Il lavoro descritto in questo protocollo è stato reso possibile da un finanziamento da parte del governo vittoriana come parte di un&#39;alleanza di collaborazione con l&#39;Istituto californiano per la medicina rigenerativa (CIRM).

Tutte le procedure sono eseguite in una cappa a flusso laminare sterile. Tutti i mezzi e le soluzioni sono equilibrati a 37 ° C se non diversamente specificato. 1 Espansione di PSC umani (hESC e hiPSCs, WA-09 utilizzato in questo protocollo) per la trasfezione Nota: Non è necessario espandere hESC su Matrigel o Geltrex. hESC espanse su fibroblasti embrionali di topo (MEF) possono essere utilizzati per elettroporazione o nucleofection a seguito di una fase di rimozione MEF (vedi sezione 2.8). <ol><li> Preparare 1 x 100 mm piatto e 1 x boccetta 75cm2 di DR4 MEF a 2,0 x 10 4 cellule per cm 2 in mezzi MEF (vedi Tabella 1) su piatti pre-rivestite con 0.1% w / v di gelatina. Nota: CF1, BLK6 o MF1 MEF può essere utilizzato, tuttavia, si consiglia di utilizzare le linee MEF resistenti agli antibiotici, per esempio, DR410. </li><li> Il giorno successivo, hESC passaggio su un piatto da 100 millimetri pre-placcato con MEF preparati in sezione 1.1. Per fare questo ASPItasso hESC supporti da culture piatti, lavare hESC con soluzione salina bilanciata Ca2 + / Mg2 + Hanks -free &#39;(HBSS), aggiungere dispasi (vedi Tabella 2 per volumi adeguati) e posto in un incubatore umidificato a 37 ° C / 5% di CO 2. Dopo 3-5 minuti di incubazione, aspirare dispasi e delicatamente lavare 1 - 2 volte con HBSS per rimuovere MEF. Aggiungere i media hESC (vedi tabella 3) e utilizzando un raschietto cellulare, o 5 ml pipetta, raschiare delicatamente le colonie sulla superficie del piatto cultura. </li><li> Raccogliere i frammenti di colonie in sospensione dal piatto di coltura in una provetta da centrifuga 15 ml. Piatto cultura Sciacquare con i media hESC e trasferimento al tubo da 15 ml. Fare attenzione a non rompere grumi in cellule singole o in piccoli frammenti. </li><li> Centrifugare per 5 minuti a 160 xg per far sedimentare frammenti di colonia. </li><li> Aspirare il surnatante. Toccare fondo della provetta 15 ml con il dito per allentare colonia frammento pellet. Frammenti di colonia delicatamente risospendere in hESC supporti in base al rapporto di divisione (normallya divisi rapporto tra 1: 4 e 1: 8 è appropriato). Fare molta attenzione a non rendere grumi nelle singole cellule o piccoli frammenti come questo influenzerà replating efficienza. </li><li> Prima di replating frammenti hESC sul MEF di lavaggio 1X con HBSS. Lentamente aggiungere una quantità appropriata (vedi Tabella 2) di sospensione cellulare contenente frammenti hESC nei media hESC ai piatti pre-placcati con MEF. </li><li> Posizionare piatti della cultura sulla mensola in incubatrice e muoversi lentamente avanti e indietro e un lato all&#39;altro per distribuire uniformemente frammenti di colonia. </li><li> Sostituire i media hESC quotidiana. </li><li> Per preparare mezzi condizionati dal MEF (MEF-CM) lavare 75 cm 2 fiasco pre-plated con MEF 1 x con HBSS. Aggiungi i media hESC. Dopo 24 ore, raccogliere condizionata media e sostituire con i media hESC fresca. Ripetere ogni giorno per un massimo di 12 giorni. Conservare MEF-CM a 4 ° C fino al momento dell&#39;uso. </li></ol> 2 Preparazione dei CES umane per la trasfezione <ol><li> Osservare la crescita di hESCsotto un microscopio giornaliero. Quando le colonie diventano 40-50% confluenti, la piastra 3 x 100 mm con piatti 2,0 x 10 5 MEF per cm 2. </li><li> Quando le colonie diventano 60 - 70% confluenti sono pronti per essere transfettate. &quot;Sposo&quot; colonie rimuovendo colonie differenziate o per anime colonia. Nota: Come crediamo maggiore trasfezione e l&#39;efficienza di targeting si verificano quando le cellule sono in fase di crescita di registro, si suggerisce di elettroporazione essere effettuati prima di hESC raggiungano ≥ 70% di confluenza. </li><li> Lavare colonie hESC con HBSS e aggiungere Accutase. Nota: Non è necessario hESCs pretrattare con inibitore ROCK Y-27632 inibizione sufficiente si verifica quando incubati con Y-27632 durante la fase 2.7 </li><li> Incubare per 10 - 20 min a 37 ° C / 5% di CO 2 fino colonie sono resi singole cellule come visto sotto un microscopio. Cellule Triturare con una pipetta 1 ml. </li><li> Aggiungi i media hESC e filtro in un tubo da 15 ml con un straine 40 micron cellar per rimuovere grumi di cellule. </li><li> Centrifugare a 160 xg per 5 min. Risospendere il pellet di cellule nei media hESC freschi e ripetere per rimuovere ogni residuo di soluzione Accutase. </li><li> Risospendere le cellule in mezzi hESC contenente 10 mM Y-27632 e trasferire la sospensione cellulare totale per un piatto 100 millimetri pre-rivestito con gelatina. </li><li> Incubare a 37 ° C / 5% di CO 2 per almeno 30 min. </li><li> Durante questo periodo MEF aderirà al piatto di gelatina rivestito. Raccogliere hESC non aderenti con una pipetta 1 ml in una nuova provetta da centrifuga 15 ml e determinare la densità delle cellule utilizzando un emocitometro. </li></ol> 3. Elettroporazione di hESC <ol><li> Supporti CM-MEF filtro con un filtro da 0,22 micron e aggiungere 10 ng / fattore di crescita dei fibroblasti ml ricombinante umano 2 (rhFGF2). </li><li> Trasferire 7,5 x 106 hESC da sezione 2.9 a un nuovo tubo da 15 ml e centrifugare a 160 xg per 5 min. </li><li> Durante questo tempo impostato il elettroporatore: Scegliere il programma per ele esponenzialectroporation e impostare i seguenti parametri, Tensione: 250 V, Capacità: 500 uF, e Resistance: ∞-. </li><li> Aspirare il surnatante e risospendere il pellet cellulare in 0,8 ml di ghiacciata 0,22 micron filtrato HBSS. Trasferire la soluzione in una sterile 0,4 centimetri elettroporazione cuvetta. </li><li> Aggiungere TV-hPITX3-forward il targeting costrutto (30 mg DNA) e mescolare delicatamente con una pipetta 200 microlitri. Incubare in ghiaccio per 5 min. Durante questo tempo togliere un&#39;aliquota di PITX3 ZFN mRNA e sbrinamento sul ghiaccio. Quando scongelato trasferimento di 7,5 ml di ZFN mRNA a DNA miscela / cellula elettroporazione cuvetta. Mescolare delicatamente con una pipetta 200 microlitri. Nota: Il locus nel mirino è il fattore principale che contribuisce alla efficienza di targeting. Codifica Loci geni silenti, i geni non espressi in CES, come PITX3 sono difficili da indirizzare utilizzando convenzionale ricombinazione omologa 6. Così, questo protocollo utilizza progettato su misura ZFNs per il locus PITX3 umano per indurre un DNA a doppio filamento break. </li><li> Elettroporazione seguendo le istruzioni sullo schermo sul elettroporatore. </li><li> Usando una pipetta 200 ml trasferire il contenuto della cuvetta elettroporazione ad una provetta da 15 ml contenente 10 ml supporti hESC. Lavare la cuvetta due volte con 200 ml di media hESC ogni volta e trasferire in una provetta da 15 ml. Ci saranno &quot;muco-come&quot; detriti costituito da DNA e proteine ​​dalle cellule lisate che avrà un impatto negativo la sopravvivenza delle cellule. Centrifugare a 160 xg per 5 minuti per rimuovere questi detriti. </li><li> Aspirare il surnatante e picchiettare delicatamente pellet di cellule per allentare. Risospendere in 30 ml completati MEF-CM contenenti 10 mM Y-27632 e replate composta da 3 x 100 mm preplated piatti con MEF. </li><li> Modificare i media giornaliera. Il giorno 2, Y-27632 può essere ritirata e cellule cresciute in soli mezzi hESC. </li><li> Dopo 2-3 giorni le hESC devono essere 50-70% confluenti. A questo punto iniziare selezione antibiotica (ad esempio, 0,5 mg / ml puromicina). </li><li> Mantenere selezione aggiungendo fresco dei media hESC / puromicina quotidiana. Dopo ~ 7 giorni piccole colonie dovrebbero essere visibili. Se non si utilizzano MEF resistenti agli antibiotici, MEF può essere completata con l&#39;aggiunta di un ulteriore 1,0 x 10 4 cellule per cm 2. </li></ol> 4. Picking cloni transgenici hESC <ol><li> Circa 14-21 giorni dopo la selezione (quando le colonie hanno raggiunto il diametro di circa 1 mm) preparano piatti per l&#39;espansione e lo screening. Inizia sbrinamento un&#39;aliquota di Matrigel o Geltrex a 4 ° C per un minimo di 5 ore. Diluire come da istruzioni del fabbricante e aggiungere 75 microlitri di ciascun pozzetto di piastre 3 x 96 pozzetti. Preparare piatti 3 x 48 pozzetti da placcatura MEF a 2,0 x 10 4 cellule per cm 2. Incubare entrambe le piastre O / N a 37 ° C / 5% di CO 2. </li><li> Il giorno seguente sezionare colonie in 16-25 parti usando un ago G 21 sulla estremità di una pipetta 2 ml tagliando una griglia. </li><li> Aspirare Matrigel da piastre da 96 pozzetti e sostituirlo con supplemsupporti ENTED CM-MEF. Lavare MEF in piastre 48 pozzetti 1 x con HBSS e aggiungere i media hESC. </li><li> Usando una pipetta 200 microlitri delicatamente trasferire un terzo della colonia sezionato in una piastra a 48 pozzetti per l&#39;espansione. Trasferire l&#39;altra 2/3 della colonia sezionato in una piastra a 96 pozzetti contenenti corrispondente completati supporti CM-MEF. </li><li> Mantenere entrambe le piastre cambiando media giornaliera (integrato multimediale CM-MEF per Matrigel piastre rivestite da 96 pozzetti e hESC supporti per le piastre 48 pozzetti contenenti MEF, entrambi integrati con 0,5 mg / ml puromicina). </li><li> Espandere fino piastre a 96 pozzetti sono al 100% confluenti e quindi inizialmente schermo tramite PCR. </li></ol> 5. Screening ed espansione di cloni positivi <ol><li> Per preparare il DNA genomico (metodo basato su 11) Rimuovere qualsiasi supporto dalle lastre invertendo, quindi asciugare su carta assorbente. </li><li> Lavare ogni pozzetto due volte con PBS RT (100 l / pozzetto ogni lavaggio), invertito e macchia come per il passo 5.1. Posizionare le piastre a -80 ° C fo 1 - 2 ore per aiutare a lisi cellulare (piastre possono essere conservate a tempo indeterminato come questo). </li><li> Mentre le cellule sono a -80 ° C fare sarcosyl Lysis Buffer (vedi tabella 4) (50 ml / pozzetto). Per lisare cellule, piatti caldi per 5 minuti a temperatura ambiente poi tampone di lisi pipetta in ciascun pozzetto. Sigillare i bordi di ogni piatto con del nastro, posto in un contenitore sigillabile contenente tovaglioli di carta umidi per creare l&#39;umidità, e incubare O / N a 60 ° C. </li><li> Dopo l&#39;incubazione aggiungere 150 ml di NaCl 5M a 10 ml di -20 ° C etanolo assoluto, mescolare bene e aggiungere 100 ml a ciascun pozzetto (Nota: etanolo andrà nuvoloso quando viene aggiunto NaCl). Piastre Toccare delicatamente per mescolare (non pipetta) e lasciare per un minimo di 30 minuti a temperatura ambiente. Durante questo tempo la soluzione andrà chiaro e il DNA viene precipitato. </li><li> Rimuovere la soluzione come al punto 5.1 quindi aggiungere 150 ml di etanolo al 70% in ogni pozzetto. Capovolgere piastra delicatamente e asciugare come prima. Ripetere questa operazione un ulteriore 2x. Nota: Poiché il DNA precipitato naturalmente aderes per la plastica coltura di tessuti non diventa sloggiato durante queste fasi di lavaggio.) </li><li> Dopo l&#39;ultimo lavaggio piatti brevemente centrifugare alla massima velocità per concentrare il DNA al fondo di ciascun pozzetto poi asciugare a temperatura ambiente (o 37 ° C) per almeno 30 min. </li><li> Aggiungere 40 - 50 ml T0.1E (pH8.0) (vedi tabella 5) o TE (pH8.0) ad ogni pozzetto e posizionare le piastre a 65 ° C per 1 ora o al 4 ° CO / N prima di utilizzare per la PCR. Risospendere il DNA toccando delicatamente i lati della piastra. Utilizzare 1-2 ml di ri-sospensione DNA / 10 microlitri reazione PCR. </li><li> Utilizzando il Expand lunga Template PCR con hPITX3 L braccio gen. F e hPITX3 L primer braccio GFP R eseguono lo screening iniziale di cloni a 58 ° C ricottura, 45 sec estensione, 35 cicli. </li><li> Campioni elettroforesi con 1kb Hyperladder in un gel di agarosio 1% contenente GelRed a 100 V per 45 minuti e rilevare cloni positivi mediante illuminazione UV. </li><li> Convalidare PCR cloni positivi per digestione del DNA genomico da Expacloni nded (vedi sotto) con HindIII e ibridazione sonde 5 &#39;e 3&#39; dei bracci vettore omologia con un Southern blot (come descritto in precedenza al punto 1). Le sonde sono generati mediante PCR utilizzando coppie di primer hPITX3 5 &#39;della sonda F e R, e hPITX3 3&#39; della sonda F e R, digerito con EcoRI e ligato in un vettore generale clonazione. </li><li> A seconda del numero di cloni positivi, preparare due pozzetti di una piastra da 6 pozzetti pre-placcatura con MEF (2,0 x 10 4 cellule per cm 2). </li><li> Il giorno successivo pretrattare cloni positivi nella piastra a 48 pozzetti con 10 mM Y-27632 per un minimo di 1 ora. </li><li> Lavare cloni positivi con HBSS e aggiungere 300 ml di Accutase. </li><li> Quando le colonie sono resi singole cellule, aggiungere 1 ml di media hESC e raccogliere in una provetta da 15 ml. </li><li> Modificare i media giornaliera. Il giorno 2, Y-27632 può essere ritirato e le cellule coltivate in hESC media. </li><li> Quando le colonie sono il 70 - 80% confluenti, sottocultura e congelare il resto della coloframmenti di NY. </li></ol>

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

Gli autori non hanno nulla da rivelare.

La generazione di linee cellulari giornalista offre un potente mezzo per monitorare, visualizzare e isolare le cellule di interesse da una popolazione eterogenea derivato da hESC. Tuttavia, gene targeting via convenzionale ricombinazione omologa ha dimostrato di essere estremamente inefficiente per CES umani 3. In questo protocollo si descrive una tecnica relativamente semplice per l&#39;introduzione di una RP in esone uno dei locus PITX3, in hESC utilizzando un vettore targeting ampiamente disponibi...

Cellule staminali embrionali (ESC) protocolli di differenziazione correnti provocano popolazioni cellulari eterogenee, soprattutto per quanto riguarda la derivazione di specifici fenotipi neuronali. Così, anche se le culture contengono il fenotipo cellulare desiderato, altro neuronale, tipi di cellule non-neuronali e non-differenziati sono spesso presenti 1. Queste caratteristiche limitano l&#39;applicazione del CES derivato fonti di cellule per l&#39;uso in terapia di sostituzione cellulare e nella modellazione delle malattie vitro. Linee cellulari giornalista genetici offrono un mezzo per visualizzare, monitorare e isolare le cellule di interesse, a condizione che l&#39;espressione della proteina reporter (RP) riproduce l&#39;espressione endogena. L&#39;uso di promotori immediatamente a monte di una regione del gene codificante può essere usata per derivare reporter genetici grezzi ma tali costrutti mancano i precisi elementi regolatori che controllano l&#39;espressione del gene endogeno. Al contrario, la ricombinazione omologa offre laopportunità di garantire l&#39;espressione ad alta fedeltà del RP. In passato, il targeting vettori progettati per ricombinazione omologa a specifici loci di interesse sono stati utilizzati per RP di topo (CES mESCs) bersaglio utilizzando elettroporazione come mezzo di consegna DNA 1,2. Tuttavia la generazione di linee cellulari giornalista via convenzionale ricombinazione omologa è estremamente inefficiente per CES umane (hESC), e, quindi, è stata documentata solo in una manciata di casi (recensito in 3). Utilizzando una proteina chimerica ingegneria contenente una fusione di una nucleasi Fok I con motivi zinc-finger site-specific, conosciuti collettivamente come zinc-finger nucleasi (ZFNs), DNA rotture del doppio filamento possono essere introdotti a livello pre-determinati loci genomici. Quando si aggiunge un vettore di DNA con omologia a entrambi i lati del DNA rottura a doppio filamento, il sito genomico può essere riparato tramite ricombinazione omologa, consentendo l&#39;inserimento della sequenza di DNA donatore. Questa tecnica si è dimostrata utile fo editing genomico in cellule primarie umane 4,5 e 6,7 hESC. Più recente lavoro ha utilizzato trascrizione attivatore-come effettrici nucleasi (Talens), fattori di trascrizione utilizzati da impianti patogeni 8, per aiutare nella progettazione di site-specific nucleasi 9. Nel seguente protocollo dimostriamo la generazione di una linea cellulare hESC giornalista da elettroporazione di un EGFP contenente omologa vettore targeting 6 insieme ZFNs per l&#39;homeobox pituitaria umana 3 (PITX3) locus. Dopo la selezione antibiotica per 2-3 settimane, hESC con il DNA integrato correttamente possono essere raccolti manualmente, ampliati e proiettati inizialmente tramite PCR, e successivamente convalidati da Southern blotting.

<table border="0" cellpadding="0" cellspacing="0" width="883">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Mouse Embryonic Fibroblasts (DR4)</td>
			<td style="width:207px;">GlobalStem</td>
			<td style="width:119px;">GSC-6004G</td>
			<td style="width:67px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gelatin</td>
			<td style="width:207px;">Sigma</td>
			<td style="width:119px;">G1393-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">14175-095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dispase</td>
			<td style="width:207px;">StemCell Technologies</td>
			<td style="width:119px;">7923</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Cell Scraper</td>
			<td style="width:207px;">Corning</td>
			<td style="width:119px;">3008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Accutase</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A11105-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y27632</td>
			<td style="width:207px;">Axon Medchem</td>
			<td style="width:119px;">Axon 1683</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer - 40um</td>
			<td>BD Biosciences</td>
			<td>352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">33mm - 0.22 um filter</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:119px;">SLGP033RS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">rhFGF2</td>
			<td style="width:207px;">R&#38;D Systems</td>
			<td>233-FB-025/CF</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Electroporator</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">0.4cm electroporation cuvette</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2088</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Human TV-hPITX3-forward targeting construct</td>
			<td style="width:207px;">Addgene</td>
			<td style="width:119px;">31942</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:491px;">ZFN Kit; Human PITX3</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">CKOZFN1050-1KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Puromycin</td>
			<td style="width:207px;">Invivogen</td>
			<td style="width:119px;">ant-pr-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel</td>
			<td style="width:207px;">BD Biosciences</td>
			<td>354277</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Geltrex</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A1569601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">NaCl</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">16140-071</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Pen/Strep</td>
			<td style="width:207px;">Life Technologies</td>
			<td>15070-063</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11320-033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">KnockOut Serum Replacement (KSR)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10828-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">MEM Non-Essential Amino Acids&#160; (NEAA)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11140-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">GlutaMAX</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">35050-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">&#223;-mercaptoethanol</td>
			<td style="width:207px;">Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">61747</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">EDTA</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td><a href="http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;region=US">E9884</a></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Trizma Hydrochloride</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K solution (20mg/ml)</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Expand Long Template PCR System</td>
			<td style="width:207px;">Roche Australia</td>
			<td style="width:119px;">11681834001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">hPITX3 L arm gen. F (primer): 5&#8217; TGTCCTAAGGAGAATGGGTAACAGACA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">hPITX3 L arm GFP R (primer): 5&#8217; ACACGCTGAACTTGTGGCCGTTTA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HyperLadder 1kb&#160;</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-33025</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">GelRed</td>
			<td style="width:207px;">Jomar Bioscience, Australia</td>
			<td style="width:119px;">41003</td>
			<td></td>
		</tr>
	</tbody>
</table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

Una limitazione importante con cellule staminali embrionali (ESC) protocolli di differenziazione attuali è la generazione di popolazioni cellulari eterogenee. Queste culture contengono le cellule di interesse, ma sono anche contaminati con i CES indifferenziate, derivati ​​non-neurali e altri sottotipi neuronali. Questo limita il loro uso in vitro ed in vivo applicazioni, come la modellazione in vitro per la scoperta di farmaci o terapia di sostituzione cellulare. Per aiutare a superare questo, linee cellulari giornalista, che offrono un mezzo per visualizzare, monitorare e isolare le cellule di interesse, possono essere progettati. Tuttavia, per raggiungere questo obiettivo in cellule staminali embrionali umane via convenzionale ricombinazione omologa è estremamente inefficiente. Questo protocollo descrive il targeting della homeobox pituitaria 3 (PITX3) locus in cellule staminali embrionali umane utilizzando progettati su misura nucleasi zinc-finger, che introducono site-specific doppio filamento rotture del DNA, insieme ad unPITX3 - EGFP -specifica vettore donatore del DNA. Dopo la generazione della linea cellulare PITX3 giornalista, può quindi essere differenziato utilizzando protocolli pubblicati da utilizzare in studi in vitro come modelli di malattia o terapia di sostituzione cellulare di Parkinson.

A seguito di co-elettroporazione della PITX3 coppia zinc-finger personalizzato progettato insieme al PITX3 - EGFP DNA -specifica donatore vettore, e la successiva selezione puromicina, hESC cloni positivi sono stati inizialmente rilevati tramite lo screening genomico PCR (Figura 1). Southern blot ibridazione di questi cloni positivi PCR con 5 &#39;e 3&#39; sonde specifiche confermato corretto il targeting to esone 1 del locus PITX3 (Figura 2), con un ...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Linee cellulari Reporter offrono un mezzo per visualizzare, monitorare e isolare le cellule di interesse da popolazioni eterogenee. Tuttavia,-gene targeting utilizzando convenzionale ricombinazione omologa in cellule staminali embrionali umane è estremamente inefficiente. Qui, descriviamo il targeting CNS mesencefalo specifico PITX3 locus fattore di trascrizione con EGFP utilizzando zinc-finger nucleasi avanzata ricombinazione omologa.

Zinc-finger nucleasi avanzata gene targeting in cellule staminali embrionali umane

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

zinc-finger-nuclease-enhanced-gene-targeting-human-embryonic-stem

Research

JoVE Journal

Biology

10.7K Views.  Monash University.  Linee cellulari Reporter offrono un mezzo per visualizzare, monitorare e isolare le cellule di interesse da popolazioni eterogenee. Tuttavia,-gene targeting utilizzando convenzionale ricombinazione omologa in cellule staminali embrionali umane è estremamente inefficiente. Qui, descriviamo il targeting CNS mesencefalo specifico PITX3 locus fattore di trascrizione con EGFP utilizzando zinc-finger nucleasi avanzata ricombinazione omologa. 

Video: Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Propagation of Human Embryonic Stem (ES) Cells

Propagation of Human Embryonic Stem ES Cells

Propagazione di staminali embrionali umane (ES) Cellule

Ricerca

Biologia

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Derivazione di cellule staminali embrionali umane da Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

Sondaggio per mitocondriale complessa attività di cellule staminali embrionali umane

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro e in Imaging bioluminescenza gene reporter in vivo di cellule staminali embrionali umane

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

Immunoprecipitazione della cromatina di cellule staminali embrionali umane

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

In vitro Labeling of Human Embryonic Stem Cells for Magnetic Resonance Imaging

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of the predominant imaging modalities to assess the restoration of the injured myocardium. Furthermore, ex-vivo labeling agents, such as iron-oxide nanoparticles, have been employed to track and localize the transplanted stem cells. However, this method does not monitor a fundamental cellular biology property regarding the viability of transplanted cells. It has been known that manganese chloride (MnCl2) enters the cells via voltage-gated calcium (Ca2+) channels when the cells are biologically active, and accumulates intracellularly to generate T1 shortening effect. Therefore, we suggest that manganese-guided MRI can be useful to monitor cell viability after the transplantation of hESC into the myocardium.
In this video, we will show how to label hESC with MnCl2 and how those cells can be clearly seen by using MRI in vitro. At the same time, biological activity of Ca2+-channels will be modulated utilizing both Ca2+-channel agonist and antagonist to evaluate concomitant signal changes.

In this video, we are showing how to label human embryonic stem cells (hESC) with manganese chloride (MnCl2) which can enter cells via voltage-gated calcium channels when the cells are biologically active. Additionally, we show the use of MnCl2 as cellular MRI contrast agent to determine the in vitro viability of hESC.

Etichettatura in vitro di cellule staminali embrionali umane per la Risonanza Magnetica

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of ...

Culture and Maintenance of Human Embryonic Stem Cells  

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be  fed  every day by performing a complete medium change to replenish lost nutrients and to keep the cultures free of unwanted differentiation factors. Although a small amount of differentiation is normal and expected in stem cell cultures, the culture should be routinely cleaned up by manually removing, or "picking" differentiated areas. Identifying and removing excess differentiation from hES cell cultures are essential techniques in the maintenance of a healthy population of cells.

Culture and Maintenance of Human Embryonic Stem Cells

This protocol demonstrates how to maintain healthy, undifferentiated human embryonic stem (ES) cells.

Cultura e manutenzione di cellule staminali embrionali umane

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Freezing and Thawing Human Embryonic Stem Cells

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Congelamento e scongelamento cellule staminali embrionali umane

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Differenziazione delle cellule staminali embrionali in precursori degli oligodendrociti

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.