We wish to acknowledge the labs in the C. elegans community who developed and shared the tools and whose work is cited in this manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by a Canadian Institutes of Health Research (CIHR) Project grant to A.L.S. (PJT-175245). C.L. is supported by a Natural Sciences and Engineering Research Council of Canada (NSERC) postgraduate scholarship (PGS-D).

Epigenetic Inheritance and ChIP in &lt;em&gt;Caenorhabditis elegans&lt;/em&gt;

<ol>
	<li>Alcazar, R. M., Lin, R., Fire, A. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmission+dynamics+of+heritable+silencing+induced+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Transmission dynamics of heritable silencing induced by double-stranded RNA in Caenorhabditis elegans.</a> Genetics. 180 (3), 1275-1288 (2008).</li><li>Ashe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+can+trigger+a+multigenerational+epigenetic+memory+in+the+germline+of+C.+elegans.">piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans.</a> Cell. 150 (1), 88-99 (2012).</li><li>Buckley, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nuclear+Argonaute+promotes+multigenerational+epigenetic+inheritance+and+germline+immortality.">A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality.</a> Nature. 489 (7416), 447-451 (2012).</li><li>Vastenhouw, N. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+gene+silencing+by+RNAi.">Long-term gene silencing by RNAi.</a> Nature. 442 (7105), 882 (2006).</li><li>Lee, H. -. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C.+elegans+piRNAs+mediate+the+genome-wide+surveillance+of+germline+transcripts.">C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts.</a> Cell. 150 (1), 78-87 (2012).</li><li>Luteijn, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extremely+stable+Piwi-induced+gene+silencing+in+Caenorhabditis+elegans.">Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans.</a> The EMBO Journal. 31 (16), 3422-3430 (2012).</li><li>Sapetschnig, A., Sarkies, P., Lehrbach, N. J., Miska, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tertiary+siRNAs+mediate+paramutation+in+C.+elegans.">Tertiary siRNAs mediate paramutation in C. elegans.</a> PLoS Genetics. 11 (3), e1005078 (2015).</li><li>Shirayama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+initiate+an+epigenetic+memory+of+nonself+RNA+in+the+C.+elegans+germline.">piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.</a> Cell. 150 (1), 65-77 (2012).</li><li>Minkina, O., Hunter, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+heritable+germline+silencing+directs+somatic+silencing+at+an+endogenous+locus.">Stable heritable germline silencing directs somatic silencing at an endogenous locus.</a> Molecular Cell. 65 (4), 659-670 (2017).</li><li>Seroussi, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+epigenetic+regulation+by+C.+elegans+nuclear+RNA+interference+pathways.">Mechanisms of epigenetic regulation by C. elegans nuclear RNA interference pathways.</a> Seminars in Cell &amp; Developmental Biology. 127, 142-154 (2022).</li><li>Lev, I., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H3K9me3+is+required+for+inheritance+of+small+RNAs+that+target+a+unique+subset+of+newly+evolved+genes.">H3K9me3 is required for inheritance of small RNAs that target a unique subset of newly evolved genes.</a> eLife. 8, e40448 (2019).</li><li>Woodhouse, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifiers+SET-25+and+SET-32+are+required+for+establishment+but+not+long-term+maintenance+of+transgenerational+epigenetic+inheritance.">Chromatin modifiers SET-25 and SET-32 are required for establishment but not long-term maintenance of transgenerational epigenetic inheritance.</a> Cell Reports. 25 (8), 2259-2272 (2018).</li><li>Houri-Zeevi, L., Teichman, G., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stress+resets+ancestral+heritable+small+RNA+responses.">Stress resets ancestral heritable small RNA responses.</a> eLife. 10, e65797 (2021).</li><li>Houri-Ze'evi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+tunable+mechanism+determines+the+duration+of+the+transgenerational+small+RNA+inheritance+in+C.+elegans.">A tunable mechanism determines the duration of the transgenerational small RNA inheritance in C. elegans.</a> Cell. 165 (1), 88-99 (2016).</li><li>Spracklin, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RNAi+inheritance+machinery+of+Caenorhabditis+elegans.">The RNAi inheritance machinery of Caenorhabditis elegans.</a> Genetics. 206 (3), 1403-1416 (2017).</li><li>Perales, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenerational+epigenetic+inheritance+is+negatively+regulated+by+the+HERI-1+chromodomain+protein.">Transgenerational epigenetic inheritance is negatively regulated by the HERI-1 chromodomain protein.</a> Genetics. 210 (4), 1287-1299 (2018).</li><li>Shukla, A., Perales, R., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+coordinate+poly(UG)+tailing+to+prevent+aberrant+and+perpetual+gene+silencing.">piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing.</a> Current Biology. 31 (20), 4473-4485 (2021).</li><li>Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse+GeneticsWormBook:+the+Online+Review+of+C.+elegans+Biology.">Reverse GeneticsWormBook: the Online Review of C. elegans Biology.</a> WormBook. , (2006).</li><li>Rivera Gomez, K., Schvarzstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization+of+nematodes+for+live+imaging+using+an+agarose+pad+produced+with+a+Vinyl+Record.">Immobilization of nematodes for live imaging using an agarose pad produced with a Vinyl Record.</a> microPublication Biology. 2018, (2018).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+C.+elegans.">Maintenance of C. elegans.</a> WormBook: The Online Review of C. Elegans Biology. , 1-11 (2006).</li><li>Askjaer, P., Ercan, S., Meister, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modern+techniques+for+the+analysis+of+chromatin+and+nuclear+organization+in+C.+elegans.">Modern techniques for the analysis of chromatin and nuclear organization in C. elegans.</a> WormBook: the Online Review of C. elegans Biology. , 1-35 (2014).</li><li>Gu, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+siRNA+in+Caenorhabditis+elegans+generates+a+transgenerational+sequence-targeted+histone+H3+lysine+9+methylation+footprint.">Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.</a> Nature Genetics. 44 (2), 157-164 (2012).</li><li>Kalinava, N., Ni, J. Z., Peterman, K., Chen, E., Gu, S. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoupling+the+downstream+effects+of+germline+nuclear+RNAi+reveals+that+H3K9me3+is+dispensable+for+heritable+RNAi+and+the+maintenance+of+endogenous+siRNA-mediated+transcriptional+silencing+in+Caenorhabditis+elegans.">Decoupling the downstream effects of germline nuclear RNAi reveals that H3K9me3 is dispensable for heritable RNAi and the maintenance of endogenous siRNA-mediated transcriptional silencing in Caenorhabditis elegans.</a> Epigenetics &amp; Chromatin. 10, 6 (2017).</li><li>Kalinava, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=elegans+heterochromatin+factor+SET-32+plays+an+essential+role+in+transgenerational+establishment+of+nuclear+RNAi-mediated+epigenetic+silencing.">elegans heterochromatin factor SET-32 plays an essential role in transgenerational establishment of nuclear RNAi-mediated epigenetic silencing.</a> Cell Reports. 25 (8), 2273-2284 (2018).</li><li>Lev, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MET-2-dependent+H3K9+methylation+suppresses+transgenerational+small+RNA+inheritance.">MET-2-dependent H3K9 methylation suppresses transgenerational small RNA inheritance.</a> Current Biology. 27 (8), 1138-1147 (2017).</li><li>Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G., Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effectiveness+of+specific+RNA-mediated+interference+through+ingested+double-stranded+RNA+in+Caenorhabditis+elegans.">Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans.</a> Genome Biology. 2 (1), (2001).</li><li>Xu, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cytoplasmic+Argonaute+protein+promotes+the+inheritance+of+RNAi.">A cytoplasmic Argonaute protein promotes the inheritance of RNAi.</a> Cell Reports. 23 (8), 2482-2494 (2018).</li><li>Grishok, A., Tabara, H., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+requirements+for+inheritance+of+RNAi+in+C.+elegans.">Genetic requirements for inheritance of RNAi in C. elegans.</a> Science. 287 (5462), 2494-2497 (2000).</li><li>Houri-Zeevi, L., Korem Kohanim, Y., Antonova, O., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+rules+explain+transgenerational+small+RNA+inheritance+in+C.+elegans.">Three rules explain transgenerational small RNA inheritance in C. elegans.</a> Cell. 182 (5), 1186-1197 (2020).</li><li>Burton, N. O., Burkhart, K. B., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+RNAi+maintains+heritable+gene+silencing+in+Caenorhabditis+elegans.">Nuclear RNAi maintains heritable gene silencing in Caenorhabditis elegans.</a> Proceedings of the National Academy of Sciences. 108 (49), 19683-19688 (2011).</li><li>Mao, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Nrde+pathway+mediates+small-RNA-directed+histone+H3+lysine+27+trimethylation+in+Caenorhabditis+elegans.">The Nrde pathway mediates small-RNA-directed histone H3 lysine 27 trimethylation in Caenorhabditis elegans.</a> Current Biology. 25 (18), 2398-2403 (2015).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Research. 22 (9), 1813-1831 (2012).</li><li>Mukhopadhyay, A., Deplancke, B., Walhout, A. J. M., Tissenbaum, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+(ChIP)+coupled+to+detection+by+quantitative+real-time+PCR+to+study+transcription+factor+binding+to+DNA+in+Caenorhabditis+elegans.">Chromatin immunoprecipitation (ChIP) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA in Caenorhabditis elegans.</a> Nature Protocols. 3 (4), 698-709 (2008).</li></ol>

All authors confirm that they do not have any conflicts to disclose.

In this protocol, dsRNA is introduced by feeding, which has become a standard method in C. elegans18. For RNAi inheritance assays, the feeding approach provides an easy method to obtain a large P0&#160;population2,11,12,22,23,24,25. However, the timing and duration of RNAi exposure affects the efficacy of transgene silencing26, and the concentration of RNAi bacteria affects the persistence of heritable RNAi silencing1. Therefore, standardized RNAi bacteria and worm growth are important to obtain a consistent level of GFP silencing and duration of inheritance. Here, embryos are plated on RNAi plates so that P0 animals are exposed to RNAi bacteria from hatching. Alternative approaches have plated synchronized L124,27 or L425 stage animals onto RNAi-NGM plates. In addition, since starvation and other stresses affect the maintenance of RNAi inheritance13, plates must be monitored to prevent overcrowding and exhaustion of the food supply. As an alternative to initiating RNAi by feeding, some of the pioneer C. elegans RNAi inheritance studies induced RNAi through gonad injection, which provides a greater control of dsRNA concentration1,28.
In this protocol, each generation is passaged as a population with alkaline hypochlorite treatment, as previously described16,22,23,24. Hypochlorite treatment ensures the F1 generation will not be contaminated with RNAi bacteria from the parental environment22 and prevents potential undesired population bottle-necking. However, bulk passaging may also be a limitation, since individual animals may have distinct inheritance patterns1,29. An alternative method to establish each generation is to select individual animals1,2,9,11,25. This approach allows for tracking phenotypes within lineages and the incorporation of genetic crosses. Lineage analysis may also be advantageous for low penetrance phenotypes12.
Fluorescent protein expression is a powerful and convenient readout of RNAi-induced silencing2,3,4,12,14,15,16,25,30. As described in this protocol, GFP expression can be manually scored as ON or OFF11,12,15,16,25. Manual scoring can be further refined by assigning qualitative intensity levels3,4,14. Alternatively, automated intensity scoring of microscopy images11,12,14,25,27 or flow cytometry fluorescence measurement of live animals2 can provide a quantitative and high-throughput readout. However, since the reporter expression is restricted to the germline, a caveat of automated approaches is that they must also differentiate between animals with silenced GFP expression versus animals with no germline, especially if the study incorporates mutants with abnormal germline development. As an alternative to GFP fluorescence, reverse transcription (RT)-qPCR can be used to quantify RNAi target pre-mRNA and mRNA levels2,16,23,24. This approach provides a more direct readout of silencing, which targets RNA, and is especially useful for other RNAi targets where silencing does not produce a visible phenotype. A limitation of using artificial GFP reporters is that exogenous and endogenous sequences are differentially regulated in transgenerational RNAi11. Studies with endogenous targets, such as the temperature-sensitive embryonic lethal allele oma-1(zu405)1,11,16,25, should therefore be considered as a complementary approach to fluorescent transgene reporters.
The analysis of ChIP in the context of RNAi inheritance assays requires comparison between treatments and replicates. First, to account for differences in starting material between samples, the ChIP signal is normalized to Input signal at the same locus as the &#39;percentage of Input&#39;. Processing a histone H3 ChIP in parallel will help to determine whether any histone modification alterations correspond with changes in nucleosome density. In addition, because ChIP is a multi-step process, the efficiency may vary between samples. The selection of appropriate positive and negative control loci is useful to evaluate and compare the signal-to-noise ratio among samples and experiments. In addition, to facilitate comparisons between samples, the ChIP DNA qPCR threshold cycle values at the RNAi target are often normalized to a control locus3,11,15,23,30,31. To evaluate the effects of the RNAi treatment, the ratio of the ChIP signal in treatment RNAi versus control or no RNAi conditions is also compared. A limitation of the current approach is that ChIP is performed with whole animals, while the response to RNAi treatment may be unique to the germline. An approach to overcome this caveat is to perform ChIP using isolated germline nuclei. Additional technical considerations for optimizing ChIP have also been discussed extensively elsewhere32,33.
Overall, this RNAi inheritance and ChIP protocol provides a detailed and easy-to-adapt foundation that can be integrated with other techniques to further explore transgenerational epigenetic regulation. For example, high throughput sequencing libraries can be constructed from the ChIP DNA (ChIP-seq) for a more detailed view of the chromatin landscape both proximal to the RNAi target and on a genome-wide scale.

Epigenetic inheritance allows the transmission of gene regulatory information across generations and can therefore allow the environment or experiences of parents to affect their progeny. In C. elegans, germline gene silencing initiated by exogenous double-stranded RNA (dsRNA) can be inherited for multiple generations in progeny not exposed to the original trigger1,2,3,4. This process, termed RNA interference (RNAi) inheritance, is one of several related epigenetic silencing phenomena in C. elegans, including piRNA-initiated multigenerational silencing2,5, paramutation/RNAe (RNA-induced epigenetic silencing)6,7,8, and multicopy array-initiated silencing9, which have overlapping but distinct requirements for small RNA and chromatin regulation machinery. In C. elegans exogenous RNAi, dsRNA is processed into small interfering RNAs (siRNAs) that act in a complex with primary Argonaute proteins to recognize their target mRNA. This targeting leads to the amplification of secondary siRNAs that associate with secondary Argonautes to silence target mRNA through both cytoplasmic and nuclear silencing pathways. For germline-expressed RNAi targets, the nuclear secondary Argonaute HRDE-1 and additional nuclear RNAi factors target nascent transcripts, resulting in transcriptional repression and recruitment of histone methyltransferases to deposit repressive chromatin marks, including H3K9me310. Histone H3K9me3 promotes the establishment of heritable silencing of germline-expressed green fluorescent protein (GFP) transgenes by RNAi inheritance11,12.
The goal of this protocol is to use a transgene expressing a GFP-histone fusion protein in the germline as a reporter for RNAi inheritance and to assay changes in histone modifications at the reporter transgene locus using chromatin immunoprecipitation and quantitative polymerase chain reaction (ChIP-qPCR). This protocol describes a standardized plate-based RNAi feeding approach to initiate reporter silencing. It also provides a detailed timeline for passaging animals between generations by isolating in utero embryos from gravid adults by alkaline hypochlorite treatment (&#39;bleaching&#39;). Methods and representative data for monitoring the frequency of GFP silencing in a subset of the population by fluorescence microscopy and for histone H3K9me3 ChIP-qPCR are also described. Reporter-based RNAi inheritance assays provide a highly tractable system to functionally dissect the roles of genetic and environmental factors in epigenetic regulation13,14, and genetic screens using such reporters have identified both genes that are required for2,3,15 and genes that negatively regulate16,17 the duration of transgenerational epigenetic inheritance.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Agarose</td>
			<td>Bioshop</td>
			<td>AGA002</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Bioshop</td>
			<td>AMP201</td>
			<td>Make a 100 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Anti-H3K9me3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab8898</td>
			<td>Concentration is batch-dependent (0.9 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Anti-Histone H3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab1791</td>
			<td>Concentration is batch-dependent (0.7 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Bleach (6% Sodium hypochlorite)</td>
			<td>Lavo</td>
			<td>02358107</td>
			<td></td>
		</tr>
		<tr>
			<td>C. elegans strain with GFP RNAi Reporter</td>
			<td>NA</td>
			<td>SX1263</td>
			<td>Sapetschnig et al. 2015 (ref. 7). A gift from E. Miska lab, University of Cambridge.</td>
		</tr>
		<tr>
			<td>Carbenicillin</td>
			<td>BioShop</td>
			<td>CAR544</td>
			<td>Make a 25 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Dynabeads Protein G Magnetic Beads</td>
			<td>Invitrogen</td>
			<td>10003D</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain HT115(DE3)</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>HT115(DE3)</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain OP50-1</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>OP50-1</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (0.5 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence Stereoscope</td>
			<td>Zeiss</td>
			<td>Axio Zoom.V16</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde (37%)</td>
			<td>Sigma</td>
			<td>F8775</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Sigma</td>
			<td>50046</td>
			<td>Make a 1.25 M solution and store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>HEPES-KOH (1 M, pH 7.5)</td>
			<td>Teknova</td>
			<td>H1035</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrophobic Printed Slides, 10 wells</td>
			<td>VWR</td>
			<td>100488-904</td>
			<td></td>
		</tr>
		<tr>
			<td>IGEPAL CA-630 (Octylphenol ethoxylate)</td>
			<td>BioShop</td>
			<td>NON999</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
		<tr>
			<td>IPTG (Isopropyl-&#946;-D-thiogalactoside)</td>
			<td>BioShop</td>
			<td>IPT001</td>
			<td>Make a 0.2 g/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>1725122</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar Plates supplemented with 100 &#181;g/mL Ampicillin</td>
			<td>NA</td>
			<td>NA</td>
			<td>Standard lab recipe.</td>
		</tr>
		<tr>
			<td>Levamisole (Tetramisole hydrochloride)</td>
			<td>Sigma</td>
			<td>L9756</td>
			<td>Make a 200 mM solution in ultrapure water. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>LiCl (8 M)</td>
			<td>Sigma</td>
			<td>L7026</td>
			<td></td>
		</tr>
		<tr>
			<td>M9 Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>22 mM KH2PO4, 42 mM Na2HPO4, 86 mM NaCl, 1 mM MgSO4.</td>
		</tr>
		<tr>
			<td>Magnetic Separator (1.5 mL tubes)</td>
			<td>Applied Biosystems</td>
			<td>A13346</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Separator (0.2 mL tubes)</td>
			<td>Permagen</td>
			<td>MSR812</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Cover Glass</td>
			<td>Fisher Scientific</td>
			<td>12541B</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Slide</td>
			<td>Technologist Choice</td>
			<td>LAB-037</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl (5 M)</td>
			<td>Promega</td>
			<td>V4221</td>
			<td>For ChIP buffers.</td>
		</tr>
		<tr>
			<td>NaOH&#160;</td>
			<td>Sigma</td>
			<td>S5881</td>
			<td>Make a 10 M solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>NGM Plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#956;g/mL cholesterol, 25 mM Potassium phosphate pH 6.0, 1 mM MgSO4, 50 &#181;g/mL streptomycin.</td>
		</tr>
		<tr>
			<td>Normal Rabbit IgG (1 mg/mL)</td>
			<td>Cell Signaling Technology</td>
			<td>2729</td>
			<td></td>
		</tr>
		<tr>
			<td>Petri Dishes (35 mm x 10 mm)</td>
			<td>Sarstedt</td>
			<td>82.1135.500</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (10X)</td>
			<td>Fisher BioReagents</td>
			<td>BP3991</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - Control RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4440 (Plasmid #1654)</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - GFP-targetting RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4417 (Plasmid #1649)</td>
			<td>Note, alternative L4440-derived plasmids targeting GFP can be used.</td>
		</tr>
		<tr>
			<td>Primer pair [-3.3 kb upstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: AAACCAAAGGACGAGAGATTCA, R: GGCTCGATCAAGTAAAATTTCG</td>
		</tr>
		<tr>
			<td>Primer pair [+1.3 kb downstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TCGACCAGTTCTAAAGTCACCG, R: ACGTGCGGGATCATTTCTTACT</td>
		</tr>
		<tr>
			<td>Primer pair [clec-18]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TGCTCCATGACCTCAACAACA, R: AGTACAGTTCACCGATCCAGA</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 1]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CTGGAGTTGTCCCAATTCTTGT, R: GGGTAAGTTTTCCGTATGTTGC</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 4]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: GATGGCCCTGTCCTTTTACCA, R: ATGCCATGTGTAATCCCAGCA</td>
		</tr>
		<tr>
			<td>Primer pair [hrp-2]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CGTCAACAGGGAGCAGCTG, R: CCTCCGAACTTTCTCTGTCCA</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail Tablet</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K&#160;</td>
			<td>Bioline</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit&#160;</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>Real-Time PCR Detection System</td>
			<td>Bio-Rad</td>
			<td>CFX96&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAi-NGM plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#181;g/mL cholesterol, 25 mM Potassium phosphate buffer pH 6.0, 1 mM MgSO4, 25 &#181;g/mL carbenicillin and 5 mM IPTG.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>Sigma</td>
			<td>R4642</td>
			<td></td>
		</tr>
		<tr>
			<td>Sarkosyl (N-Lauroylsarcosine sodium salt)</td>
			<td>Sigma</td>
			<td>L5777</td>
			<td>Make a 10% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Sigma</td>
			<td>74255</td>
			<td>Make a 10% (w/v) solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>Sodium deoxycholate</td>
			<td>Sigma</td>
			<td>30970</td>
			<td>Make a 5% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>Sonication Tube</td>
			<td>Evergreen</td>
			<td>214-3721-010</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonication Tube Cap</td>
			<td>Evergreen</td>
			<td>300-2911-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Qsonica</td>
			<td>Q800R3-110</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptomycin sulfate</td>
			<td>Bioshop</td>
			<td>STP101</td>
			<td>Make a 50 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>TAE buffer (1X)</td>
			<td>NA</td>
			<td>NA</td>
			<td>40 mM Tris, 20 mM acetate, 1 mM EDTA</td>
		</tr>
		<tr>
			<td>Tally counter clicker</td>
			<td>Uline</td>
			<td>H-7350</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Bioshop</td>
			<td>TET701</td>
			<td>Make a 5 mg/mL solution in ethanol and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>Eppendorf</td>
			<td>05-400-205</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl (1 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15568025</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma</td>
			<td>T8787</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
	</tbody>
</table>

analysis of transgenerational epigenetic inheritance in c. elegans using a fluorescent reporter and chromatin immunoprecipitation (chip)

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through factors such as non-coding RNAs and chromatin modifications. The phenomenon of RNA interference (RNAi) inheritance in the nematode Caenorhabditis elegans is an effective model to investigate TEI that takes advantage of this model organism's short life cycle, self-propagation, and transparency. In RNAi inheritance, exposure of animals to RNAi leads to gene silencing and altered chromatin signatures at the target locus that persist for multiple generations in the absence of the initial trigger. This protocol describes the analysis of RNAi inheritance in C. elegans using a germline-expressed nuclear green fluorescent protein (GFP) reporter. Reporter silencing is initiated by feeding the animals bacteria expressing double-stranded RNA targeting GFP. At each generation, animals are passaged to maintain synchronized development, and reporter gene silencing is determined by microscopy. At select generations, populations are collected and processed for chromatin immunoprecipitation (ChIP)-quantitative polymerase chain reaction (qPCR) to measure histone modification enrichment at the GFP reporter locus. This protocol for studying RNAi inheritance can be easily modified and combined with other analyses to further investigate TEI factors in small RNA and chromatin pathways.

Author Spotlight: RNAi Inheritance and ChIP in C. elegans 

Analysis of Transgenerational Epigenetic Inheritance in C. elegans Using a Fluorescent Reporter and Chromatin Immunoprecipitation (ChIP)

Research in our lab examines how chromatin-associated proteins, histone modifications, and small RNA pathway factors work together in the context of development and transgenerational epigenetic inheritance. The RNA inheritance assay, using a GFP reporter, has become a very powerful tool. This protocol describes how to standardize the preparation, scoring, and passaging of worms, and the preparation of ChIP samples, which can help to generate reproducible results.One of the experimental challenges when studying germline-expressed transgenes is isolating the effects in the animal's germline. We're currently using whole animals for ChIP, but in the future we would like to develop assays to examine chromatin, specifically in the germline. Our laboratory is interested in histone methylation and proteins that recognize these marks.Going forward, we would like to investigate the interplay between these chromatin readers and small RNA pathways in the context of RNAi inheritance at transgenes and the regulation of endogenous sequences.

Animals carrying the germline-expressed GFP-histone H2B [mex-5p::gfp-h2b::tbb-2 3&#39;UTR]7 reporter (Figure 2A) were exposed to GFP RNAi or control RNAi by feeding, and passaged as described in the protocol and Figure 1. Nuclear GFP signal in the germline was manually scored using a fluorescence dissecting microscope for a sample of the population at each generation. Silencing of the transgene was fully penetrant in the scored P0 and F1 animals treated with GFP RNAi (Figure 2B). In the F2 generation, the proportion of the population exhibiting inheritance of GFP silencing was approximately 50%. By the F5 generation, the majority of the population did not show inheritance of silencing, and by the F10 generation, no inheritance was detected, as all the animals expressed GFP.
To determine the change in histone H3K9me3 enrichment corresponding to RNAi-induced silencing, ChIP-qPCR was performed on F1 generation animals following either GFP RNAi or control RNAi treatment. As expected, the GFP RNAi-treated population displayed higher histone H3K9me3 levels at the GFP target and at the 1.3 kb downstream region compared to control RNAi-treated animals (Figure 2C). The specificity of the histone H3K9me3 ChIP is supported by the enrichment at a positive control locus (clec-18) known to be enriched in this mark, but not at a nearby negative control locus (hrp-2). Histone H3 enrichment and near-background enrichment in the IgG control immunoprecipitations were also detected at all qPCR loci, as expected. When ChIP enrichment at the reporter is normalized to the clec-18 positive control locus, higher histone H3K9me3 enrichment upon GFP RNAi is shown, whereas histone H3 enrichment is similar between the control and GFP RNAi treatments (Figure 2D). Since GFP RNAi is not expected to affect histone H3K9me3 or total histone H3 occupancy at the clec-18 locus, this normalization mitigates against technical variation, such as differences in ChIP efficiency between the GFP RNAi and control RNAi samples. The fold-change of histone H3K9me3 and histone H3 levels between RNAi treatments shows GFP reporter-specific histone H3K9me3 enrichment, independent of histone occupancy, upon GFP RNAi-induced silencing (Figure 2E).
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65285/65285fig02.jpg" /> 
Figure 2: GFP RNAi-induced silencing corresponds to elevated H3K9me3 enrichment at the RNAi target. (A) Diagram of the germline-expressed GFP RNAi reporter mjIs134[mex-5p::gfp-h2b::tbb-2 3&#39;UTR] with qPCR amplicon regions labelled. (B) GFP expression scored across generations after RNAi treatments at 21 &#176;C. Error bars represent the standard deviation from two biological replicates. (C) ChIP-qPCR of H3K9me3, histone H3, and IgG control in F1 young adults from two biological replicates. clec-18 and hrp-2 are the positive and negative control loci for H3K9me3 enrichment, respectively. (D) H3K9me3 and histone H3 enrichment at the GFP RNAi reporter normalized to the clec-18 positive control locus. (E) Change in H3K9me3 and histone H3 enrichment between GFP RNAi- and control RNAi-treated animals, with normalization to clec-18. Dotted line represents a fold-change of 1. <a href="https://www.jove.com/files/ftp_upload/65285/65285fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about RNAi Inheritance and ChIP in C. elegans at JoVE.com

This protocol describes an RNA interference and ChIP assay to study the epigenetic inheritance of RNAi-induced silencing and associated chromatin modifications in C. elegans.

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through ...

analysis-transgenerational-epigenetic-inheritance-c-elegans-using

Research

JoVE Journal

Genetics

Bleaching and Plating Caenorhabditis elegans P0 Generation Embryos onto RNAi-NGM plates

Bleaching and Plating Caenorhabditis elegans P0 Generation Embryos onto RNAi-NGM plates  

Prepare animals for the RNAi inheritance assay by picking three or four gravid Caenorhabditis elegans adults under the 35 millimeter standard NGM plates seeded with OP50-1 bacteria. After four days, wash the gravid adult worms off the plates into 1.5 milliliter tubes using 800 microliters of M9 buffer supplemented with Triton X-100. Repeat the wash and pull the worms into one tube.After centrifuging the worms at 1, 000 G for 1.5 to two minutes, aspirate the supernatant leaving 100 microliters without disturbing the worm pellet. To each tube containing the worm pellet, add 650 microliters of double distilled water. To isolate the C.elegans embryos from the collected population, add 250 microliters of the freshly prepared bleaching solution and start a timer.Every one to two minutes, vortex the tubes thoroughly. After five minutes, monitor the degradation of adult worms under the stereoscope. Continue vortexing until the worms are completely dissolved and only embryos remain.This generally takes six to seven minutes. Immediately centrifuge the tubes at 1, 000 G for 1.5 minutes and aspirate the supernatant, leaving approximately 50 to 100 microliters of the supernatant with the embryos. Add one milliliter of M9 buffer supplemented with Triton X-100 to the embryos and vortex.Centrifuge the suspension and repeat the wash two times. After the final wash, aspirate the supernatant and leave approximately 100 microliters in the tube. Vortex the tubes with isolated embryos and pipette two microliters from each tube twice onto a labeled glass slide.Count the embryos using a tally counter to estimate the concentration of embryos per microliter. To start a semi-synchronized population growth, transfer approximately 250 embryos onto each RNAi NGM plate containing E.coli HT115 bacteria with GFP or control RNAi vectors. Allow the liquid to absorb.Incubate the P naught generation treated with RNAi for four days at 21 degrees Celsius.

Passaging and Scoring the Caenorhabditis elegans P0 Generation for Germline GFP Expression

Passaging and Scoring the Caenorhabditis elegans P0 Generation for Germline GFP Expression  

Begin preparing the agarose pads by placing a drop of melted 1%agarose onto the vinyl record using a glass Pasteur pipet. Orient a glass slide so that the lines on the record are horizontal or vertical, and place the slide quickly onto the agarose drop for 30 seconds. Remove the glass slide from the record and add approximately five microliters of freshly prepared five millimolar levamisole under the stereoscope.Gently flick the tube containing worms and transfer 5 to 10 microliters onto the agarose pad to mount the worms. Estimate the number of worms as they are being added so that there are approximately 40 worms per replicate. Line up the worms in rows using an eyelash pick, and place a glass coverslip onto the slide.Isolate the embryos from the remaining worms using the bleaching protocol and plate 250 embryos onto 35 millimeter NGM plates seeded with OP50-1 bacteria. Under the fluorescent stereoscope, use a GFP filter set and count and record the number of GFP positive and GFP negative worms on the slides for each replicate using a tally counter. The manual scoring of the nuclear GFP signal in the germline for each generation showed that the silencing of the transgene was fully penetrant in the scored P0 and F1 worms treated with GFP RNAi.In the F2 generation, the proportion of the population exhibiting inheritance of GFP silencing was approximately 50%By the F5 generation, the majority of the population did not show the inheritance of silencing. By the F10 generation, all the worms expressed GFP and no inheritance was detected.

Collection of F1 Generation Caenorhabditis elegans for Chromatin Immunoprecipitation (ChIP)

Collection of F1 Generation Caenorhabditis elegans for Chromatin Immunoprecipitation (ChIP)  

Begin by plating approximately 3, 500 C.elgans F1 generation embryos on 14 plates and allow them to grow to the young adult stage for three days at 21 degrees Celsius. Wash and collect the C.elgans into 1.5-milliliter tubes using PBS/TX. Centrifuge at 1000 G for two minutes, aspirate, and pull the worms from one strain into one tube.Repeat three washes with PBS/TX. Next, aspirate the supernatant leaving one milliliter in the tube and invert to mix. After counting the number of C.elgans worms in three microliters three times, calculate the concentration of worms and transfer a volume corresponding to 3000 worms to a new tube for formaldehyde cross-linking.

Formaldehyde Crosslinking of the F1 Generation of Caenorhabditis elegans for ChIP

Formaldehyde Crosslinking of the F1 Generation of Caenorhabditis elegans for ChIP  

Begin by adding formaldehyde to a 1.8%final concentration to the tube containing the worms and rotating the tube at room temperature for six minutes. Then immediately freeze the tubes in liquid nitrogen, and store the samples at 80 degrees Celsius. To proceed thaw the formaldehyde cross-link sample in a room temperature water bath for three minutes, and rotate the samples for 16 minutes at room temperature.At 1.25 molar glycine to a 125 millimolar final concentration, and rotate for five minutes at room temperature. Following this step, keep the samples on ice, or at four degrees, and use ice cold buffers until the magnetic bead elution. After centrifuging the sample at 1000 g for three minutes, wash it three times with one milliliter of PBSTX.Then wash it two times with one milliliter of Resuspension Buffer. After the last wash, leave enough Buffer to ensure the total volume is at least three times the pellet volume and a minimum of 100 microliters.

Sonication of Formaldehyde-Crosslinked Caenorhabditis elegans and Chromatin Immunoprecipitation

Sonication of Formaldehyde-Crosslinked Caenorhabditis elegans and Chromatin Immunoprecipitation  

Begin by mixing and aliquoting 90 to 120 microliters of the formaldehyde crosslinked C.Elegans samples into a polystyrene sonication tube. Add an equal volume of resuspension buffer containing 2X detergents. Sonicate in a water bath sonicator for seven minutes.Gently mix the sample by pipetting and repeat the sonication for an additional seven minutes. Once done, transfer the sonicated lysate to a 1.5 milliliter tube. Add a half volume of resuspension buffer without detergents.After centrifugation at 13, 000 G for 15 minutes at four degrees Celsius, divide the lysate supernatant into four parts. Store the input lysate part at minus 20 degrees Celsius in a 1.5 milliliter tube. Add 0.5 micrograms of anti-H3K9 trimethylation, anti-histone H3 or IgG to the appropriate immunoprecipitation or IP sample.Incubate the reaction at four degrees Celsius overnight with rotation. The following day, aliquot the nine microliters of protein G coated magnetic beads per IP sample in a 1.5 milliliter tube. After two washes with one milliliter of FA-150, resuspend the magnetic beads in the FA-150 buffer.Once done, add 7.5 microliters of the magnetic bead suspension to each IP antibody mix before incubating the tubes at four degrees Celsius for two hours with rotation. Next, wash the magnetic beads seven times using at least 200 microliters of each buffer solution. Incubate each wash at four degrees Celsius for five minutes with rotation before collecting the beads on a magnetic stand to aspirate the wash.After aspirating the last wash of the buffer, resuspend the magnetic beads in 50 microliters of chromatin IP elution buffer, and transfer it to a 1.5 milliliter tube. After eluting the sample in a ThermoMixer, collect the beads on a magnetic stand and transfer the supernatant to a new tube. Repeat the elution with another 50 microliters of chromatin immunoprecipitation elution buffer.Once done, pull a total of 100 microliters of supernatant before proceeding with reverse cross-linking and DNA elution.

1.6K Views.  University of Toronto.  This protocol describes an RNA interference and ChIP assay to study the epigenetic inheritance of RNAi-induced silencing and associated chromatin modifications in C. elegans.  

Epigenetic Inheritance and ChIP in Caenorhabditis elegans

Summary