly potent and selective, but their complex disulfide bond networks make them challenging to produce. As a member of the FP7 European Venomics project (<a href="http://www.venomics.eu">www.venomics.eu</a>), our challenge is to develop successful production strategies with the aim of producing thousands of novel venom proteins for functional characterization. Aided by the redox properties of disulfide bond isomerase DsbC, we adapted our HTP production pipeline for the expression of oxidized, functional venom peptides in the E. coli cytoplasm. The protocols are also applicable to the production of diverse disulfide-rich proteins. Here we demonstrate our pipeline applied to the production of animal venom proteins. With the protocols described herein it is likely that soluble disulfide-rich proteins will be obtained in as little as a week. Even from a small scale, there is the potential to use the purified proteins for validating the oxidation state by mass spectrometry, for characterization in pilot studies, or for sensitive micro-assays.

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

A protocol for the quantitative, high throughput expression screening and analytical purification of fusion proteins from small-scale Escherichia coli cultures is described and applied to the expression of disulfide-rich animal venom protein targets.

הקרנת תפוקה גבוהה ביטוי כמותי וטיהור יישומים לחלבוני ארס רקומביננטי דיסולפיד עשירים הופק ב<em&gt; א coli</em

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. ...

Transient Expression of Proteins by Hydrodynamic Gene Delivery in Mice

Efficient expression of transgenes in vivo is of critical importance in studying gene function and developing treatments for diseases. Over the past years, hydrodynamic gene delivery (HGD) has emerged as a simple, fast, safe and effective method for delivering transgenes into rodents. This technique relies on the force generated by the rapid injection of a large volume of physiological solution to increase the permeability of cell membranes of perfused organs and thus deliver DNA into cells. One of the main advantages of HGD is the ability to introduce transgenes into mammalian cells using naked plasmid DNA (pDNA). Introducing an exogenous gene using a plasmid is minimally laborious, highly efficient and, contrary to viral carriers, remarkably safe. HGD was initially used to deliver genes into mice, it is now used to deliver a wide range of substances, including oligonucleotides, artificial chromosomes, RNA, proteins and small molecules into mice, rats and, to a limited degree, other animals. This protocol describes HGD in mice and focuses on three key aspects of the method that are critical to performing the procedure successfully: correct insertion of the needle into the vein, the volume of injection and the speed of delivery. Examples are given to show the application of this method to the transient expression of two genes that encode secreted, primate-specific proteins, apolipoprotein L-I (APOL-I) and haptoglobin-related protein (HPR).

In vivo transfection of naked DNA by hydrodynamic gene delivery introduces genes into the tissue of an animal with minimal inflammatory response. Sufficient amounts of gene product are generated such that gene function and regulation as well as protein structure and function can be analyzed.

ביטוי חולף של חלבונים על ידי הידרודינמית ג&#39;ין משלוח בעכברים

Efficient expression of transgenes in vivo is of critical importance in studying gene function and developing treatments for diseases. Over the past ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

הקרנת siRNA לזיהוי יוביקוויטין ורגולטורים מערכת דמויות יוביקוויטין של מסלולים ביולוגיים בתאי יונקים בתרבית

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...