This work was supported by the European Research Council (ERC) Starting Grant, under the 7th Framework Program (Project No. 311122, BioProbe). We thank Dr. Julien Autebert and Marcel Buerge for technical assistance and discussions during the development of the protocol and the platform. Prof. Petra Dittrich (ETH Zurich), Prof. Bradley Nelson (ETH Zurich), Dr. Bruno Michel and Dr. Walter Riess are acknowledged for their continuous support.

1. ראש MFP ואת פלטפורמת ניקוי והכנה הערה: פרוטוקול זה משתמש-בכיוון אנכי היברידית סיליקון זכוכית MFP בראש 15,16. המרכיב סיליקון של הראש מכיל את microchannels, אשר חרוט עד לעומק של 100 מיקרומטר. סיליקון החרוט הוא קשור זכוכית באמצעות מליטת anodic. עיצוב הערוץ מורכב דפוס מורכב משישה ערוצים, שתי כל להזרקה ושאיפה, ושתי להזרקת נוזל הטבילה (איור 1). הערוצים המשמשים להזרקת נוזל טבילה לחדש את התקשורת סביב הדגימה הביולוגית, וכך למנוע הפסדים בשל שאיפה ואידוי. הערוצים הפנימיים והערוצים חיצוניים המשמשים ביצירה הנוכחית הם 100 × 100 מיקרומטר ו -200 × 100 מיקרומטר בהתאמה. ייצור ועיבוד פוסט, ראשי MFP עם ערוצים ברורים רכס מלוטש מתקבלים. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכנת תחנת השאיבה-טיפול נוזלמַנגָנוֹן <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמשו נימים עם 1/16 &#39;&#39; (1.59 מ&quot;מ) קוטר חיצוני ו 0.02 &#39;&#39; (0.51 מ&quot;מ) קוטר פנימי לכל וצינור מחובר המזרקים. וארי גודל נימי מבוסס על יישום ולקבל המחברים ואביזרים המתאימים להתממשק ראש MFP עם מזרקים. השתמש במים ultrapure מקום דילולים נחוצים. </li><li style=";text-align:right;direction:rtl"> מזרקים נקיים (250 - 500 נפח μl) ו בוכנות מזרק על ידי sonication בתמיסה אקונומיקה 0.5% ל-לפני המים ultrapure ופוסט דוקטורנטים ניסויים תא חי. יש לשטוף אותן היטב במים. למלא אותם במים על ידי טבילת הטיפים שלהם לחלוטין בתוך אמבט מי aspirating באמצעות הבוכנה. טהר את הנוזל תוך בתוך אמבט מים עם פיר מזרק פנייה חותמת ביציאה של המזרק. לשאוב טיהור חוזר על פעולה עד שאין בועות אוויר נראים במדורי המזרק. </li><li style=";text-align:right;direction:rtl"> חבר מזרקים מלאים עד משאבות המזרק באמצעות מחברי Luer נעילה. השתמש שסתום מתג רכוב עלמשאבות לכוון את הנוזל מן המזרק לאחת משתי נימים מובילות גם אל ראש MFP או למאגרים הנוזליים (איור 6). (אם לא שסתום מתג זמין ראה סעיף 1.4.4). טהר הוא נימים עם מים מן המזרקים בקצב זרימה של כ 10 - 50 μl / דקה, בהתאם לגודל של המזרק עד כ -10 μl של מים נשאר המזרקים. </li><li style=";text-align:right;direction:rtl"> טרום להכניס את הנימים מטוהרים לתוך מתאם מחבר microfluidic מתאים / אשר ממשקים עם vias הערוץ בראש (למשל, מחבר M1 - ראה חומרים). </li></ol></li><li style=";text-align:right;direction:rtl"> הכנת ראש MFP <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> נקו את הראש MFP ידי sonication משימוש בחומרי ניקוי זכוכית לניקוי רגיל או אקונומיקה 0.5% לניקוי מחמירים, במשך 5 דקות. טהר ערוצים במים על ידי טבילה במים איפקס וליישם ואקום vias. </li><li style=";text-align:right;direction:rtl"> בדוק ערוצים תחת סטראו עבור חסימות פוטנציאל (סתימה) מחדשכבול בשלב הקודם במידת הצורך. </li><li style=";text-align:right;direction:rtl"> הר הראש נקי על בעל ראש הבורג המחבר עם צינורות טרום מוכנס מטוהר על ראשו. בורג בעל ראש לבמה-Z, המשמש לשליטה על מרחק הפער בין הראש monolayer התא. </li></ol></li><li style=";text-align:right;direction:rtl"> כיול בשלבי הסריקה של פלטפורמת MFP <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בצע כיול נקודת סיום של ה- X, א- ו- Z-שלבים לפני מחבר את הראש אל הרציף, על פי הפרוטוקול של היצרן עם ממשק תוכנה מתאים. בשלבים מכוילים להבטיח דיוק במיצוב ראש MFP. </li><li style=";text-align:right;direction:rtl"> השג מרחק פער אפס גולמי (איפוס) על ידי הבאת ראש MFP מעל שקופית קאמרית ללא תאים ויורד לאט 5 מיקרומטר צעדים. במגע בדיקה עם המצע, הטבעות של ניוטון יש לשים לב. זוהי הערכה גסה. עמדה מדויקת שתופק לאחר התאמת coplanarity של הקודקוד החללי אל substratדואר. </li><li style=";text-align:right;direction:rtl"> כדי להבטיח coplanarity של הקודקוד החללי, לכוונן את הטיית הראש באמצעות goniometer (על הממשק של ראש במת Z). כאשר נוצר להבטיח כי הטבעות של ניוטון הן סימטרי (איור 1). הזז את מיקרומטר MFP ראש 20 מן המצע ולהתאים להטות באמצעות goniometer. יורד חזרה, מתאפס וכוונון להטות עד הטבעות של ניוטון הם סימטריים על קשר. עם הטיה מותאמת, לקבוע את מיקום z המייצר טבעות ניוטון סימטריות כמו אפס. הערה: בשלב Z שולט ראש אל מצע המרחק, ואילו בשלב XY שולט הסריקה של המצע (איור 2). ניתן למצוא הסבר מפורט ב קודם לכן עבודתנו 14. </li></ol></li><li style=";text-align:right;direction:rtl"> הכנות כימיות להסרה מקומית של שכבות תאים זהירות: במקרה הצורך, ציוד בטיחות השימוש (למשל, כפפות ניטריל, משקפי מגן) עבור כימיקלים שמכינים. השתמש hoo קטרד אם הדרושות להכנת פתרונות. הכן את כל כימיקלי המאגרים עם מי ultrapure כמו diluent. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כן 50 פתרון המ&quot;מ NaOH בעוד נוזל העיבוד לערוץ ההזרקה הפנימי (i2 עם I2 Q הזרימה באיור 1). </li><li style=";text-align:right;direction:rtl"> הכן את פתרון חיץ החילוץ הנדרש הזרקה החיצונית (i1 עם I1 Q הזרימה באיור 1), מורכב 1 מ&quot;מ חומצת ethylenediaminetetraacetic (EDTA), 0.5% Tween 20, ו -10 מיקרומטר rhodamine B ב 50 המ&quot;מימ טריס (hydroxymethyl) aminomethane ב pH 8. הקאה, להשתמש מי מזרקי השאיפה. </li><li style=";text-align:right;direction:rtl"> לסנן את כל פתרונות באמצעות מסנן מזרק 0.2 מיקרומטר. דגה כל הפתרונים המסוננים באמצעות ייבוש עד תחנת האוויר המומסת מבעבעת על פני השטח. </li><li style=";text-align:right;direction:rtl"> באמצעות קו הניקוז מחובר משאבות המזרק, לטהר את המים שריד לשאוב פתרונות degassed לתוך מזרקי ההזרקה ב 40 μl / min עד המזרקים מלאים (250 או 500 μl).הדבר מבטיח מילוי חינם בועות של מזרקים, מחברים, ונימים. שסתום ושתיים נימי מזרק-מתג המערכת מאפשרת מילוי של מזרקים באמצע הניסוי. בהעדר מתג שסתום כגון, ניתק את הנימים מהראש ולמלא נימים ואת המזרק ידי aspirating פתרונות degassed לפני החיבור מחדש להם בראש. </li><li style=";text-align:right;direction:rtl"> Aspirating עיבוד מגן נוזלים דרך הנימים מאפשר שימוש של כמויות קטנות במהלך המבצע. אם הכימיקלים ניתן להכין בכמויות גדולות, למלא מזרקים עם הפתרונות הנדרשים ישירות. לדוגמא, מזרקי השאיפה המכילים מים ניתן למלא באמצעות גישה זו. </li><li style=";text-align:right;direction:rtl"> טהר את הנימים לראש MFP עם הנוזלים שהוקצו עבור כל ערוץ כהגדרתו 1.4.1 ו 1.4.2. הערה: פתרון חיץ החילוץ מגן על NaOH ב הכליאה הפנימית ואת רכיב rhodamine למאגר מקל על ויזואליזציה של הדואר hHFC במהלך המבצע. </li><li style=";text-align:right;direction:rtl"> אם התאים יתר ומחוברות, עם אגרגטים תא המופיעים על פני השטח תרבותי, להשלים את מיצוי חיץ עם 10% proteinase ק אלה משלימים את הפעולה של NaOH על אגרגטים אלה על ידי המסת חלבונים מפוגל כמו lysate נכנס ערוצי שאיפה. הדבר מונע סתימת ערוצי במהלך המבצע. </li></ol></li><li style=";text-align:right;direction:rtl"> הכנת monolayers התא בשקופיות קאמרית זהירות: השתמש ברדס תרבית תאים עבור culturing התאים ולטפל ציוד על פי התקנות שנקבעו על ידי קצין הבטיחות הביולוגי של המעבדה. הערת דרישות מיוחדות של שורות תאים ספציפיות להתאים את הפרוטוקול וציוד בהתאם. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש תא חממות תרבות (ב 5% CO 2 ו ב 37 ºC) לתרבות והרחבת התאים להיות בדוגמת. בצע את ההתרחבות באמצעות פרוטוקולי תרבית תאים סטנדרטיים 17,18 צלוחיות T. השתמש בחומרי הדפסת culturing לפי דרישות של cel הספציפיl קו (למשל, סרום אנטיביוטיקה בתוספת DMEM עבור culturing MCF7 ו MDAMB 231). </li><li style=";text-align:right;direction:rtl"> בהגיעו מפגש תא צלוחיות תרבות, trypsinize ולאסוף תאים וזרעי 2 × 10 5 תאים / 2 ס&quot;מ בכל אחת השקופיות 2 קאמרית עבור דפוסים והתרבות מעל 48 שעות. השתמש תאים באחד החדרים כביקורת על גדילת תא כדאי. </li><li style=";text-align:right;direction:rtl"> בהגיעו מפגש תא בשקופיות הקאמריות, דגירת התאים במשך 45 דקות עם 500 פתרון לצבוע μl תא-גשש (למשל, ירוק - CMFDA או כתום - CMRA) בשעת 10 ריכוז מיקרומטר ערוך סרום ללא בינוני. הדבר נעשה להדמית תא במהלך דפוסים. שוטף את התאים שכותרתו עם PBS על ידי שטיפת כל תא בעדינות בעזרת פיפטה, ולאחר מכן תרבות תאי מדיה-בתוספת סרום עבור ניסויי דפוסים. </li><li style=";text-align:right;direction:rtl"> השג תמונת ייחוס של פני התא מוכתם תאי הגשש לצורך ספירת תאים. הדבר נעשה על מנת להבטיחconfluency של שכבת התאים. בנוסף, הוא משמש ככלי עזר עבור ניסויי כימותים אם התאוששות מדגם וניתוח DNA הם מטרות. הערה: במקרה זה כדאיות התא תוערך במהלך דפוסים, התאים יכולים להיות מוכתם ערכת cytotoxicity Live / Dead בהתאם להוראות היצרן. </li></ol></li></ol> 2. יצירת מאסר זרימת הידרודינמית המבנה ההיררכי (hHFC) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הזז את MFP מעל monolayer תא עד למרחק פער של 50 מיקרומטר משקופית הזכוכית. מרחק פער זה תוך הבטחת מגע של hHFC בחשבון גם משטח בשכבה וריאציה עובי. </li><li style=";text-align:right;direction:rtl"> להזריק NaOH ב -6 או 8 μl / min דרך i2. הערכת ספיקות אחרות (כלומר, ש I1, ש A1 ו- Q A2) באמצעות חוקי הזרימה באיור 3. </li><li style=";text-align:right;direction:rtl"> לווסת את גודל HFC הפנימי על ידי שינוי היחס של Q I2 / Q I1 באמצעות מזרקי ההזרקה.לדוגמה, השתמש Q I1 בין 1.3 μl / min ו -4 μl / דקה, עם ש I2 קבוע ב 8 μl / min, שתוצאתה טביעת רגל NaOH של 150 - 300 תאים (100 - 200 מיקרומטר 2 / תא) ( 3D איור). </li><li style=";text-align:right;direction:rtl"> להזריק בינוני מלא מן הפתחים-החיצוניים ביותר על ראש MFP בקצב זרימה של 20 μl / min לתת דין וחשבון על אידוי של התקשורת ושל השאיפה במהלך המבצע של hHFC. </li></ol> 3. monolayers תא דפוסי שימוש hHFC הערה: תבנית הסריקה קובעת בתחומים בשכבת התא שבו התאים מחולצים (דפוסי תוסף), עוזבים את התאים הנותרים ללמוד שאלות ביולוגיות ספציפיות. דפוס זה יכול להיות קווים ישרים או מערך של כתמים, למשל. תבניות מורכבות דורשות עיצוב של מסלול סריקה מתאים. לדוגמא, מסלול סריקה משובץ מספק רשת של אזורי תא (מוצג למשל איור 4 א </strong&gt;), אשר יאפשר אשר בדק את השפעתו של גירויים שונים על תאי ריבועים שונים בעת היותו בסמיכות. ניתן ליצור דפוסים אלה באמצעות שליטה בשלבי XY של הפלטפורמה, שבו תוכנות השליטה מאפשרת scripting של מסלולי סריקה עבור ראש MFP על monolayer התא. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הגדר את תוכנת הבמה כדי לסרוק את ראש הבדיקה על monolayer התא בדפוסים המוגדר על ידי משתמש (על ידי הגדרת X, Y ו- Z קואורדינטות) בכל מהירות סריקה של 10 מיקרומטר / s במרחק פער של 50 מיקרומטר. </li><li style=";text-align:right;direction:rtl"> עם hHFC מקוננות במבצע במגע עם monolayer, לסרוק את MFP עם מסלולו של התבנית הרצויה לבצע הסרת תא בדוגמת. </li><li style=";text-align:right;direction:rtl"> עבור שיתוף תרבות לאחר הסרת תאי הסוג הראשונה, זרע קו תאים שונה כדי למלא את הפערים, תוך שימוש בשיטות המתוארות בסעיף 1.5. לעבור בין מצבים מקוננים וצבטו (על ידי הגדלת מרחק פער, למשל) כדי לשלוט הסרת תאים. הערה: מהירות הסריקה יכולה להיות investiמגודר עבור שורות תאים אחרות. מהירויות הסריקה המשמשות להסרת תאים להשלים תופעות הפגנה הזאת מעל האזורים סרקו את שטח שורות תאים בשימוש. </li></ol> 4. עיבוד במורד זרם עבור הגברת הדגימה ו- DNA <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן את תחנת דגימה לניתוח במורד הזרם של lysate. עבור תחנת הדגימה, להשתמש 3D מודפס 8-פס בעל צינור PCR. לחלופין, בחר בעל צינור מתאים לשמש מתאם זה, שהוא מסוגל להיות רכוב בטווח סריקה של הראש מחוץ המצע. נגב את בעל צינור עם 70% אתנול או decontaminants משטח אחר המבוססים על חומרא הרצוי עבור היישום. השתמש קליפ מגנטי על בעל צינור לצרף אותו על בעל המצע. </li><li style=";text-align:right;direction:rtl"> לאחר הכנת תחנת הדגימה, מקמו את מיקרומטר MFP ראש 100 מ בשכבה. בגין הפעלת hHFC עם 50 פתרון המ&quot;מ NaOH בעוד נוזל העיבוד לערוץ ההזרקה הפנימי עם ספיקות של 1, 6, -7 ו -17.5 μl / min ש I1, I2 Q, Q A1 ו- Q A2 בהתאמה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לאחר כליאת הזרימה התייצבה (ב כ 10 שניות), יורד ראש החללית למרחק פער של 50 מיקרומטר לבצע תמוגה מקומית המבוססת NaOH של תת-האוכלוסייה הנבחרת של תאים עם hHFC. לאחר תמוגה של האוכלוסייה משנה תושלם (כ -30 שניות לכל טביעת הרגל), לכוון את הראש כלפי הצינורות בתחנת הדגימה. הוצא את lysate שנאסף לתוך צינורות PCR ישירות (איור 6). </li></ol></li><li style=";text-align:right;direction:rtl"> עבור עיבוד במורד הזרם של lysate, הראשון לנטרל את ה- pH של התמיסה על ידי ערבוב של lysate עם טריס חיץ (1: 1). לאחר נטרול, לחמם את lysate ל -95 ºC למשך 30 דקות. ואז ישירות לטעון את lysate לתוך עבודת qPCR סטנדרטית כפי שנקבע על ידי ספק של המכשיר. </li></ol>

<ol>
	<li>Th&#233;ry, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micropatterning+as+a+tool+to+decipher+cell+morphogenesis+and+functions.">Micropatterning as a tool to decipher cell morphogenesis and functions.</a> J. Cell Sci. 123 (Pt 24), 4201-4213 (2010).</li><li>Goubko, C. A., Cao, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patterning+multiple+cell+types+in+co-cultures:+A+review.">Patterning multiple cell types in co-cultures: A review.</a> Mater. Sci. Eng. C. 29 (6), 1855-1868 (2009).</li><li>Kaji, H., Camci-Unal, G., Langer, R., Khademhosseini, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+systems+for+the+generation+of+patterned+co-cultures+for+controlling+cell-cell+interactions.">Engineering systems for the generation of patterned co-cultures for controlling cell-cell interactions.</a> Biochim. Biophys. Acta. 1810 (3), 239-250 (2011).</li><li>Cho, C. H., Park, J., Tilles, A. W., Berthiaume, F., Toner, M., Yarmush, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Layered+patterning+of+hepatocytes+in+co-culture+systems+using+microfabricated+stencils.">Layered patterning of hepatocytes in co-culture systems using microfabricated stencils.</a> Biotechniques. 48 (1), 47-52 (2010).</li><li>Sch&#252;tze, K., Lahr, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+expressed+genes+by+laser-mediated+manipulation+of+single+cells.">Identification of expressed genes by laser-mediated manipulation of single cells.</a> Nat. Biotechnol. 16 (8), 737-742 (1998).</li><li>Salazar, G. T. A., Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micropallet+arrays+for+the+separation+of+single,+adherent+cells.">Micropallet arrays for the separation of single, adherent cells.</a> Anal. Chem. 79 (2), 682-687 (2007).</li><li>Guillaume-Gentil, O., Zambelli, T., Vorholt, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+single+mammalian+cells+from+adherent+cultures+by+fluidic+force+microscopy.">Isolation of single mammalian cells from adherent cultures by fluidic force microscopy.</a> Lab Chip. 14 (2), 402-414 (2014).</li><li>Iwata, F., Adachi, M., Hashimoto, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single-cell+scraper+based+on+an+atomic+force+microscope+for+detaching+a+living+cell+from+a+substrate.">A single-cell scraper based on an atomic force microscope for detaching a living cell from a substrate.</a> J. Appl. Phys. 118 (13), (2015).</li><li>Riahi, R., Yang, Y., Zhang, D. D., Wong, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+wound-healing+assays+for+probing+collective+cell+migration.">Advances in wound-healing assays for probing collective cell migration.</a> J. Lab. Autom. 17 (1), 59-65 (2012).</li><li>Juncker, D., Schmid, H., Delamarche, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multipurpose+microfluidic+probe.">Multipurpose microfluidic probe.</a> Nat. Mater. 4 (8), 622-628 (2005).</li><li>Kaigala, G. V., Lovchik, R. D., Delamarche, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics+in+the+&amp;#34;open+space&amp;#34;+for+performing+localized+chemistry+on+biological+interfaces.">Microfluidics in the &amp;#34;open space&amp;#34; for performing localized chemistry on biological interfaces.</a> Angew. Chem. Int. Ed. Engl. 51 (45), 11224-11240 (2012).</li><li>Qasaimeh, M. A., Gervais, T., Juncker, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+quadrupole+and+floating+concentration+gradient.">Microfluidic quadrupole and floating concentration gradient.</a> Nat. Commun. 2 (May), 464 (2011).</li><li>Christ, K. V., Turner, K. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+of+hydrodynamically+confined+microfluidics:+controlling+flow+envelope+and+pressure.">Design of hydrodynamically confined microfluidics: controlling flow envelope and pressure.</a> Lab Chip. 11 (8), 1491-1501 (2011).</li><li>Autebert, J., Kashyap, A., Lovchik, R. D., Delamarche, E., Kaigala, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hierarchical+hydrodynamic+flow+confinement:+efficient+use+and+retrieval+of+chemicals+for+microscale+chemistry+on+surfaces.">Hierarchical hydrodynamic flow confinement: efficient use and retrieval of chemicals for microscale chemistry on surfaces.</a> Langmuir. 30 (12), 3640-3645 (2014).</li><li>Kaigala, G. V., Lovchik, R. D., Drechsler, U., Delamarche, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Vertical+Microfluidic+Probe.">A Vertical Microfluidic Probe.</a> Langmuir. 27 (9), 5686-5693 (2011).</li><li>Cors, J. F., Lovchik, R. D., Delamarche, E., Kaigala, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+compact+and+versatile+microfluidic+probe+for+local+processing+of+tissue+sections+and+biological+specimens.">A compact and versatile microfluidic probe for local processing of tissue sections and biological specimens.</a> Rev. Sci. Instrum. 85 (3), 034301 (2014).</li><li>Pollard, J. W., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Basic Cell Culture Protocols. , (1997).</li><li>Mitry, R. R., Hughes, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+cell+culture+protocols.">Human cell culture protocols.</a> Methods Mol. Biol. Springer. 531 (1), (2012).</li><li>Sakai, K., Ushida, T., Nagase, T., Nakamigawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+cell+detachment+by+shear+stress.">Quantitative analysis of cell detachment by shear stress.</a> Mater. Sci. Eng. C. 17 (1-2), 55-58 (2001).</li><li>Rodriguez, N. M., Desai, R. A., Trappmann, B., Baker, B. M., Chen, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micropatterned+multicolor+dynamically+adhesive+substrates+to+control+cell+adhesion+and+multicellular+organization.">Micropatterned multicolor dynamically adhesive substrates to control cell adhesion and multicellular organization.</a> Langmuir. 30 (5), 1327-1335 (2014).</li><li>Tasoglu, S., Demirci, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioprinting+for+stem+cell+research.">Bioprinting for stem cell research.</a> Trends Biotechnol. 31 (1), 10-19 (2013).</li></ol>

The authors have nothing to disclose.

אנו מציגים פרוטוקול צדדי עבור דפוסי התוסף של monolayers תא, המאפשרים לדור מהיר של תבניות תא מוגדרות מרחבית. תמוגה סלקטיבי של monolayers התא מתבצעת באמצעות NaOH בעוד נוזל עיבוד hHFC. NaOH מידה denatures החלבונים הכלולים קרום התא. אנו ממליצים על שימוש של ריכוז 50 מ&quot;מ של NaOH כדי להבטיח עיבוד במורד הזרם של lysate. ריכוז זה יכול להיות מוגבר להסרת תאים מהירים יותר, העיבוד במורד זרם lysate שסופק אינו אובייקטיבי. HHFC מבטיח כי בסביבותיה לא מעובדים של monolayer תא נותרות בעינן וזמינים גם הרחבת דפוס או חיטוט נכסים נוספים של התאים. שיעור הסרת תאים היא פונקציה של שני בכימיה גזירה שהציג את הזרימה. אנחנו בוחרים טווח הפעלה של ספיקות יש הסרת תאי כימיה דומיננטית. מהירויות סריקה של 10 - 20 &amp; #181; מ &#39;/ שני באמצעות קצב זרימת הזרקת NaOH של 6 - 8 μl / min משמש כדי להקל דפוסי תוסף&#39; מהירים &#39;. הקצב המהיר של הסרת תאים כמה כתובות אתגרים העומדים בפני דפוס משטח דפוסים מבוססי גישות 20,21. שיטות אלו דורשים מנגנון שמגביל את הצמיחה של תאים באזורים המוגדרים מרחבית, למשל, על ידי בתצהיר סלקטיבית של חלבונים הידבקות התא באמצעות הדפסה מיקרו מגע וזריעה הבאות של תאים כדי להשיג את התבנית. הם מוגבלים על ידי תפוקה נמוכה ודורשים כמה צעדים רציפים עבור דור דפוס וכן חותמת / סטנסיל חדשה עבור כל תבנית. השיטה המתוארת אינה דורשת צמיחה סלקטיבית של תאים על אזורים מוגדרים, מתגברת מספר מגבלות על ידי ביצוע דפוסי תוסף בניגוד הדפסה, בעוד שאינה דורש כל טיפול נוסף של מצע תרבית תאים. עם הפרוטוקול המתואר במאמר זה, התפוקה של monolayers תא דפוסיםהוא גדל, תוך קבלת משוב חזותי מיידי של הדפוס שנוצר. זה הופך לפשוט שינוי בזמן אמת של תבניות. שליטה כזו תהיה חיונית תרחישים בהם כדאיות התא על משטח נתון אינה הומוגנית. יתרון נוסף של השיטה הוא אותו הראש והכימיה יכולים לשמש כדי ליצור דפוסים מרובים, ובכך להפחית את מספר הצעדים המעורבים ביצירת monolayer תא בדוגמת. הממדים של הערוצים בראש גיאומטרית הראש וניתן לשנותם בהתאם לדרישות של היישום, ובכך מאפשרים שליטה על ההחלטה של ​​הדפוסים. כל הניסויים בעבודה הנוכחית בוצעו באמצעות ראש MFP עם ממדי צמצם קבועים, במיוחד עם פתחים פנימיים ב 100 × 100 מיקרומטר ו פתחים חיצוניים ב 200 × 100 מיקרומטר. עיצוב זה עם פתחים חיצוניים גדולים נבחר על מנת להבטיח פעולה רציפה של hHFC מבלי לסתום של הפתחים ידיפסולת תא תועה. בדקנו ראשים עם ממדי צמצם פנימיים 50 × 50 מיקרומטר ו 50 מיקרומטר רווחים ביניהם, עם תוצאות מוצלחות הסרת תאים. השתמש פתחים קטנים, עד 10 × 10 מיקרומטר עם 10 מיקרומטר מרווחים, ותאפשר דרוגים לגודל טביעת רגל קטן יותר (~ 30 × 30 מיקרומטר), ובכך לאפשר רזולוציה גבוהה דפוסים. צפינו ונושאים תפעוליים עם צמצם בגדלים קטן יותר מ -10 מיקרומטר עקב סתימה מ וחלקיקים. בגלל קשיים תפעוליים כגון, 100 מיקרומטר הוא הגבול הנוכחי של רזולוציה ולכן מגבלה של הטכניקה המתוארת. עם זאת, אנו יכולים לתת מענה זה באמצעות היכולת בעיצוב הנוזלית של hHFC. אנחנו הוכחנו כי ההחלטה של הסרת תאים יכולה להיות מכוונת עבור קבוצת נתונה של ממדי צמצם ידי השליטה ש I2 / Q ט &#39;1 (איור 4 ב) ופער איפקס אל מצע 10,14. השלבים המשמשים העבודה הנוכחית יש גודל צעד מינימאלי של 100 ננומטר.שילוב של פרמטרים לשליטה אלה יכול לשפר את הרזולוציה המרחבית של הסרת תאים במונחים של גודל טביעת הרגל ומרחק סריקה. אם שיתוף תרבויות בדוגמת הם רצויים כדי לחקור אינטראקציות תאי תאים ספציפיות בין סוגי תאים שונים, זריעת רציפי דפוסים יכולים להתבצע באמצעות הפרוטוקול המתואר. לבסוף, DNA amplifiable באיכות גבוהה ניתן להשיג מן lysate, כפי שבאו לידי ביטוי על ידי השיא היחיד ב- DNA להמס עקומה (ראה איור 7). הערכנו כמות ה- DNA של כ -1.6 ng מן טביעת רגל אחת (כ -300 תאים) באמצעות qPCR, מקורב הציפייה תיאורטית (6-8 pg / תא). דבר זה מצביע על כמות ה- DNA החילוץ המתאים מספר תהליכים במורד תוך שלילת שימוש בכל שיטות בידוד DNA. זה פותח אפיקי DNA-ניתוח מקומי מבוסס חיטוט של תאים בתרבית. היכולת של hHFC לעצב נוזלים יכול לשמש גם להפקיד תאים וחלבונים חיו על acמשטחי tivated, אשר בשילוב עם דפוסי התוסף ושיתוף culturing הרציף שהוצגו בפרוטוקול זה מאפשר יצירת דפוסי תא ותא-מטריצה ​​מורכבים על מצעי תרבות. הרבגוניות ואת השליטה המתאפשרת על ידי דפוסי תוסף מבוססים hHFC של monolayers תא ואת האפשרות של ביצוע ניתוח דנ&quot;א על ​​תאי חילוץ, מספק כלי חדש ורב עצמה מוגדרת ביולוגים לבצע מחקרים שכללו אינטראקציות תא נפתרו מרחבית.

בסביבה מולדתם, תאים ברקמות ביולוגיות תופסים מגוון של רמזים ביוכימיים ופיזיים בהכוונת הצמיחה, הארגון שלהם, ופיתוח. הבנת רמזים אלה מחייב חקירה סלקטיבית של אינטראקציות תאים תאים ותא-מטריקס. זה מחייב פיתוח של שיטות monolayers התא דפוסים. שיטות תאים מסוגים שונים נפרדים גיאומטרי בתרבות (דפוסים) לאפשר לימודים רחבים של רמזים פיסיים וכימיים בביולוגיה של תא. רוב הגישות הנוכחיות עבור שכבות תאי דפוסים 1 - 4 תלוי הפקדת חלבונים-הידבקות תא על גבי משטחים או באמצעות שבלונות microfabricated לצמיחה סלקטיבית על מצעים. לעומת זאת, כאן אנו מציגים שיטת monolayers תא דפוס במהירות באתרו, כלומר, תאים בתרבית, על ידי הסרת תאים באזורים נבחרים של בשכבה. שיטות מבצע דפוסי תוסף כזה 5 - 9 usually דורש מצעים מיוחדים, טיפול פני שטח, מבצע מורכב, מגע פיזי או אבלציה באמצעות ליזר, המשפיע על תאי חיים בטעות. אנחנו כאן להשתמש בדיקת microfluidic (MFP) 10,11, טכנולוגית microfluidic סריקה ללא מגע כי hydrodynamically תוחמת נוזל על מצע. אחד המרכיבים החשובים של MFP הוא ראש microfabricated המכיל microchannels (איור 1). הפלטפורמה הקשורה מורכבת משאבות מזרק לבקרה נוזלית, בשלבים לסריקה מלא מיקרוסקופ הפוכה להדמיה ומשוב (איור 2). בתצורה הבסיסית שלו, ראש MFP כולל שני microchannels עם פתחים בשיא, אחד להזרקת נוזל עיבוד ושני עבור aspirating נוזל העיבוד מוזרק יחד עם מעט נוזל טבילה (איור 3 א). במהלך מבצע MFP, איפקס הוא במרחק קבוע מן המצע. כאשר קצב זרימת שאיפה (QA) הוא sufficiently גבוה משיעור זרימת זריקה (אני Q), כלומר, Q א: Q אני ≥ 2.5, נוזל העיבוד מוגבל על פני המצע. התוצאה היא כליאה זרימה הידרודינמית (פיקוד העורף). האזור שבו נוזל העיבוד נמצא בקשר ישיר עם המצע נקרא את טביעת הרגל. לקבלת תנאי הפעלה טיפוסיות, את זרימת נוזל העיבוד בתוך HFC מאופיין מספר ריינולדס נמוך (Re ≈ 10 -2) ומספר Péclet הגבוה (PE ≈ 10 2). זה מרמז תזרימי נזילים המשטר למינרית בלהיות הסעה במצב הראשוני של העברת מסה של לתרכובות כימיות. המודלים המספריים ואנליטית כליאת זרימה מתואר במקומות אחרים 12 - 14. במאמר זה, אנו משתמשים בגישה של נוזלי עיבוד מרובים כליאת זמנית, אשר נקראת HFC ההיררכי (hHFC) 14. כדי ליישם hHFC עם MFP, שני additionaפתחי l נדרשים לספק מקור משני של הזרקה ושאיפה. זה מאפשר לנו להגביל נוזל אחד בתוך נוזל שני. היתרונות הפנימיים (עיבוד) הנוזלים מלהיות מוגנים מפני פסולת תועה על פני המצע על ידי הנוזל החיצוני (מיגון). בנוסף, hHFC מאפשר פעולה בשני מצבים: (i) המצב המקונן, שבו נוזל העיבוד במגעי HFC הפנימיים פני השטח (איור 3), וכן (ii) במצב הצבוט, שבו הנוזל הפנימי מאבד קשר רק הנוזל החיצוני נמצא בקשר עם המצע (איור 3 ג). מעבר בין שני המצבים מאפשר למשתמשים לבצע או להפסיק את טיפול המצע מושג על ידי שליטה על הראש-קרקע הפער או על ידי שינוי היחס בין שני שיעורי זרימת ההזרקה (Q i2 / Q i1). עבור גיאומטרית ערוץ נתונה, את טביעת הרגל של נוזל העיבוד על פני המצע יכולה להיות נשלטה על ידי ויסות תנאי זרימה (איור 3D). נתרן hydrתחמוצת (NaOH) משמשת נוזל העיבוד הפנימי lyse התאים, ואת lysate הוא aspirated ברציפות מפני השטח. מכיוון ההשפעות הכימיות של נוזל העיבוד הן נקודות כדי טביעת רגל HFC הפנימית, מהתאים הסמוכים להישאר רגועים, המאפשר מחקרי spatiotemporal של אינטראקציות תאי תאים. פונקציונלי הסריקה של MFP מאפשרת יצירת גיאומטריות המוגדרים על ידי משתמש של דפוסי תא (איור 4). יתר על כן, הבחירה של NaOH כמו נוזל עיבוד להכיל ניתוח דנ&quot;א במורד הזרם (איור 7).

<table><tbody><tr><td colspan="4">&lt;strong&gt;Materials&lt;/strong&gt;</td></tr><tr><td>Microfluidic Probe (MFP)</td><td></td><td></td><td>Silicon/glass hybrid probe head with channels patterned in silicon. Fabrication done in-house at IBM Research - Z&amp;uuml;rich</td></tr><tr><td>Lab Tek II Chamber slides with 2 chambers</td><td>ThermoFisher scientific, USA</td><td>154461</td><td>2 Chamber chamber slides for cell culture with each chamber providing an area of 4 cm&lt;sup&gt;2&lt;/sup&gt; and capable of holding up to 3 ml of media volume</td></tr><tr><td colspan="4">&lt;strong&gt;Chemicals and cell lines&lt;/strong&gt;</td></tr><tr><td>Sodium Hydroxide, Tris-Cl, Ethylenediaminetetraaceticacid, Rhodamine B</td><td>SigmaAldrich chemicals, USA</td><td>S5881, 252859,&amp;nbsp; E9884, R6626</td><td>Chemicals used for processing and shielding liquids</td></tr><tr><td>Proteinase K</td><td>Qiagen, Germany</td><td>19131</td><td>protease to digest denatuired proteins</td></tr><tr><td>Deconex 16 Plus</td><td>Bohrer Chemie, Switzerland</td><td></td><td>Universal cleaning agent for labaratory consumables. Used for non stringent cleaning.</td></tr><tr><td>DNA away&amp;nbsp;</td><td>ThermoFisher scientific, USA</td><td>7010</td><td>Surface decontaminant that denatures DNA and DNAases.</td></tr><tr><td>DMEM, high glucose, GLUTAMAX supplement</td><td>ThermoFisher scientific, USA</td><td>10566-016</td><td>Culturing medium for epithelial cells.</td></tr><tr><td>CellTracker Green CMFDA dye</td><td>ThermoFisher scientific, USA</td><td>C7025</td><td>Membrane permeant live cell labeling dye. Dye active for 72 hours.</td></tr><tr><td>CellTracker Orange CMRA dye</td><td>ThermoFisher scientific, USA</td><td>C34551</td><td></td></tr><tr><td>&amp;beta;-actin genomic primers for qPCR</td><td>Integrated DNA technologies, USA</td><td></td><td>Custom oligos used for DNA quality validation and qPCR.</td></tr><tr><td>MCF7 breast carcinoma cells</td><td>ATCC, USA</td><td>ATCC HTB-22</td><td>Cell lines used to produce co-cultures.</td></tr><tr><td>MDA-MB-231 breast carcinoma cells</td><td>ATCC, USA</td><td>ATCC HTB-26</td><td></td></tr><tr><td colspan="4">&lt;strong&gt;Equipment and fluidic connections&lt;/strong&gt;</td></tr><tr><td>Motorized high precision stages</td><td>Custom machined components.&amp;nbsp; Linear axis motors from LANG GmBH, Germany</td><td>Customized linear axis stages from LT series</td><td>3 &amp;times; LT for 3 axes. LSTEP controller used for interfacing stages and PC through RS 232 port.</td></tr><tr><td>Syringes</td><td>Hamilton, Switzerland</td><td>1700 TLLX series</td><td>Interchangeable with syringes provided by other manufacturers with a 250-500 &amp;micro;l range.</td></tr><tr><td>Nemesys low pressure syringe pumps</td><td>cetoni GmbH, Germany</td><td></td><td>Component of pumping station.</td></tr><tr><td>Circular M1-connector</td><td>Dolomite microfluidics, United Kingdom&amp;nbsp;</td><td>3000051</td><td>Interface between vias in MFP head and tubing</td></tr><tr><td>Tilt/rotation stage Goniometer</td><td>OptoSigma, USA</td><td>KKD-25C</td><td>Goniometer to adjust coplanarity of MFP apex</td></tr><tr><td>DS Fi2 HD color camera (CCD)&amp;nbsp;</td><td>Nikon, Switzerland</td><td></td><td>Controlled using DS-U3 controller unit</td></tr><tr><td colspan="4">&lt;strong&gt;Software&lt;/strong&gt;</td></tr><tr><td>Win - Commander</td><td>LANG GmBH, Germany</td><td></td><td>Stage control software.</td></tr><tr><td>Qmix Elements</td><td>cetoni GmbH, Germany</td><td></td><td>Pump control software.</td></tr><tr><td>NIS Elements</td><td>Nikon, Switzerland</td><td></td><td>Basic research module for image acquisition and analysis.</td></tr></tbody></table>

rapid subtractive patterning of live cell layers with a microfluidic probe

החללית microfluidic (MFP) הופך לפשוט ביצוע כימיה המקומית על מצעים ביולוגיים ידי כליאת כרכים nanoliter של נוזלים. באמצעות יישום המיוחד של MFP, כליאת הזרימה הידרודינמית ההיררכית (hHFC), נוזלים מרובים מובאים במקביל מגעים עם מצע. פעולה כימית מקומית ועיצוב נוזלי באמצעות hHFC, מנוצל כדי ליצור דפוסי תא על ידי מקומי lysing והסרת תאים. על ידי ניצול יכולת הסריקה של MFP, דפוסים המוגדר על ידי משתמש של monolayers תא נוצרים. פרוטוקול זה מאפשר דפוסים תאים מהירה, בזמן אמת ומבוקר מרחבית, אשר יכול לאפשר מחקרים אינטראקציה תאים תאים ותא-מטריקס סלקטיבית.

הפרוטוקול המתואר עבור דפוסי תוסף מהירים של monolayers התא מודגם באמצעות פלטפורמת MFP מרכיב רבה (איורים 1 ו -2). הפרוטוקול מעסיק כליאת הזרימה הידרודינמית ההיררכית (hHFC; איור 3) כדי מקומית לטפל ולהסיר תאי monolayers תא, באמצעות NaOH בעוד נוזל העיבוד. תצורת hHFC כוללת HFC פנימי לבין פיקוד עורף חיצוני. מרותק NaOH ב hHFC הפנימי מציג פעולה כימית גזירה על התאים במגע. בתוך טביעת רגל זה, התאים נחשפים בצורה הומוגנית על הפעולה הכימית של NaOH, בשל העברת מסה מונעת הסעה בתוך עם דיפוזיה זניח לאזור מחוץ הכליאה. גזירה על התאים מצד שני, ניתן לשנות על ידי שינוי קצב הזרימה של NaOH. כדי לפשט פרמטרים תפעוליים, בחרנו לעשות פעולה כימיה המנגנון הדומיננטי של הסרת תאים בהשוואת הגזירה. ללהעריך את כוח הגזירה שמיישם hHFC על פני השטח, מודל סופי, אלמנט נבנה באמצעות Comsol Multiphysics 5.0. סימולציות נוהלו באמצעות מודול CFD לתזרימי למינרית. שני תנאי שפת כניסה אל פתחי הזרקת הגיאומטריה ושני תנאי שפה מוצאים אל פתחי השאיפה (איור 5) יושמו עבור הטווח של ספיקות וממדי צמצם המשמש בהפגנה הנוכחית. במודל שנתקבל, חוקי הזרימה הכתיבו את פרופיל הגזירה, ואילו הספיקות הגדירו את סדר הגודל של הגזירה על פני השטח. למעשה, שילוב של שניהם קובע אם hHFC קשרי פני השטח. שמירה על גורמים אלה בחשבון, יצאנו כדי למצוא מגוון רחב של ספיקות לפעולה על מנת להשיג סרת תא דומיננטית מבחינה כימי. כדי ליצור hHFC, נשתמש כלל זרימת שאיפה הכוללת יחס קצב זרימת הזרקה של 3.5. כללי זרימת אחרים המשמשים הוגדרו למזער סתימה בתוך הערוצים שהאיפה,אשר יכול להיגרם על ידי חלבונים מפוגלים דבק משטחי הערוץ. באמצעות המודל שפותח, מצאנו ספיקות בין 5 ל 10 μl / min תרגום כדי מתח גזירה בין 1 ו -3 N / m 2. ללא ההשפעה הכימית של NaOH, למשל במקרה של מיצוי חיץ, מאמץ הגזירה לא יהיה גבוה מספיק כדי להסיר את התאים 19. בטווח שנצפה, נציין כי מבצע ברמות ספיקה גבוהה יותר מעשי בשל הפרעות בנתיב הזרימה ברמות ספיקת שאיפה נמוכה (כלומר, ש I2 &lt;4 μl / min) בשל פסולת תא באפיקים. בהתחשב בפרופיל גזירה למד ושיקולים מעשיים, ספיקות NaOH (I2 Q) של 6 ו -8 μl / min משמשים הניסויים דפוסים ש I1, ש A1 ו- Q A2 על פי חוקי הזרימה שמוצג באיור 3. יחס תזרימי ההזרקה (ש I2 / Q I1) מאפשר us להמשיך לווסת את גודל טביעת הרגל hHFC (איור 3D ואיור 4B), עם העיקרון הבסיסי פירט ידי Autebert et al. 14. באמצעות היכולת הנוזלית בעיצוב hHFC בשילוב עם יכולת סריקה ברזולוציה גבוהה של פלטפורמת MFP, אנחנו מדגימים הדורים לרשת תא חי בקני מידה מרובות ויותר מזה להראות את היישום של הפרוטוקול הנתון בפיתוח שיתוף תרבויות (איור 4C). הפלטפורמה גם מאפשר לנו לבצע אחזור lysate מדגם לניתוח במורד הזרם. כדי להציג את האיכות של lysate שהושג, דגמנו מקומית lysed תאים מאחד וחמישה עקבות בשני ניסויים בלתי תלויים, מראה את הווריאציה בכמויות של DNA המתקבל lysate (איור 7). כאן, אנו DNA מוגבר כלולים lysate באמצעות פריימרים β-יקטין (קדימה: GGATGCAGAAGGAGATCACT הפוכה: CGATCCACACGGAGTACTTG<html> ) באמצעות 4 μl של lysate לניטרול כל תגובת PCR. <img alt="איור 1" src="/files/ftp_upload/54447/54447fig1.jpg" /> מודולים באיור 1. של פלטפורמת MFP ואת הראש. (א) מודולים התפעוליים של הפלטפורמה מהווים ממונע מזרקים, בשלבים ממונעים לבין בקר. שההתקן מחובר הבמה-Z ממונע לשלוט מרחוק הפער בין הראש ואת המצע, ואת בעל המצע מצורף ה- X ו- בשלבים מוטורי Y המהווים את מערכת הסריקה. (ב) ראש MFP יש vias fluidic לחבר את תחנת השאיבה, הרכבה חורים לעגן את הראש על הבמה Z, וערוצים יוצא איפקס מלוטש. איפקס מוגדר coplanar למצע תרבית תאים. הטבעות של סימטרי ניוטון ניתן להבחין כאשר הקודקוד ואת המצע הוא coplanar ובמגע.<html> &quot;Target =&quot; p_upload / 54,447 / 54447fig1large.jpg _ blank &quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 2" src="/files/ftp_upload/54447/54447fig2.jpg" /> פלטפורמת MFP איור 2.. פלטפורמת הסריקה ברזולוציה הגבוהה מצוידת בעל ראש במכונת התממשקות עם Z-הבמה ממונע דיוק גבוה. בעל המצע מחובר במת XY לסריקה למטרות. עבור התאוששות של lysate לניתוח במורד זרם, תחנת דגימה מודפסת 3D נחתכת מגנטית לצד של בעל המצע (מוצג הבלעה). משאבות מזרק, מיקרוסקופ הפוכה, הבקרים ומציג ממוקמים סביב הפלטפורמה. <a href="https://www.jove.com/files/ftp_upload/54447/54447fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> 3 &quot;src =&quot; / files / ftp_upload / 54,447 / 54447fig3.jpg &quot;/&gt; איור 3. כליאת זרימת הידרודינמית מבנה היררכית (hHFC) לשליטה במרחב ובזמן של הסרת תאים. (א) סכמטי של פיקוד עורף יחיד. (ב) מקוננות (C) מצב צבט פעולת hHFC. (ד) תמונה של טביעת הרגל עבור שני יחסי זרימת זריקה / שאיפה שונות. <a href="https://www.jove.com/files/ftp_upload/54447/54447fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/54447/54447fig4.jpg" /> איור 4. דפוסי monolayers התא באמצעות MFP. (א) דור Cell-הרשת על ידי סריקה מתוכנת של MFP על monolayer תא מד&quot;א- MB-231. תאים הוכתמו לצבוע תאים גשש ירוק. (ב) טביעת הרגל על יחסי הזרקה השונים (n) על monolayer תא MCF7. סכמטית מראה את השוני הצפוי בצורה של פיקוד העורף הפנימי עם שינוי n. (C) Patterned שיתוף התרבות ידי דפוסי תוסף של monolayer MCF7 ואחריו זריעת תאי מד&quot;א- MB-231 באזורים המופחתים. <a href="https://www.jove.com/files/ftp_upload/54447/54447fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/54447/54447fig5.jpg" /> איור 5. שאר מתח על פני השטח בעת החלת hHFC. מאמץ הגזירה על עליות השטח באופן ליניארי עם קצב זרימת הזרקה הפנימי. הנקודה הגבוהה ביותר הגזירה נמצאת בין שני הפתחים פנימיים (הבלעה ימנית תחתונה), שבו נוזל העיבוד מוגבל (קווי זרימה אדומה, הבלעה שמאלית עליונה). ממדי הצמצם ששמשו במודל הסופי, האלמנט הם 200, 100, 100 ו -200 מיקרומטר עבור i1, i2, a1ו- A2, בהתאמה. <a href="https://www.jove.com/files/ftp_upload/54447/54447fig5large.jpg" target="_blank">לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 6" src="/files/ftp_upload/54447/54447fig6.jpg" /> מצבי הפעלת איור 6. של פלטפורמת MFP לבצע תא הסרת דפוסים. (א) סכמטי של נתיב הזרימה עבור דפוסי תוסף ידי תמוגה תא. לשם פשטות, רק אחד מכל נתיבי הזרקה ותזרים שאיפה מוצג. המזרקים מלאים באמצעות שסתום ניקוז המשאבות. i1 ו- i2 משמשים להזרקת חיץ מיצוי NaOH, בהתאמה. (ב) סכמטי של נתיב הזרימה להתאוששות lysate. נתיב הזרימה זו מופעלת לאחר איסוף lysate תא לניתוח באמצעות נתיב הזרימה ב (א). <a href="https://www.jove.com/files/ftp_upload/54447/54447fig6large.jpg" target="_blank">אנא Clic</a>k כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 7" src="/files/ftp_upload/54447/54447fig7.jpg" /> איור 7. ניתוח במורד הזרם של דנ&quot;א lysate התא באמצעות qPCR. (א) מגרשים הגברה של ה- DNA lysate מופק 5 עקבות (5 FP) ו -1 טביעת הרגל (1 FP). בקרות חולצו לאחר איסוף lysate עבור בשני המקרים. (ב) ממיסים עקומות של דנ&quot;א מוגבר מן lysate מראה את האיכות של ה- DNA חילוץ. qPCR בוצע (N = 2, n = 3) כדי להגביר את גן β-יקטין. <a href="https://www.jove.com/files/ftp_upload/54447/54447fig7large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור S" src="/files/ftp_upload/54447/54447figS.jpg" /> איור S1. תמונה מותאמת של עיצוב ערוץ ראש MFP 6 ערוציםערוצים המשמשים בניסויי דפוסים. ביצוע hHFC הם 200, 100, 100, 200 מיקרומטר רחב, ו 100 מיקרומטר עמוקים. שני הערוצים החיצוניים, אשר לחדש נוזל טבילה הם 500 מיקרומטר רחב ו 100 מיקרומטר עמוקים. קובץ GDS עבור אותו העיצוב סופק בתור משלים למאמר זה. <a href="https://www.jove.com/files/ftp_upload/54447/54447figSlarge.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe at JoVE.com

Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe

We present a protocol to perform subtractive patterning of live cell monolayers on a surface. This is achieved by local and selective lysis of adherent cells using a microfluidic probe (MFP). The cell lysate retrieved from local regions can be used for downstream analysis, enabling molecular profiling studies.

דפוסי Subtractive מהירים של שכבות תא חיות עם בדיקת Microfluidic

The microfluidic probe (MFP) facilitates performing local chemistry on biological substrates by confining nanoliter volumes of liquids. Using one ...

rapid-subtractive-patterning-live-cell-layers-with-microfluidic

Research

JoVE Journal

Bioengineering

7.0K Views.  IBM Research - Zurich. We present a protocol to perform subtractive patterning of live cell monolayers on a surface. This is achieved by local and selective lysis of adherent cells using a microfluidic probe (MFP). The cell lysate retrieved from local regions can be used for downstream analysis, enabling molecular profiling studies.

Video: Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe

Separating Beads and Cells in Multi-channel Microfluidic Devices Using Dielectrophoresis and Laminar Flow

Microfluidic devices have advanced cell studies by providing a dynamic fluidic environment on the scale of the cell for studying, manipulating, sorting and counting cells. However, manipulating the cell within the fluidic domain remains a challenge and requires complicated fabrication protocols for forming valves and electrodes, or demands specialty equipment like optical tweezers. Here, we demonstrate that conventional printed circuit boards (PCB) can be used for the non-contact manipulation of cells by employing dielectrophoresis (DEP) for bead and cell manipulation in laminar flow fields for bioactuation, and for cell and bead separation in multichannel microfluidic devices. First, we present the protocol for assembling the DEP electrodes and microfluidic devices, and preparing the cells for DEP. Then, we characterize the DEP operation with polystyrene beads. Lastly, we show representative results of bead and cell separation in a multichannel microfluidic device. In summary, DEP is an effective method for manipulating particles (beads or cells) within microfluidic devices.

Dielectrophoresis (DEP) is an effective method to manipulate cells. Printed circuit boards (PCB) can provide inexpensive, reusable and effective electrodes for contact-free cell manipulation within microfluidic devices. By combining PDMS-based microfluidic channels with coverslips on PCBs, we demonstrate bead and cell manipulation and separation within multichannel microfluidic devices.

חרוזים ועל הפרדת תאים ריבוי ערוצים מכשירים microfluidic שימוש dielectrophoresis ו זרימה למינרית

Microfluidic devices have advanced cell studies by providing a dynamic fluidic environment on the scale of the cell for studying, manipulating, sorting ...

A Microfluidic Device with Groove Patterns for Studying Cellular Behavior

We describe a microfluidic device with microgrooved patterns for studying cellular behavior. This microfluidic platform consists of a top fluidic channel and a bottom microgrooved substrate. To fabricate the microgrooved channels, a top poly(dimethylsiloxane) (PDMS) mold containing the impression of the microfluidic channels was aligned and bonded to a microgrooved substrate. Using this device, mouse fibroblast cells were immobilized and patterned within microgrooved substrates (25, 50, 75, and 100 &mu;m wide). To study apoptosis in a microfluidic device, media containing hydrogen peroxide, Annexin V, and propidium iodide was perfused into the fluidic channel for 2 hours. We found that cells exposed to the oxidative stress became apoptotic. These apoptotic cells were confirmed by Annexin V that bound to phosphatidylserine at the outer leaflet of the plasma membrane during the apoptosis process. Using this microfluidic device with microgrooved patterns, the apoptosis process was observed in real-time and analyzed by using an inverted microscope containing an incubation chamber (37&deg;C, 5% CO2). Therefore, this microfluidic device incorporated with microgrooved substrates could be useful for studying the cellular behavior and performing high-throughput drug screening.

We describe a protocol for the fabrication of microfluidic devices that can enable cell capture and culture. In this approach patterned microstructures such as grooves within microfluidic channels are used to create low shear stress regions within which cell can dock.

מכשיר microfluidic עם דפוסי Groove לחקר התנהגות נייד

We describe a microfluidic device with microgrooved patterns for studying cellular behavior.  This microfluidic platform consists of a top fluidic channel ...

Biology

A Microfluidic Device for Studying Multiple Distinct Strains

The study of cell responses to environmental changes poses many experimental challenges: cells need to be imaged under changing conditions, often in a comparative manner. Multiwell plates are routinely used to compare many different strains or cell lines, but allow limited control over the environment dynamics. Microfluidic devices, on the other hand, allow exquisite dynamic control over the surrounding conditions, but it is challenging to image and distinguish more than a few strains in them. Here we describe a method to easily and rapidly manufacture a microfluidic device capable of applying dynamically changing conditions to multiple distinct yeast strains in one channel. The device is designed and manufactured by simple means without the need for soft lithography. It is composed of a Y-shaped flow channel attached to a second layer harboring microwells. The strains are placed in separate microwells, and imaged under the exact same dynamic conditions. We demonstrate the use of the device for measuring protein localization responses to pulses of nutrient changes in different yeast strains.

We present a simple method to produce microfluidic devices capable of applying similar dynamic conditions to multiple distinct strains, without the need for a clean room or soft lithography.

מכשיר microfluidic ללימוד זני Distinct מרובים

The study of cell responses to environmental changes poses many experimental challenges: cells need to be imaged under changing conditions, often in a ...

A Microfluidic Technique to Probe Cell Deformability

Here we detail the design, fabrication, and use of a microfluidic device to evaluate the deformability of a large number of individual cells in an efficient manner. Typically, data for ~102 cells can be acquired within a 1 hr experiment. An automated image analysis program enables efficient post-experiment analysis of image data, enabling processing to be complete within a few hours. Our device geometry is unique in that cells must deform through a series of micron-scale constrictions, thereby enabling the initial deformation and time-dependent relaxation of individual cells to be assayed. The applicability of this method to human promyelocytic leukemia (HL-60) cells is demonstrated. Driving cells to deform through micron-scale constrictions using pressure-driven flow, we observe that human promyelocytic (HL-60) cells momentarily occlude the first constriction for a median time of 9.3 msec before passaging more quickly through the subsequent constrictions with a median transit time of 4.0 msec per constriction. By contrast, all-trans retinoic acid-treated (neutrophil-type) HL-60 cells occlude the first constriction for only 4.3 msec before passaging through the subsequent constrictions with a median transit time of 3.3 msec. This method can provide insight into the viscoelastic nature of cells, and ultimately reveal the molecular origins of this behavior.

We demonstrate a microfluidics-based assay to measure the timescale for cells to transit through a sequence of micron-scale constrictions.

טכניקת Microfluidic לחקור deformability הסלולרי

Here we detail the design, fabrication, and use of a microfluidic device to evaluate the deformability of a large number of individual cells in an ...

The Microfluidic Probe: Operation and Use for Localized Surface Processing

Microfluidic devices allow assays to be performed using minute amounts of sample and have recently been used to control the microenvironment of cells. Microfluidics is commonly associated with closed microchannels which limit their use to samples that can be introduced, and cultured in the case of cells, within a confined volume. On the other hand, micropipetting system have been used to locally perfuse cells and surfaces, notably using push-pull setups where one pipette acts as source and the other one as sink, but the confinement of the flow is difficult in three dimensions. Furthermore, pipettes are fragile and difficult to position and hence are used in static configuration only. 
The microfluidic probe (MFP) circumvents the constraints imposed by the construction of closed microfluidic channels and instead of enclosing the sample into the microfluidic system, the microfluidic flow can be directly delivered onto the sample, and scanned across the sample, using the MFP. . The injection and aspiration openings are located within a few tens of micrometers of one another so that a microjet injected into the gap is confined by the hydrodynamic forces of the surrounding liquid and entirely aspirated back into the other opening. The microjet can be flushed across the substrate surface and provides a precise tool for localized deposition/delivery of reagents which can be used over large areas by scanning the probe across the surface. 
In this video we present the microfluidic probe1 (MFP). We explain in detail how to assemble the MFP, mount it atop an inverted microscope, and align it relative to the substrate surface, and finally show how to use it to process a substrate surface immersed in a buffer.

In this video we present the microfluidic probe1 (MFP). We explain in detail how to assemble the MFP, mount it atop an inverted microscope, and align it relative to the substrate surface, and finally show how to use it to process a substrate surface immersed in a buffer solution.

בדיקה Microfluidic: מבצע ושימוש לעיבוד Surface לוקליזציה

Microfluidic devices allow assays to be performed using minute amounts of sample and have recently been used to control the microenvironment of cells. ...

Preparation of Neuronal Co-cultures with Single Cell Precision

Microfluidic embodiments of the Campenot chamber have attracted great interest from the neuroscience community. These interconnected co-culture platforms can be used to investigate a variety of questions, spanning developmental and functional neurobiology to infection and disease propagation. However, conventional systems require significant cellular inputs (many thousands per compartment), inadequate for studying low abundance cells, such as primary dopaminergic substantia nigra, spiral ganglia, and Drosophilia melanogaster neurons, and impractical for high throughput experimentation. The dense cultures are also highly locally entangled, with few outgrowths (&#60;10%) interconnecting the two cultures. In this paper straightforward microfluidic and patterning protocols are described which address these challenges: (i) a microfluidic single neuron arraying method, and (ii) a water masking method for plasma patterning biomaterial coatings to register neurons and promote outgrowth between compartments. Minimalistic neuronal co-cultures were prepared with high-level (&#62;85%) intercompartment connectivity and can be used for high throughput neurobiology experiments with single cell precision.

Protocols for single neuron microfluidic arraying and water masking for the in-chip plasma patterning of biomaterial coatings are described. Highly interconnected co-cultures can be prepared using minimal cell inputs.

הכנת עצבית שיתוף תרבויות עם Precision תא בודד

Microfluidic embodiments of the Campenot chamber have attracted great interest from the neuroscience community. These interconnected co-culture platforms ...

Neuroscience

Patterning of Microorganisms and Microparticles through Sequential Capillarity-assisted Assembly

Controlled patterning of microorganisms into defined spatial arrangements offers unique possibilities for a broad range of biological applications, including studies of microbial physiology and interactions. At the simplest level, accurate spatial patterning of microorganisms would enable reliable, long-term imaging of large numbers of individual cells and transform the ability to quantitatively study distance-dependent microbe-microbe interactions. More uniquely, coupling accurate spatial patterning and full control over environmental conditions, as offered by microfluidic technology, would provide a powerful and versatile platform for single-cell studies in microbial ecology. 
This paper presents a microfluidic platform to produce versatile and user-defined patterns of microorganisms within a microfluidic channel, allowing complete optical access for long-term, high-throughput monitoring. This new microfluidic technology is based on capillarity-assisted particle assembly and exploits the capillary forces arising from the controlled motion of an evaporating suspension inside a microfluidic channel to deposit individual microsized objects in an array of traps microfabricated onto a polydimethylsiloxane (PDMS) substrate. Sequential depositions generate the desired spatial layout of single or multiple types of micro-sized objects, dictated solely by the geometry of the traps and the filling sequence. 
The platform has been calibrated using colloidal particles of different dimensions and materials: it has proven to be a powerful tool to generate diverse colloidal patterns and perform surface functionalization of trapped particles. Furthermore, the platform was tested on microbial cells, using Escherichia coli cells as a model bacterium. Thousands of individual cells were patterned on the surface, and their growth was monitored over time. In this platform, the coupling of single-cell deposition and microfluidic technology allows both geometric patterning of microorganisms and precise control of environmental conditions. It thus opens a window into the physiology of single microbes and the ecology of microbe-microbe interactions, as shown by preliminary experiments.

We present a technology that uses capillarity-assisted assembly in a microfluidic platform to pattern micro-sized objects suspended in a liquid, such as bacteria and colloids, into prescribed arrays on a polydimethylsiloxane substrate.

דפוס של מיקרואורגניזמים ומיקרו-חלקיקים באמצעות הרכבה בסיוע נימים רציפים

Controlled patterning of microorganisms into defined spatial arrangements offers unique possibilities for a broad range of biological applications, ...

Engineering

A Microfluidic System with Surface Patterning for Investigating Cavitation Bubble(s)&#8211;Cell Interaction and the Resultant Bioeffects at the Single-cell Level

In this manuscript, we first describe the fabrication protocol of a microfluidic chip, with gold dots and fibronectin-coated regions on the same glass substrate, that precisely controls the generation of tandem bubbles and individual cells patterned nearby with well-defined locations and shapes. We then demonstrate the generation of tandem bubbles by using two pulsed lasers illuminating a pair of gold dots with a few-microsecond time delay. We visualize the bubble-bubble interaction and jet formation by high-speed imaging and characterize the resultant flow field using particle image velocimetry (PIV). Finally, we present some applications of this technique for single cell analysis, including cell membrane poration with macromolecule uptake, localized membrane deformation determined by the displacements of attached integrin-binding beads, and intracellular calcium response from ratiometric imaging. Our results show that a fast and directional jetting flow is produced by the tandem bubble interaction, which can impose a highly localized shear stress on the surface of a cell grown in close proximity. Furthermore, different bioeffects can be induced by altering the strength of the jetting flow by adjusting the standoff distance from the cell to the tandem bubbles.

A microfluidic chip was fabricated to produce pairs of gold dots for tandem bubble generation and fibronectin-coated islands for single-cell patterning nearby. The resultant flow field was characterized by particle image velocimetry and was employed to study various bioeffects, including cell membrane poration, membrane deformation, and intracellular calcium response.

מערכת Microfluidic עם דפוסי Surface לחקירת בועת Cavitation (ים) אינטראקציה דו תא ואת Bioeffects הנובע מהן ברמת התא הבודד

In this manuscript, we first describe the fabrication protocol of a microfluidic chip, with gold dots and fibronectin-coated regions on the same glass ...

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to spatially fractionate the sample based on a biological property of interest. For the resultant spatial distribution to be used as the assay readout, microfluidic devices are often subjected to microscopic analysis requiring complex instrumentation with higher cost and reduced portability. To address this limitation, we have developed an integrated electronic sensing technology for multiplexed detection of particles at different locations on a microfluidic chip. Our technology, called Microfluidic CODES, combines Resistive Pulse Sensing with Code Division Multiple Access to compress 2D spatial information into a 1D electrical signal. In this paper, we present a practical demonstration of the Microfluidic CODES technology to detect and size cultured cancer cells distributed over multiple microfluidic channels. As validated by the high-speed microscopy, our technology can accurately analyze dense cell populations all electronically without the need for an external instrument. As such, the Microfluidic CODES can potentially enable low-cost integrated lab-on-a-chip devices that are well suited for the point-of-care testing of biological samples.

We demonstrate a microfluidic platform with an integrated surface electrode network that combines resistive pulse sensing (RPS) with code division multiple access (CDMA), to multiplex detection and sizing of particles in multiple microfluidic channels.

פלטפורמת microfluidic עם איתור Multiplexed אלקטרוני למערכות מעקב מרחבית של חלקיקים

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

A Versatile Method of Patterning Proteins and Cells

Substrate and cell patterning techniques are widely used in cell biology to study cell-to-cell and cell-to-substrate interactions. Conventional patterning techniques work well only with simple shapes, small areas and selected bio-materials. This article describes a method to distribute cell suspensions as well as substrate solutions into complex, long, closed (dead-end) polydimethylsiloxane (PDMS) microchannels using negative pressure. This method enables researchers to pattern multiple substrates including fibronectin, collagen, antibodies (Sal-1), poly-D-lysine (PDL), and laminin. Patterning of substrates allows one to indirectly pattern a variety of cells. We have tested C2C12 myoblasts, the PC12 neuronal cell line, embryonic rat cortical neurons, and amphibian retinal neurons. In addition, we demonstrate that this technique can directly pattern fibroblasts in microfluidic channels via brief application of a low vacuum on cell suspensions. The low vacuum does not significantly decrease cell viability as shown by cell viability assays. Modifications are discussed for application of the method to different cell and substrate types. This technique allows researchers to pattern cells and proteins in specific patterns without the need for exotic materials or equipment and can be done in any laboratory with a vacuum.

This report describes a simple, easy to perform technique, using low pressure vacuum, to fill microfluidic channels with cells and substrates for biological research.

שיטה צדדית של חלבוני דפוסי תאים

Substrate and cell patterning techniques are widely used in cell biology to study cell-to-cell and cell-to-substrate interactions. Conventional patterning ...